NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION. Ana M. Martinez
|
|
- Austin Sims
- 5 years ago
- Views:
Transcription
1 NOVEL FUNCTION OF mirnas IN REGULATING GENE EXPRESSION Ana M. Martinez
2 Switching from Repression to Activation: MicroRNAs can Up-Regulate Translation. Shoba Vasudevan, Yingchun Tong, Joan A. Steitz AU-rich elements (ARE) and microrna target sites are conserved sequences in mrna 3 UTR that control gene expression posttranscriptionally. Upon cell cycle arrest (G1 phase by serum starvation), the ARE in tumor necrosis factor a (TNFa) mrna is transformed into a translation activation signal, recruiting Argonaute (AGO) and fragile X mental retardation related protein 1 (FXR1).
3 PURPOSE 1. To identify if the binding of the AGO2-FXR1 complex that activates translation is directed by a mirna complementary to the ARE. 2. To see if micro-ribonucleoproteins (micrornps) can in general up regulate translation under growth-arrest conditions, thereby switching between repressing and activating roles in response to the cell cycle.
4 Human mir369-3 Its seed sequence is complementary to the 2 target sites (seed 1and 2) within the minimal TNFa ARE needed for translation activation of the luciferase reporter. Expression of the mirna is reduced in serum-grown cells. It is necessary for translation up-regulation of the ARE reporter.
5 mir369-3 associates with TNFa to upregulate translation by direct base pairing in the ARE region
6 Distinguishing translation repression HeLa cells were subjected to serum starvation and the released into serum growth conditions for 18 hours, which results in synchronous proliferation (in late S/G2 phase).
7 RNP purification of the aptamer-tagged ARE and mtare reporters show that requirement of the three proteins in the ARE for translation activation. Knockdown Experiments show that HMGA2 translation upregulation is also dependent on the presence of FXR1 and AGO2.
8 MicroRNA-373 induces expression of genes with complementary promoter sequences. Robert F. Place, Long-Cheng Li, Deepa Pookot, Emily J. Noonan and Rajvir Dahiya mirna controls up-regulation of gene expression by binding to complementary sequences on promoters. By scanning promoters in silico for sequences complementary to known mirnas, they found a putative mir-373 target within promoters of E- Cadherin and Cold-shock domain-containing protein C2(CSDC2) as well as many other proteins.
9 mirna-373 target sites on promoters of E-Cadherin and CSDC2
10 Synthesized the native mature duplex mir-373 and another dsrna molecule (dsecad-640) fully complementary to the mir-373 target site. Immunoblot analysis confirmed induction of E-Cadherin.
11 Up-Regulation of CSDC2 by mir-373 Determined that mir-373 acts in pleitropic manner, up-regulating gene expression of multiple genes.
12 Biogenesis of pre-mir373 by Dicer is required to induce E-Cadherin expression.
13 Enrichment of RNA Polymerase II at mir-373-targeted gene Promoters Performed ChiP assays, using an antibody specific to RNApII. Mapped Three regions corresponding to the transcription start sites of E-Cadherin and CSDC2.
14 Synthesis of two mir-373 mutants indicate that induction of E-Cadherin and CSDC2 is specific to the sequence of mir-373
15 Conclusion mirnas apart from repressing gene expression or degrading complementary mrna, can up-regulate translation of proteins by complementary base pairing with ARE in 3 UTRs of mrnas and recruiting the AGO2-FXR1 complex. Gene expression is also achieved by mirnas binding to complementary sequences in promoters of genes.
mirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationBi 8 Lecture 17. interference. Ellen Rothenberg 1 March 2016
Bi 8 Lecture 17 REGulation by RNA interference Ellen Rothenberg 1 March 2016 Protein is not the only regulatory molecule affecting gene expression: RNA itself can be negative regulator RNA does not need
More informationCircular RNAs (circrnas) act a stable mirna sponges
Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding
More informationCellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions. 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19
Cellular MicroRNA and P Bodies Modulate Host-HIV-1 Interactions 指導教授 : 張麗冠博士 演講者 : 黃柄翰 Date: 2009/10/19 1 MicroRNA biogenesis 1. Pri mirna: primary mirna 2. Drosha: RNaseIII 3. DCR 1: Dicer 1 RNaseIII
More informationMicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationSelective filtering defect at the axon initial segment in Alzheimer s disease mouse models. Yu Wu
Selective filtering defect at the axon initial segment in Alzheimer s disease mouse models Yu Wu Alzheimer s Disease (AD) Mouse models: APP/PS1, PS1δE9, APPswe, hps1 Wirths, O. et al, Acta neuropathologica
More informationMicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
More informationUtility of Circulating micrornas in Cardiovascular Disease
Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating
More informationMarta Puerto Plasencia. microrna sponges
Marta Puerto Plasencia microrna sponges Introduction microrna CircularRNA Publications Conclusions The most well-studied regions in the human genome belong to proteincoding genes. Coding exons are 1.5%
More informationChapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
More informationV16: involvement of micrornas in GRNs
What are micrornas? V16: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,
More informationAlternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
More informationHigh AU content: a signature of upregulated mirna in cardiac diseases
https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High
More informationCancer Problems in Indonesia
mirna and Cancer : mirna as a Key Regulator in Cancer Sofia Mubarika 2 nd Symposium Biomolecular Update in Cancer PERABOI Padang 18 Mei 2013 Cancer Problems in Indonesia 1. Chemoresistency / recurrency
More informationPost-transcriptional regulation of an intronic microrna
Post-transcriptional regulation of an intronic microrna Carl Novina Dana-Farber Cancer Institute Harvard Medical School Broad Institute of Harvard and MIT Qiagen Webinar 05-17-11 Outline 1. The biology
More informationSupplementary information
Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun
More informationIntrinsic cellular defenses against virus infection
Intrinsic cellular defenses against virus infection Detection of virus infection Host cell response to virus infection Interferons: structure and synthesis Induction of antiviral activity Viral defenses
More informationMicroRNAs and Cancer
MicroRNAs and Cancer MicroRNAs are an abundant class of small (20-25 nucleotides) non-protein coding RNAs that function as negative gene regulators. The human genome contains up to 1000 micrornas which
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationhe micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003)
MicroRNAs: Genomics, Biogenesis, Mechanism, and Function (D. Bartel Cell 2004) he micrornas of Caenorhabditis elegans (Lim et al. Genes & Development 2003) Vertebrate MicroRNA Genes (Lim et al. Science
More informationPhenomena first observed in petunia
Vectors for RNAi Phenomena first observed in petunia Attempted to overexpress chalone synthase (anthrocyanin pigment gene) in petunia. (trying to darken flower color) Caused the loss of pigment. Bill Douherty
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for
More informationMicroRNAs, RNA Modifications, RNA Editing. Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM
MicroRNAs, RNA Modifications, RNA Editing Bora E. Baysal MD, PhD Oncology for Scientists Lecture Tue, Oct 17, 2017, 3:30 PM - 5:00 PM Expanding world of RNAs mrna, messenger RNA (~20,000) trna, transfer
More informationMolecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes
Molecular Cell Biology - Problem Drill 10: Gene Expression in Eukaryotes Question No. 1 of 10 1. Which of the following statements about gene expression control in eukaryotes is correct? Question #1 (A)
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing Jakub Orzechowski Westholm (1) Long- term bioinforma=cs support, Science For Life Laboratory Stockholm (2) Department of Biophysics and Biochemistry,
More informationProkaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationSupplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
More informationDNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
More informationNovel RNAs along the Pathway of Gene Expression. (or, The Expanding Universe of Small RNAs)
Novel RNAs along the Pathway of Gene Expression (or, The Expanding Universe of Small RNAs) Central Dogma DNA RNA Protein replication transcription translation Central Dogma DNA RNA Spliced RNA Protein
More informationCross species analysis of genomics data. Computational Prediction of mirnas and their targets
02-716 Cross species analysis of genomics data Computational Prediction of mirnas and their targets Outline Introduction Brief history mirna Biogenesis Why Computational Methods? Computational Methods
More informationGenetic Studies of Human Hematopoiesis
Genetic Studies of Human Hematopoiesis Vijay G. Sankaran, M.D., Ph.D. sankaran@broadinstitute.org @bloodgenes August 23, 2018 SWISSTRANSFUSION 2018 A Perspective on Hematopoiesis Laurenti & Gottgens, Nature,
More informationMicroRNAs: Regulatory Function and Potential for Gene Therapy
Lidia Park Genomics and Medicine November 23, 2008 MicroRNAs: Regulatory Function and Potential for Gene Therapy When Victor Ambros, Rosalind Lee, and Rhonda Feinbaum published the first finding of a microrna,
More informationAn Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival
An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationmrna cis Elements Located in Non-Protein-Coding Regions
mrna cis Elements Located in Non-Protein-Coding Regions IRP Repressor mirnas Bcd/4EHP Repressor cap 5 Leader ORF 3 UTR (A) n eif4e/4e-bp 2 o structure uorf eif2α kinases Localization Transcript-independent
More informationmicrorna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
More informationmicro-rnas as biomarkers in children who underwent surgery for CHD
micro-rnas as biomarkers in children who underwent surgery for CHD mentors: Dr. Yael Nevo-Caspi & Prof. Gidi Paret Or Bercovich Liat Mor What will we talk about Congenital heart defects (CHD) Scientific
More informationChapter 10 - Post-transcriptional Gene Control
Chapter 10 - Post-transcriptional Gene Control Chapter 10 - Post-transcriptional Gene Control 10.1 Processing of Eukaryotic Pre-mRNA 10.2 Regulation of Pre-mRNA Processing 10.3 Transport of mrna Across
More informationTITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
More informationMicroRNAs: novel regulators in skin research
MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,
More informationReduced Expression of Ribosomal Proteins Relieves MicroRNA-Mediated Repression
Article Reduced Expression of Ribosomal Proteins Relieves MicroRNA-Mediated Repression Maja M. Janas,,, Eric Wang, 5,6 Tara Love,,,,8 Abigail S. Harris, 7 Kristen Stevenson, Karlheinz Semmelmann, 7 Jonathan
More informationGENE EXPRESSION AND microrna PROFILING IN LYMPHOMAS. AN INTEGRATIVE GENOMICS ANALYSIS
GENE EXPRESSION AND microrna PROFILING IN LYMPHOMAS. AN INTEGRATIVE GENOMICS ANALYSIS Dra. Margarita Sánchez-Beato Lymphoma Group Molecular Pathology Programme CNIO Agilent Microarray and Sequencing Roadshow,
More informationAssaying micrornas in biofluids for detection of drug induced cardiac injury. HESI Annual Meeting State of the Science Session June 8, 2011
Assaying micrornas in biofluids for detection of drug induced cardiac injury HESI Annual Meeting State of the Science Session June 8, 2011 Karol Thompson, PhD Center for Drug Evaluation & Research US Food
More informationTranscriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
More informationThe Viral and Cellular MicroRNA Targetome in Lymphoblastoid Cell Lines
The Viral and Cellular MicroRNA Targetome in Lymphoblastoid Cell Lines Rebecca L. Skalsky 1, David L. Corcoran 2, Eva Gottwein 3, Christopher L. Frank 1, Dong Kang 1, Markus Hafner 4, Jeffrey D. Nusbaum
More informationmirnas as Biomarkers for Diagnosis and Assessment of Prognosis of Coronary Artery Disease
Open Journal of Internal Medicine, 2018, 8, 54-63 http://www.scirp.org/journal/ojim ISSN Online: 2162-5980 ISSN Print: 2162-5972 mirnas as Biomarkers for Diagnosis and Assessment of Prognosis of Coronary
More informationIPA Advanced Training Course
IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationGene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
More informationTHE EFFECT OF HSA-MIR-105 ON PROSTATE CANCER GROWTH
THE EFFECT OF HSA-MIR-105 ON PROSTATE CANCER GROWTH by David Rice Honeywell Bachelor of Science, Queen s University, 2010 THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER
More informationResearch Article Base Composition Characteristics of Mammalian mirnas
Journal of Nucleic Acids Volume 2013, Article ID 951570, 6 pages http://dx.doi.org/10.1155/2013/951570 Research Article Base Composition Characteristics of Mammalian mirnas Bin Wang Department of Chemistry,
More informationMicroRNAs: molecular features and role in cancer.
MicroRNAs: molecular features and role in cancer. Elodie Lages, Hélène Ipas, Audrey Guttin, Houssam Nesr, François Berger, Jean-Paul Issartel To cite this version: Elodie Lages, Hélène Ipas, Audrey Guttin,
More informationComputational Analysis of mirna and Target mrna Interactions: Combined Effects of The Quantity and Quality of Their Binding Sites *
www.pibb.ac.cn!"#$%!""&'( Progress in Biochemistry and Biophysics 2009, 36(5): 608~615 Computational Analysis of mirna and Target mrna Interactions: Combined Effects of The Quantity and Quality of Their
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/2/1/ra81/dc1 Supplementary Materials for Delivery of MicroRNA-126 by Apoptotic Bodies Induces CXCL12- Dependent Vascular Protection Alma Zernecke,* Kiril Bidzhekov,
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationP. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop,
Supplemental Data A Genetic Screen Implicates mirna-372 and mirna-373 As Oncogenes in Testicular Germ Cell Tumors P. Mathijs Voorhoeve, Carlos le Sage, Mariette Schrier, Ad J.M. Gillis, Hans Stoop, Remco
More informationHuman Genome: Mapping, Sequencing Techniques, Diseases
Human Genome: Mapping, Sequencing Techniques, Diseases Lecture 4 BINF 7580 Fall 2005 1 Let us review what we talked about at the previous lecture. Please,... 2 The central dogma states that the transfer
More informationCRS4 Seminar series. Inferring the functional role of micrornas from gene expression data CRS4. Biomedicine. Bioinformatics. Paolo Uva July 11, 2012
CRS4 Seminar series Inferring the functional role of micrornas from gene expression data CRS4 Biomedicine Bioinformatics Paolo Uva July 11, 2012 Partners Pharmaceutical company Fondazione San Raffaele,
More informationMicroRNAs: a new source of biomarkers in radiation response. Simone Moertl, Helmholtz Centre Munich
MicroRNAs: a new source of biomarkers in radiation response Simone Moertl, Helmholtz Centre Munich The RNA World mrna rrna coding snorna trna scarna RNA snrna noncoding lincrna rasirna RNAi anti-sense
More informationMolecular Mechanism of MicroRNA-203 Mediated Epidermal Stem Cell Differentiation
University of Colorado, Boulder CU Scholar Undergraduate Honors Theses Honors Program Spring 2011 Molecular Mechanism of MicroRNA-203 Mediated Epidermal Stem Cell Differentiation Sarah Jackson University
More informationMorphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
More information10/31/2017. micrornas and cancer. From the one gene-one enzyme hypothesis to. microrna DNA RNA. Transcription factors.
micrornas and cancer Cellular and Molecular Biology of Cancer (PATH G4500-001) November 1 st, 2017 -Katia Basso- Columbia University Katia Basso, PhD Office: ICRC RM506 E-mail: kb451@cumc.columbia.edu
More informationMicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee
MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -
More informationInteraktionen von RNAs und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig May 5, 2017 RNA-protein binding vs. DNA-protein binding Is binding of proteins to RNA the same as binding of proteins to DNA? Will the same rules
More informationThe Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure
More informationThe Blueprint of Life: DNA to Protein
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA
More informationSTAT1 regulates microrna transcription in interferon γ stimulated HeLa cells
CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin
More informationMICRORNA-MEDIATED REGULATION AND THE FRAGILE X FAMILY OF PROTEINS ANNE ELIZABETH CHEEVER DISSERTATION
MICRORNA-MEDIATED REGULATION AND THE FRAGILE X FAMILY OF PROTEINS BY ANNE ELIZABETH CHEEVER DISSERTATION Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Cell
More informationPlasticity at the synapse A role for micrornas
Plasticity at the synapse A role for micrornas Anil Ori Universiteit Utrecht Biology of Disease 04-07-2011 Table of contents 1. Preface... 3 2. Abstract... 4 3. Background... 5 4. Neurons and their synapses...
More informationAlan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design
Alan Weiner BIOCHEM 530 Friday, MEB 248 October 23, 2015 RNA structure, the ribosome, structure-based drug design Crick's "Central Dogma"? DNA makes RNA makes protein Crick's "Central Dogma"? DNA makes
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationPrediction of micrornas and their targets
Prediction of micrornas and their targets Introduction Brief history mirna Biogenesis Computational Methods Mature and precursor mirna prediction mirna target gene prediction Summary micrornas? RNA can
More informationStudy of mirna based gene regulation involved in Squamous Lung Carcinoma by assistance of Argonaute Protein
January - February 2018; 7(1): 2913-2917 International Journal of Research and Development in Pharmacy & Life Science An International open access peer reviewed journal ISSN (P): 2393-932X, ISSN (E): 2278-0238
More informationIdentification of mirnas in Eucalyptus globulus Plant by Computational Methods
International Journal of Pharmaceutical Science Invention ISSN (Online): 2319 6718, ISSN (Print): 2319 670X Volume 2 Issue 5 May 2013 PP.70-74 Identification of mirnas in Eucalyptus globulus Plant by Computational
More informationRNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
More informationProfiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
More informationOver the past decade, it has become progressively more
Reviews Methodological Reviews discuss methods that are of broad interest to the community of cardiovascular investigators and that enable a better understanding of cardiovascular biology, particularly
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationWidespread regulation of mirna biogenesis at the Dicer step by the cold-inducible RNA-binding protein, RBM3
University of Kentucky UKnowledge Rehabilitation Sciences Faculty Publications Rehabilitation Sciences 12-1-2011 Widespread regulation of mirna biogenesis at the Dicer step by the cold-inducible RNA-binding
More informationa) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,
Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted
More informationDeciphering the Role of micrornas in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma
www.bioinformation.net Volume 13(6) Hypothesis Deciphering the Role of micrornas in BRD4-NUT Fusion Gene Induced NUT Midline Carcinoma Ekta Pathak 1, Bhavya 1, Divya Mishra 1, Neelam Atri 1, 2, Rajeev
More informationTable S1. Quantitative RT-PCR primers
Table S1. Quantitative RT-PCR primers Gene Forward Primer Reverse Primer Human ApoB gcaagcagaagccagaagta ccatttggagaagcagtttgg Human ApoA1 gaaagctgcggtgctgac agtggccaggtccttcact Human MTP acggccattcccattgtg
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationTranscriptome profiling of the developing male germ line identifies the mir-29 family as a global regulator during meiosis
RNA BIOLOGY 2017, VOL. 14, NO. 2, 219 235 http://dx.doi.org/10.1080/15476286.2016.1270002 RESEARCH PAPER Transcriptome profiling of the developing male germ line identifies the mir-29 family as a global
More informationResearch Communication
IUBMB Life, 64(7): 628 635, July 2012 Research Communication MicroRNA-181b Targets camp Responsive Element Binding Protein 1 in Gastric Adenocarcinomas Lin Chen*, Qian Yang*, Wei-Qing Kong*, Tao Liu, Min
More informationPaternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationOriginal Article Identification of hsa-mir-21 as a target gene of tumorigenesis in neuroblastoma
Int J Clin Exp Med 2016;9(2):2718-2727 www.ijcem.com /ISSN:1940-5901/IJCEM0016181 Original Article Identification of hsa-mir-21 as a target gene of tumorigenesis in neuroblastoma Zuopeng Wang *, Wei Yao
More informationSoft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
More informationmicrorna-200b and microrna-200c promote colorectal cancer cell proliferation via
Supplementary Materials microrna-200b and microrna-200c promote colorectal cancer cell proliferation via targeting the reversion-inducing cysteine-rich protein with Kazal motifs Supplementary Table 1.
More informationDottorato di Ricerca in Genetica e Biologia Cellulare. MUTANT P53 INHIBITS microrna BIOGENESIS BY INTERFERING WITH THE MICROPROCESSOR COMPLEX
Dipartimento di Ecologia e Biologia Dottorato di Ricerca in Genetica e Biologia Cellulare Ciclo XXVII Settore scientifico-disciplinare BIO/11 MUTANT P53 INHIBITS microrna BIOGENESIS BY INTERFERING WITH
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationConcordant Regulation of Translation and mrna Abundance for Hundreds of Targets of a Human microrna
Concordant Regulation of Translation and mrna Abundance for Hundreds of Targets of a Human microrna David G. Hendrickson 1., Daniel J. Hogan 2,3., Heather L. McCullough 2,3,4., Jason W. Myers 2,3., Daniel
More informationreported to underlie diverse aspects of biology, including developmental timing, differentiation, proliferation, cell death, and metabolism.
1100 MicroRNA in Cancer: The Involvement of Aberrant MicroRNA Biogenesis Regulatory Pathways Genes & Cancer 1(11) 1100 1114 The Author(s) 2011 Reprints and permission: sagepub.com/journalspermissions.nav
More informationmir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting
mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,
More informationPractical Aspects of microrna Target Prediction
Current Molecular Medicine 2011, 11, 93-109 93 Practical Aspects of microrna Target Prediction T.M. Witkos, E. Koscianska and W.J. Krzyzosiak* Laboratory of Cancer Genetics, Institute of Bioorganic Chemistry,
More informationL I F E S C I E N C E S
1a L I F E S C I E N C E S 5 -UUA AUA UUC GAA AGC UGC AUC GAA AAC UGU GAA UCA-3 5 -TTA ATA TTC GAA AGC TGC ATC GAA AAC TGT GAA TCA-3 3 -AAT TAT AAG CTT TCG ACG TAG CTT TTG ACA CTT AGT-5 NOVEMBER 2, 2006
More information