Haematology Comparability Document
|
|
|
- Dayna Curtis
- 5 years ago
- Views:
Transcription
1 South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document QA d By: Ken Beechey Names Ranges Units Decimal points Alison Doorey LOINC Codes Document Approved By Date: 16/05/2012 Date: 21/05/2012 CHL: Ruth Spearing 12/05/09 (0.7) Steve Gibbons 12/05/09 (0.6) Ken Beechey 12/05/09 (0.7) SCL: Ian Morison 12/05/09 (0.7) Russell O Neil 12/05/09 (0.7) Robert Allan 12/05/09 (0.7) MLS: John Pettit 12/05/09 (0.7) Liz Pugh 12/05/09 (0.7) WCDHB: Phil Clark 12/05/09 (0.7) HBDHB: Sarah Hardingham 12/05/09 (0.7) TDHB: Craig Mabbett 12/05/09 (0.7) N.B. You may print this Procedure for local reference but remember that the master copy is the only current version. Master copies can be obtained from Canterbury Health Laboratories. Always check that you are working from the latest version before undertaking any activity which relies on information contained therein. Alison Doorey Page 1 of 39 18/05/2012
2 Table of Contents HAEMATOLOGY COMPARABILITY DOCUMENT... 1 TABLE OF CONTENTS... 2 INTRODUCTION... 3 BASOPHILS... 4 EOSINOPHILS... 6 ESR... 8 FIBRINOGEN... 9 HAEMATOCRIT HAEMOGLOBIN INR LYMPHOCYTES MCH MCHC MCV META/MYELOCYTES MONOCYTES NEUTROPHILS PLATELETS RBC RDW RETICULOCYTES WBC APPENDIX A: TESTS NOT STANDARDISED AS NOT REPORTED APPENDIX B: TESTS UNABLE TO CUMULATE CHANGE HISTORY: Alison Doorey Page 2 of 39 18/05/2012
3 Introduction The South Island Quality Assurance Group (SIQAG) for Haematology was established in 2008 / 2009 as part of a comparability project between Canterbury Health Laboratories, Southern Community Laboratories, Med Lab South and Grey Hospital Laboratory. This project was completed as part of a larger programme of work looking at the development of a regional results repository in the Canterbury region, similar to the Test Safe model adopted in Auckland. The scope of work was initially limited to tests from the Health PAC schedule though it was agreed that other tests identified by this group could be reviewed. Haematologists and senior Medical Laboratory Scientists from each laboratory met and pragmatically assessed tests for comparability. In order to ensure that results reported to Éclair would cumulate and display correctly, each test that was deemed comparable had the following reviewed and agreed; Name (standardised to LOINC recommendation). reference interval. units. number of decimal places reported. LOINC code. Labnet partners, Taranaki and Hawke s Bay, which share the Delphic Laboratory System with Canterbury Health Laboratories, were consulted during the sign-off process to ensure that proposed reference intervals could be implemented across all laboratory sites. The Northern Haematology Quality Assurance Group (NorthQAG) recommended reference intervals were also reviewed with a view to agreeing ranges nationally where possible. The SIQAG for Haematology asks that members adopt the recommendations outlined in this document so that test information can be standardised wherever possible. It should be recognised that this is a working document and further recommendations may come from other working groups. It is the responsibility of the SIQAG for Haematology to ensure that this document remains current. The SIQAG for Haematology: Agreed Reference Intervals Document is not a definitive list of Haematology normal reference intervals. It only details the agreed parameters and reference intervals that have been agreed across all three laboratory providers in Canterbury. Contact individual laboratories directly if you require a comprehensive set of reference intervals. Alison Doorey Page 3 of 39 18/05/2012
4 Basophils Alternative name: (NA) Health Pac Number Reported to (no. DP) S01e If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp LOINC Code Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years Alison Doorey Page 4 of 39 18/05/2012
5 15 years (Adult) Antenatal 1 st Trimester - Antenatal 2 nd Trimester - Antenatal 3 rd Trimester - Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 June 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. SCL to retain antenatal range, CHL only report a comment. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Discussion was held over the number of decimal places that should report depending on the result. If was agreed to change from 1dp to; If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp Alison Doorey Page 5 of 39 18/05/2012
6 Eosinophils Alternative name: (NA) Health Pac Number Reported to (no. DP) S01e If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp LOINC Code Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years Alison Doorey Page 6 of 39 18/05/2012
7 14 years years (Adult) Antenatal 1 st Trimester - Antenatal 2 nd Trimester - Antenatal 3 rd Trimester - Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 June 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Discussion was held over the number of decimal places that should report depending on the result. If was agreed to change from 1dp to; If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp Alison Doorey Page 7 of 39 18/05/2012
8 ESR Alternative name: (Erythrocyte Sedimentation Rate) Health Pac Number H01 LOINC Code Reported to (no. DP) 0 Units mm/hr Laboratory Information CHL Analyser X CHL Method X SCL Analyser X SCL Method X MLS Analyser X MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval 1-30 years years years 1-20 >71 years 1-30 Antenatal 1 st Trimester - Antenatal 2 nd Trimester - Antenatal 3 rd Trimester - Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 Conception / Agreement. Justification Alison Doorey Page 8 of 39 18/05/2012
9 Fibrinogen Alternative name: (NA) Health Pac Number H09 LOINC Code Reported to (no. DP) 1 Units g/l Laboratory Information CHL Analyser X CHL Method X SCL Analyser X SCL Method X MLS Analyser X MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval All ages Antenatal 1 st Trimester - Antenatal 2 nd Trimester - Antenatal 3 rd Trimester - Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 Conception / Agreement. Justification Alison Doorey Page 9 of 39 18/05/2012
10 Haematocrit Alternative name: (Hct / Packed Cell Volume) Health Pac Number S01 LOINC Code Reported to (no. DP) 2 Units Ratio Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Female Male Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years Alison Doorey Page 10 of 39 18/05/2012
11 14 years years (Adult) Antenatal 1 st Trimester X Antenatal 2 nd Trimester X Antenatal 3 rd Trimester X Antenatal Global (default) - - Reference Intervals Justification Date of change December 2007 April 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Alison Doorey Page 11 of 39 18/05/2012
12 Haemoglobin Alternative name: (NA) Health Pac Number S01c LOINC Code Reported to (no. DP) 0 Units g/l Paediatric Range Needed Laboratory Information Yes Sample Type EDTA CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Female Male Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years Alison Doorey Page 12 of 39 18/05/2012
13 12 years years years years years (Adult) Antenatal 1 st Trimester X Antenatal 2 nd Trimester X Antenatal 3 rd Trimester X Antenatal Global (default) - - Reference Intervals Justification Date of change December 2007 April 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Alison Doorey Page 13 of 39 18/05/2012
14 INR Alternative name: (International Normalised Ratio - INR (not on anticoagulants)) Health Pac Number H06 LOINC Code Reported to (no. DP) 1 Units Ratio Laboratory Information CHL Analyser ACL TOP CHL Method X SCL Analyser Sysmex CA1500 SCL Method X MLS Analyser Stago Compacts MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval 16 + (Adult) Reference Intervals Justification Date of change December 2007 Conception / Agreement. Justification Alison Doorey Page 14 of 39 18/05/2012
15 Lymphocytes Alternative name: (NA) Health Pac Number Reported to (no. DP) S01e If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp LOINC Code Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years Alison Doorey Page 15 of 39 18/05/2012
16 12 years years years years (Adult) 1 4 Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 June 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Discussion was held over the number of decimal places that should report depending on the result. If was agreed to change from 1dp to; If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp Alison Doorey Page 16 of 39 18/05/2012
17 MCH Alternative name: (Mean Cell Haemoglobin) Health Pac Number S01 LOINC Code Reported to (no. DP) 0 Units pg Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years Alison Doorey Page 17 of 39 18/05/2012
18 13 years years years (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Alison Doorey Page 18 of 39 18/05/2012
19 MCHC Alternative name: (Mean Cell Haemoglobin Concentration) Health Pac Number S01 LOINC Code Reported to (no. DP) 0 Units g/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Female Male Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years Alison Doorey Page 19 of 39 18/05/2012
20 12 years years years years (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) Reference Intervals Justification Date of change April 2009 Justification This analyte was not originally reviewed as it was not envisaged that the results would be sent to Éclair, however agreement between NorthQAG and the SIQAG on national paediatric reference ranges has included MCHC therefore for completeness it has been included in this documentation but this parameter won t be reported. Alison Doorey Page 20 of 39 18/05/2012
21 MCV Alternative name: (Mean Cell Volume) Health Pac Number S01 LOINC Code Reported to (no. DP) 0 Units fl Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years Alison Doorey Page 21 of 39 18/05/2012
22 13 years years years (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Alison Doorey Page 22 of 39 18/05/2012
23 Alison Doorey Page 23 of 39 18/05/2012
24 Meta/myelocytes Alternative name: (NA) Health Pac Number Reported to (no. DP) S01 If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp LOINC Code Units X x10^9/l x10(9)/l Laboratory Information CHL Analyser X CHL Method X SCL Analyser X SCL Method X MLS Analyser X MLS Method X WCDHB Analyser X WCDHB Method X TDHB Analyser X TDHB Method X HBDHB Analyser X HBDHB Method X Reference Intervals Age Range Reference Interval 16 + (Adult) Reference Intervals Justification Date of change October 2011 Justification Conception/Agreement: Sysmex Journal International Vol.20 No.1 (2010), pages Haematology Reference Intervals for Established Novel Parameters in Health Adults. J.M. Pekelharing et al. Alison Doorey Page 24 of 39 18/05/2012
25 Monocytes Alternative name: (NA) Health Pac Number Reported to (no. DP) S01e If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp LOINC Code Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years years Alison Doorey Page 25 of 39 18/05/2012
26 16 + (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 June 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Discussion was held over the number of decimal places that should report depending on the result. If was agreed to change from 1dp to; If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp Alison Doorey Page 26 of 39 18/05/2012
27 Neutrophils Alternative name: (NA) Health Pac Number Reported to (no. DP) S01e If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp LOINC Code Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years years Alison Doorey Page 27 of 39 18/05/2012
28 16 + (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 June 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Discussion was held over the number of decimal places that should report depending on the result. If was agreed to change from 1dp to; If the cell count 100 = 0dp If the cell count 0.5 and <100 = 1dp If the cell count < 0.5 = 2dp Alison Doorey Page 28 of 39 18/05/2012
29 Platelets Alternative name: (NA) Health Pac Number S0f LOINC Code Reported to (no. DP) 0 Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years years (Adult) Alison Doorey Page 29 of 39 18/05/2012
30 Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Alison Doorey Page 30 of 39 18/05/2012
31 RBC Alternative name: (Red Blood Cell Count) Health Pac Number S01a LOINC Code Reported to (no. DP) 2 Units x10^12/l x10(12)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Female Male Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years years Alison Doorey Page 31 of 39 18/05/2012
32 16 + (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) Reference Intervals Justification Date of change April 2009 Justification This analyte was not originally reviewed as it was not envisaged that the results would be sent to Éclair, however agreement between NorthQAG and the SIQAG on national paediatric reference ranges has included RBC therefore for completeness it has been included in this documentation but this parameter won t be reported. Alison Doorey Page 32 of 39 18/05/2012
33 RDW Alternative name: (Red Cell Distribution Width) Health Pac Number S01 LOINC Code Reported to (no. DP) 1 Units % Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Female Male Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years years Alison Doorey Page 33 of 39 18/05/2012
34 16 + (Adult) Antenatal 1 st Trimester Antenatal 2 nd Trimester Antenatal 3 rd Trimester Antenatal Global (default) Reference Intervals Justification Date of change April 2009 Justification This analyte was not originally reviewed as it was not envisaged that the results would be sent to Éclair, however agreement between NorthQAG and the SIQAG on national paediatric reference ranges has included RBC therefore for completeness it has been included in this documentation but this parameter won t be reported. Alison Doorey Page 34 of 39 18/05/2012
35 Reticulocytes Alternative name: (retics) Health Pac Number H19 LOINC Code Reported to (no. DP) 0 Units x10^9/l x10(9)/l Laboratory Information CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Adult Antenatal 1 st Trimester - Antenatal 2 nd Trimester - Antenatal 3 rd Trimester - Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 Conception / Agreement. Justification Alison Doorey Page 35 of 39 18/05/2012
36 WBC Alternative name: (White Blood Cell Count) Health Pac Number S01b LOINC Code Reported to (no. DP) Laboratory Information If the cell count 100 = 0dp All others = 1dp Units x10^9/l x10(9)/l CHL Analyser Sysmex XE2100 CHL Method X SCL Analyser Sysmex XE2100 SCL Method X MLS Analyser Sysmex XE2100 MLS Method X WCDHB Analyser TDHB Analyser HBDHB Analyser WCDHB Method TDHB Method HBDHB Method Reference Intervals Age Range Reference Interval Cord days month months 3 months months 5 months months 7 months months 9 months months 11 months year years years years years years years years years years years years years years years (Adult) 4 11 Alison Doorey Page 36 of 39 18/05/2012
37 Antenatal 1 st Trimester 4 15 Antenatal 2 nd Trimester 4 15 Antenatal 3 rd Trimester 4 15 Antenatal Global (default) - Reference Intervals Justification Date of change December 2007 April 2009 June 2009 Justification Conception / Agreement SCL Paediatric Range adopted initially. Subsequently awaiting outcome of NorthQAG paediatric discussions of with IM / RS / KB are involved. Agreement between NorthQAG and the SIQAG on national paediatric reference ranges. Discussion was held over the number of decimal places that should report depending on the result. If was agreed to change from 1dp to; If the cell count 100 = 0dp All others = 1dp Alison Doorey Page 37 of 39 18/05/2012
38 Appendix A: Tests not standardised as not reported Test / Analyte Decimal Places Units LOINC Code Mean platelet volume (MPV) 1 fl Appendix B: Tests unable to cumulate Test / Analyte Decimal Places Units LOINC Code APTT 0 secs (other codes exist) Alison Doorey Page 38 of 39 18/05/2012
39 Change History: Date of Change Analyte Version Change History 01/10/09 Introduction 1.3 Amendment to the introduction This line can be deleted prior to publish and was only put in to explain why the document is currently been versioned at 1.3 and not published. 30/11/11 Metamyelocytes 1.4 Added Alison Doorey Page 39 of 39 18/05/2012
q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9
ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti
Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
Paper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
NEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
Icd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Neil Wrathall The Christie Tel: +44 (0) 161 918 7264 Wilmslow Road Fax: +44 (0) 161 446 8549 Manchester
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK HSL (Analytics) LLP Haematology and Blood Transfusion Department Barnet Hospital Wellhouse Lane Barnet EN5 3DJ Contact: Priti Patel Tel: +44
LabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00
NOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
The LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology and Blood Transfusion 3 rd Floor Pathology Directorate Darent Valley Hospital Darenth Wood Road Dartford Kent DA2
American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
e-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
INFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
Quality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa
Quality control in the hematology laboratory for the sake of the patient Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa The FBC. Most frequently requested lab test Usually delegated
Continuing Education Questions
FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one
Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
Changes of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
Interpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Barbara De la Salle Director, UK NEQAS Haematology
Barbara De la Salle Director, UK NEQAS Haematology UK NEQAS Haematology developments (with apologies to Ian Mellors) UKAS assessors ISO15189 (Laboratories) ISO17043 (Scheme) Oversight bodies (NQAAP) Strategic
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091667 Age 37 Years Gender Male 29/8/2017 120000AM 29/8/2017 100129AM 29/8/2017 113851AM Ref By Final COAGULATION ROFILE 1 ARTIAL THROMBOLASTIN TIME, ACTIVATED; ATT
Dr Charlie Baker Consultant Anaesthetist UHNM. Being a place our f amilies would choose
Dr Charlie Baker Consultant Anaesthetist UHNM Being a place our f amilies would choose The story so far: Anaemia is associated with transfusion. The more anaemic you are pre op the more likely you are
AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
Clinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
The Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
Joanne Mallon, Nora O Neill, Dr D Hull Antenatal midwife coordinator, Consultant Haematologist
Title: CLINICAL GUIDELINES ID TAG Guideline for Antenatal Screening for Haemoglobinopathies Author: Designation: Speciality / Division: Directorate: Joanne Mallon, Nora O Neill, Dr D Hull Antenatal midwife
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
Laboratory diagnosis of iron deficiency: The interpretation of automated counting parameters. Dr Wayne Thomas Derriford Hospital, Plymouth
Laboratory diagnosis of iron deficiency: The interpretation of automated counting parameters. Dr Wayne Thomas Derriford Hospital, Plymouth Why does it matter? Over 30% of the Worlds population are anaemic,
Brief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
NORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Haematology & Blood Transfusion Contact: Dr Fergus Jack Poole Hospital Tel: +44 (0) 1202 442 497 Longfleet Road E-Mail: fergus.jack@poole.nhs.uk
Test Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091668 Age 40 Years Gender Male 29/8/2017 120000AM 29/8/2017 100156AM 29/8/2017 120820M Ref By Final COAGULATION ROFILE 2 FACTOR VIII FUNCTIONAL /ACTIVITY (Electromechanical
FBC interpretation. Dr. Gergely Varga
FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24
Evaluation of haematology analyzer CELL-DYN 3700 SL
Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo
XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016
XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient
Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
Hematology & Coagulation Practicum Objectives CLS - 647
Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Department of Haematology & lood Transfusion East Kent Hospitals University NHS Foundation Trust William Harvey Hospital Kennington Road Willesborough
CTAD as a universal anticoagulant
Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of
Blood DLC, Retic count, PCV, Hb and ESR. Dr. Tamara Alqudah
Blood DLC, Retic count, PCV, Hb and ESR Dr. Tamara Alqudah Differential Leukocyte Count (DLC) There are 5 main types of WBCs: 1. Neutrophils: 40-80% 2. Eosinophils: 1-6 % 3. Basophils: < 1-2% 4. Lymphocytes:
Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
CELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
HAEMATOLOGY INTRODUCTION
HAEMATOLOGY INTRODUCTION Haematology Laboratory offers a comprehensive range of routine and specialised haematological investigations. The laboratory also offers Routine Urine Sediment Microscopy and molecular
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
The Full Blood Count. Dave Reynders University of Pretoria Paediatric Oncology and Haematology
The Full Blood Count Dave Reynders University of Pretoria Paediatric Oncology and Haematology 1 History Empedocles in the 5 th century BC Vasculature contains Blood, Phlegm, Black bile and Yellow Bile.
GRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
Abnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust
Abnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust Regional Paediatric Specialty Trainees teaching 4 th July 2017 Scope
TECHNICAL UNIVERSITY OF MOMBASA
TECHNICAL UNIVERSITY OF MOMBASA Faculty of Applied and Health Sciences DEPARTMENT OF MEDICAL SCIENCES DIPLOMA IN MEDICAL LABORATORY SCIENCES (DMLS ) AML 2301 : HAEMATOLOGY II SPECIAL/SUPPLEMENTARY : EXAMINATIONS
Rapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter
Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and
BIOCHEMISTRY of BLOOD
BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of
CSP. Common Sense Pathology CONTENTS. Role of the FBC How to interpret results Value of the blood film
CSP Common Sense Pathology APRIL 2004 A REGULAR CASE-BASED SERIES ON PRACTICAL PATHOLOGY FOR GPs CONTENTS Role of the FBC How to interpret results Value of the blood film A JOINT INITIATIVE OF The Royal
BC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
Changes to CBC Reference Ranges
September 28, 2016 July, 2017 Changes to CBC Reference Ranges At Dynacare, our vision is to be Canada s health and wellness solutions leader. As part of our commitment and continuous efforts to enhance
Lab Guide Hematology Section Lab Guide
Lab Guide - 2018 Hematology Section Lab Guide Activated Partial Thromboplastin Time (APTT) One tube 2.7 ml citrated blood sample filled up to the mark on the tube label. (Light blue top tube, citrated
Laboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
COMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für
Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 20 June 2017 ccredited to Haematology & Blood Tranfusion Craigavon rea Hospital
Case study for CME Diabetes up-to-date management
Case study for CME Diabetes up-to-date management Dr Ole Schmiedel, MRCP MD FRACP Physician and Endocrinologist Service Clinical Director Auckland Diabetes Centre GP referral to Auckland Diabetes Centre
Green Amber Red Assurance Level
A re-audit of the turnaround time of samples for the Sickle Cell and Thalassaemia Newborn Screening Programme, in the Manchester Newborn Screening Laboratory Clinical Audit Report May 2014 Clinical Audit
Differential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für
NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016
NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE
West Suffolk Clinical Commissioning Group (WSCCG) Safety audit for methotrexate prescribing for patients in primary care
West Suffolk Clinical Commissioning Group (WSCCG) Safety audit for methotrexate prescribing for patients in primary care Year 2013-2014 Safety 100% of patients prescribed oral methotrexate should have
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
Test Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
Performance evaluation of Celltac G: a new automated hematology analyzer
Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo
Hematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
Clinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1
Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer
Use of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia
Use of the XE-21 in a Patient with Cold Auto-immune Hemolytic Anemia Gudrun STAMMINGER and Lothar BEIER Klinikum Chemnitz ggmbh, Institut für Laboratoriumsmedizin, Flemmingstraße 2, Chemnitz, Germany.
15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
BASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
Please contact the Client Services Team if you require further information.
Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used
Letter 63: Childhood Leukemia: Blood Test Results Normalised After Four Months On Herbs
Letter 63: Childhood Leukemia: Blood Test Results Normalised After Four Months On Herbs Kontribusi Dari Dr. Chris Teo Wednesday, 03 September 2008 Cancer Care August / September 2008 Danny (M355/not real
Online catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan
Hematological parameters among tuberculosis patients under treatment attending Kosti and Kenana teaching hospitals in White Nile state, Sudan Mohamed Elyass, AmeraAbdullah, Exany Samuel, Nada yassen, Ahmed
namib la UnIVERSITY OF SCIEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES
namib la UnIVERSITY OF SCIEnCE AnD TECHnOLOGY FACULTY OF HEALTH AND APPLIED SCIENCES DEPARTMENT OF HEALTH SCIENCES QUALIFICATION: BACHELOR OF BIOMEDICAL SCIENCES QUALIFICATION CODE: SOBBMS LEVEL: 6 COURSE