ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9

Size: px
Start display at page:

Download "ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9"

Transcription

1 ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE Volker El-Samalouti PhD Kit# 1 Kit ID: Kit Mailed: Original Evaluation: /25/ /26/2017 CAP Next Mailing Date: 1/29/2018 LEGEND: Exception Reason Codes appearing in this evaluation: = Educational challenge. Reviewed By Page 1 of 9

2 ., 0** e. ** * 00.. ee.glome 06.. Specimen No. of Limits of Acceptability your Result Mean S.D. Labs S.D.I Lower Upper Grade Survey -100 Mean +100 I MCV ff, I-19-C I MCH Pg WB MCHC g/dl Platelet Count x 10E9 /L 'n "--, gl" =I Page 3 of 9

3 05,6e. edbee.,e», 04140*.4.. Lymphs Specimen Result Attention: Volker El-Sarnalouti PhD Mean S.D No. of Limits of Acceptability your Labs S.D.I Lower Upper Grade Survey -100 Mean ,. ',... PeN...eme-- Lyrnphs Absolute x 10E9/L e. 1 Monocytes A Monocytes Absolute x 10E9/L SYSMEX XE-2100,2100D /L FH9-A2017 '.. 111, Page 5 of 9

4 ...epo e,,.6, No. of Limits of Acceptability Specimen Result Mean S.D. Labs S.D.I Lower Upper Grade IG % Survey -100 Mean +100 IG Absolute x 10E9/L nrbc% % echeck XE CONTROL nrbc Absolute x 10E3/uL echeck XE CONTROL Method Specimen Result Good Response Response Grade Blood Cell ID BCP-21 ERYTHROCYTE, NORMAL ERYTHROCYTE, NORMAL Good BCP-22 MONOCVIE MONOCYTE Good BCP-23 EOSINOPHIL, ANY STAGE EOSINOPHIL, ANY STAGE Good The College of Arnerican Pathologists recommends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 7 of 9

5 64.* CAP CAP #: Subspecialty : Hematology Proficiency Event Proficiency Event Proficiency Event Current Event Performance Cumulative CLIA '88 Performance Regulated Analyte Event Score A Event Score % Event Score % Interpretation Interpretation Cell ID/Flow Differential FH9-A 5 / FH9-B 5/5 100 FH9-C 5/5 100 Satisfactory Successful Erythrocyte Count (RBC) 1'119-A 5 / FH9-B 5/5 100 FH9-C 5/5 100 Satisfactory Successful Hematocrit FH9-A 5 / FH9-B 5/5 100 FH9-C 5/5 100 Satisfactory Successful Hemoglobin FH9-A 5 / FH9-B 5/5 100 FH9-C 5 / Satisfactory Successful Leukocyte Count (WBC) FH9-A 5 / FH9-B 5/5 100 FH9-C 5/5 100 Satisfactory Successful Platelet Count FH9-A 5 / FH9-B 5/5 100 FH9-C 5/5 100 Satisfactory Successful Fibrinogen CGL-A 5 / CGL-B 5/5 100 Pending Successful <4> PTT CGL-A 5 / CGL-B 5/5 100 Pending Successful <4> Prothrombin Time CGL-A 5 / C,C1,-B 5/5 100 Pending Successful <4> Hematology 45/ / / Satisfactory Successful <4> Scorecard performance pending future evaluation or may not be applicable due to discontinued testing or use of a waived method. The College of American Pathologists recommends that die result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 9 of 9

6 ee «... sewee ee.es, e ree.* Method Specimen Result Good Response Response Grade Blood Cell ID Ungraded B CP-24 BCP-25 BCP-26 BCP-27 BCP-28 BCP-29 BCP-30 BASOPHIL, ANY STAGE PLATELET, NORMAL POLYCHROMATOPHILIC RBC PLATELET, GIANT MONOCY 1 E NEUTROPHIL, SEG/BAND LYMPHOCYTE BASOPHIL, ANY STAGE PLATELET, NORMAL Good Good The College of American Pathologists recomrnends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory E1 16 Page 8

7 06 se emie < e oe 4,41).eso 4,5.* CAP Number: Institution: Attention: City / State: Kit# 1 LIKF Laboratorium fur Klinische Forschung GmbH Volker El-Samalouti PhD Schwentinental GE No. of Limits of Acceptability yo ur Specimen Result Mean S.D. Labs S.D.I Lower Upper Grade Survey -100 Mean +100 Eosinophils % == Eosinophils Absolute x 10E9/L _p Basophils % u , e rmmmt 7 i Basophils Absolute x 10E9/L Page 6.

8 osb eteeee 641, ep*.e.. MPV fl Specimen No. of Limits of Acceptability your Result Mean S.D. Labs S.D.I Lower Upper Grade Survey -100 Mean IIIIII.I=IIII4II....ffl RDW EL "1-194-, »9MMW...9,----, u -2u Neut/Gran % I-19-A 2017 _- - Fel, Neut/Gran Absolute x 10E9/L g i Page 4

9 ..e. eteese.e Waukegan Road, Northfield,11Unois City / State: Schvv-entinental GE Kit Mailed; 9/25/2017 No. of Limits of Acceptability your Specimen Result Mean S.D. Labs S.D.I Lower Upper Grade Survey -100 Mean +100 White Blood Cell Count x 10E9/L Red Blood Cell Count x 10E12/L FE j ' _ , Hemoglobin g/dl Hematocrit % SYSMEX XE-2100,2100D /L '4110 Page 2

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9

q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9 etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für

More information

Laboratory for diagnosis of THALASSEMIA

Laboratory for diagnosis of THALASSEMIA SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

Haematology Comparability Document

Haematology Comparability Document South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

Differential Blood Smear H3

Differential Blood Smear H3 Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für

More information

DAT-B 2015 Direct Antiglobulin Test

DAT-B 2015 Direct Antiglobulin Test EVALUATION DAT-B 2015 Direct Antiglobulin Test INSTITUTION: ATTENTION: CAP NUMBER: 7181660-01 Kit# 1 KIT INFORMATION: Kit ID: 28002258 10/12/2015 11/16/2015 Next Mailing Date: 2/22/2016 COPIED TO: LAP

More information

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev

Koostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte

More information

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired

Interpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make

More information

NOTE: This table will be discontinued after this lot.

NOTE: This table will be discontinued after this lot. AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6

More information

Continuing Education Questions

Continuing Education Questions FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one

More information

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016

NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE

More information

The Complete Blood Count

The Complete Blood Count The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count

More information

Brief Communication Diagnostic Hematology

Brief Communication Diagnostic Hematology Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature

Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Icd code for cbc with differential/ platelet

Icd code for cbc with differential/ platelet Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential

More information

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa

Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory

More information

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens

Scoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated

More information

Clinical use of flow cytometry

Clinical use of flow cytometry Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

INFECTION/ INFLAMMATION

INFECTION/ INFLAMMATION HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

e-figure 1. The design of the study.

e-figure 1. The design of the study. e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and

More information

8.2 Principles of Quantitative Hematologic Determinations (1)

8.2 Principles of Quantitative Hematologic Determinations (1) 3 8. FIELD CENTER HEMATOLOGY SERVICES 8.1 Clinical Significance Quantitation of the formed elements of the blood (erythrocytes -RBCs, leukocytes - WBCs, and platelets) is important in the ARIC study primarily

More information

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How?

Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

Changes of hematological references depends on storage period and temperature conditions in rats and dogs

Changes of hematological references depends on storage period and temperature conditions in rats and dogs ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature

More information

FH9-A 2016 Kit Instructions CAP 2016

FH9-A 2016 Kit Instructions CAP 2016 FH9-A 2016 Kit Instructions CAP 2016 Comprehensive Hematology Survey Automated Differential FH9 FH9P Table of Contents Kit Contents Kit Contents... 1 Important: Before You Begin... 1 Detailed Testing Instructions...

More information

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)

AVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC) AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin

More information

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia 50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016 XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient

More information

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN

5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:

More information

Paper ID: ART

Paper ID: ART analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in

More information

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS

EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE

More information

3. Blood Cell Histograms:

3. Blood Cell Histograms: LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative

More information

Test Name Results Units Bio. Ref. Interval

Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 135091667 Age 37 Years Gender Male 29/8/2017 120000AM 29/8/2017 100129AM 29/8/2017 113851AM Ref By Final COAGULATION ROFILE 1 ARTIAL THROMBOLASTIN TIME, ACTIVATED; ATT

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Two Important Statistics

Two Important Statistics Two Important Statistics 70% 40% 0 Quality Control & YOU David Plaut Fall, 2012 davidplaut@yahoo.com 1 11 Why do physicians order laboratory tests? 2 2 Why do Physicians Order Laboratory Tests? 1. Patients

More information

Proficiency Testing Evaluation

Proficiency Testing Evaluation Facility/Contact Phone: (573)265-8840 PCRMC Medical Group - Forest C Fax: (573)265-8884 1000 N Jefferson St Email (primary): odean@pcrmc.com; Email (secondary): (Please add pt@aafp.org to your electronic

More information

Blood Cells Med Terms Quiz

Blood Cells Med Terms Quiz Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:

More information

Step 2. Common Blood Tests, and the Coulter Counter Readout

Step 2. Common Blood Tests, and the Coulter Counter Readout Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their

More information

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition: TSENG, JUSTINA J DOB: 10/26/1955 AGE: 59

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition: TSENG, JUSTINA J DOB: 10/26/1955 AGE: 59 Report Status: Final Patient Information Specimen Information Client Information Specimen: EN255254W Client #: 44123510 MAIL001 Requisition: 0014895 Lab Ref #: PRO76199 GREENVILLE RANCHERIA 1425 MONTGOMERY

More information

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter

Combining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00

More information

Blood Cell Identification Graded

Blood Cell Identification Graded Blood Cell Identification Graded Case History The patient is a 20-year-old female with sickle cell disease who presents with bilateral leg pain for 3 days. She is scheduled to have bilateral hip and leg

More information

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure

Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for

More information

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program

American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:

Patient Information Specimen Information Client Information. Specimen: EN255254W. Requisition: Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

Use of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia

Use of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia Use of the XE-21 in a Patient with Cold Auto-immune Hemolytic Anemia Gudrun STAMMINGER and Lothar BEIER Klinikum Chemnitz ggmbh, Institut für Laboratoriumsmedizin, Flemmingstraße 2, Chemnitz, Germany.

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD

Sue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD Comparison Study of the Rates of Manual Peripheral Blood Smear Review From 3 Automated Hematology Analyzers, Unicel DxH 800, ADVIA 2120i, and XE 2100, Using International Consensus Group Guidelines Sue

More information

BIOCHEMISTRY of BLOOD

BIOCHEMISTRY of BLOOD BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital

Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:

More information

BLOOD. Dr. Vedat Evren

BLOOD. Dr. Vedat Evren BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body

More information

Myelodysplastic Syndrome Case 158

Myelodysplastic Syndrome Case 158 Myelodysplastic Syndrome Case 158 Dong Chen MD PhD Division of Hematopathology Mayo Clinic Clinical History 86 year old man Persistent borderline anemia and thrombocytopenia. His past medical history was

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00

1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00 Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000

More information

Test Name Results Units Bio. Ref. Interval

Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 135091668 Age 40 Years Gender Male 29/8/2017 120000AM 29/8/2017 100156AM 29/8/2017 120820M Ref By Final COAGULATION ROFILE 2 FACTOR VIII FUNCTIONAL /ACTIVITY (Electromechanical

More information

Blood Cell Identification Graded

Blood Cell Identification Graded BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory

More information

* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil

* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,

More information

Performance evaluation of Celltac G: a new automated hematology analyzer

Performance evaluation of Celltac G: a new automated hematology analyzer Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo

More information

JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice

JKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

LabDriver Audit Trail Example

LabDriver Audit Trail Example LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009

More information

A Study on the Relationship between CBC and EEG for Epilepsy Patients

A Study on the Relationship between CBC and EEG for Epilepsy Patients ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia

More information

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood

Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Annals of Clinical & Laboratory Science, vol. 32, no. 4, 2002 393 Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Jong Weon Choi and Soo Hwan Pai Department of Clinical Pathology,

More information

The LaboratoryMatters

The LaboratoryMatters Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008 VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening

More information

Laboratory Results Summary

Laboratory Results Summary Laboratory Results Summary Laboratory CO1033AI Test event 2 of 3 CAP LAP Number 7181660 Page Print Date 9 / 10 2008/Jul/04 Program Syphilis (SYPH435) Results Deadline 2008/Jun/24 Subscription ID Analyte

More information

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies

CELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies

More information

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs

1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs 1 BIO 212: ANATOMY & PHYSIOLOGY II LAB BLOOD PLATES EOSINOPHIL Contains large red-staining granules Usually 2 lobes 12-17 µm: about the size of neutrophils (2X erythrocytes) regulation/reduction of Histamine.

More information

Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory

Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory Azza S Eldanasoury 1, Noha H Boshnak 2, Raghda E Abd El Monem 3 1 MD, Professor of Clinical

More information

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after

More information

2014 Continuing Compliance Master Series Best Practices in Alternative Assessment of Performance

2014 Continuing Compliance Master Series Best Practices in Alternative Assessment of Performance 2014 Continuing Compliance Master Series Best Practices in Alternative Assessment of Performance Brad S. Karon, MD, PhD, FCAP November 19, 2014 www.cap.org Today s Presenter Brad S. Karon, MD, PhD, FCAP

More information

ör-jei/t COLLEGE of AMERICAN PATHOLOGISTS 325 Waukegan Road. Northfleld.118nola cap.org ORIGINAL EVALUATION

ör-jei/t COLLEGE of AMERICAN PATHOLOGISTS 325 Waukegan Road. Northfleld.118nola cap.org ORIGINAL EVALUATION **** COLLEGE of AMERICAN PATHOLOGISTS 325 Waukegan Road. Northfleld.118nola 60093-2750 800-323-4040 cap.org General Chernistry/Therapeutic Drugs INSTITUTION: ATTENTION: CAP NU1MBER: KIT INFORMATION: COPIED

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Supplementary Note Details of the patient populations studied Strengths and weakness of the study Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined

More information

FBC interpretation. Dr. Gergely Varga

FBC interpretation. Dr. Gergely Varga FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24

More information

Blood Lecture Test Questions Set 2 Summer 2012

Blood Lecture Test Questions Set 2 Summer 2012 Blood Lecture Test Questions Set 2 Summer 2012 1. Leukocytes are attracted to a site of injury or disease by: a. diapedesis b. chemotaxis c. leukocytosis d. heparin e. leukomotosis 2. Leukocytes leave

More information

The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix

The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix Blood In Detail The fluid medium (blood) is a highly specialized connective tissue that consists of various blood cells (formed elements) suspended in a fluid matrix (blood plasma). The formed elements

More information