Copy Number Variations
|
|
- Kimberly Fitzgerald
- 5 years ago
- Views:
Transcription
1 Copy Number Variations Illumina Seminar - Milan June 18, 2009 Untangling the complexity of mendelian and complex diseases Federica Torri Dept of Science & Biomedical Technologies Fondazione Filarete, University of Milan
2 What are CNVs? Stretches of DNA larger than 1 kb that display copy number differences in comparison to a reference genome - Copy number variation (germline,, inherited) - inherited: also present in parents genome - de novo: absent in parents genome - Copy number alteration (somatic, e.g. in cancer cells) - Copy number polymorphism (relatively common CNV, with a fixed starting/ending position) - Copy number difference (between-species copy number differences, e.g chimpanzees and humans)
3 Nat Rev Genet. 2007;8: CNVs in α-globins CNVs in CMT CNVs as a general feature
4 Structural variation in the human genome Nat Rev Genet 7: 85-97, 2006 Millions of nucleotides of heterogeneity within every genome likely to make an important contribution to human diversity and disease susceptibility. ~12 % or 4.8%?
5 CNV: the hottest topic?
6 The current map of human structural variation is far from complete.
7 CNVs in health Important in primate evolution Overlap and regulate the expression of ~ 18% of genes Account for more nucleotide variation than SNPs in the human genome Non-random distribution across the genome: hot spots Nearly 50% map in SD s regions Mechanisms: NAHR, NHEJ, retrotransposition, FoSTeS Underwent selective pressure in the human lineage (shaped by mutation, selection, demographic history) Population-specific variation Enriched towards environmental sensor genes (sensory perception and defense response functions) AMY1 gene paradigm
8 CNVs in health Important in primate evolution Overlap and regulate the expression of ~ 18% of genes Account for more nucleotide variation than SNPs in the human genome Non-random distribution across the genome: hot spots Nearly 50% map in SD s regions Mechanisms: NAHR, NHEJ, retrotransposition, FoSTeS Underwent selective pressure in the human lineage (shaped by mutation, selection, demographic history) Population-specific variation Enriched towards environmental sensor genes (sensory perception and defense response functions) AMY1 gene paradigm
9 Population differentiation Redon et al., Nature ;444:444-54
10 CNVs in health Important in primate evolution Overlap and regulate the expression of ~ 18% of genes Account for more nucleotide variation than SNPs in the human genome Non-random distribution across the genome: hot spots Nearly 50% map in SD s regions Mechanisms: NAHR, NHEJ, retrotransposition, FoSTeS Underwent selective pressure in the human lineage (shaped by mutation, selection, demographic history) Population-specific variation Enriched towards environmental sensor genes (sensory perception and defense response functions) AMY1 gene paradigm
11 CNVs and evolution: how has CNVs shaped our genomes? Genome Res. 2008, 18: CNVs number and median size comparable orthologous region significantly enriched human specific SDs significantly enriched for human-specific CNVs, the same for chimpanzee: species specific CNVs pattern due to architectural differences between the two genomes Comparison between fixed CNDs (human and chimp) and human CNVs containing genes.
12 The relations between CNVs affecting genes and fixation future studies aiming to characterize genetic basis of adaptive phenotypic differences between humans and chimpanzees.
13 latest news on CNVs differences between any two individuals 99% of the copy number differences between any two individuals is explained by the simple mendelian inheritance of the same allele from a parent COMMON VARIANTS -Only few >100kb -Copy-number differences between two individuals seems to be due to CNPs: 90% from CNPs with MAF > 1%, 80% from CNPs with MAF > 5% -mostly inherited -patterns of allele frequency, LD, population differentiation that mirror SNPs -90% biallelic -10% multiallelic RARE VARIANTS -Mostly >100kb -Affect less than the 5% of the human genome - Rare CNVs sharing imply sharing of larger genomic region -fewer allelic states -highly penetrant and short lived in the population -De novo/inherited persisting for only a few generations within a pedigree next frontier of human genetics research!
14 1000 genomes projects: a glimpse on lower frequency variants -AIM : a nearly complete catalog of common human genetic variants (defined as frequency 1% or higher) by high-quality sequence data for >85% of the genome for three sets of individuals - Each set is sampled from broad geographic regions (tentatively, Bantu-speaking populations in Africa; populations in East Asia; and populations in Europe). -This catalog will include SNPs, copy number variants, and short insertion and deletion polymorphisms. Filling the gap between rare and common variants
15 Am J Hum Genet. 2009;84: ~16% of the genome Low frequency High frequency
16 CNVs not only in simple (genomic) diseases Nat Genet 40: 322-8, 2008 GENOMIC DISORDERS: sporadic diseases caused by recurrent de novo structural mutations
17 but also in complex traits McCarroll SA,Hum Mol Genet ;17:R135-42
18 The common versus rare hypothesis Common variant common disease scenario Rare variant common disease scenario vs Case-control CNVs mapping in shared regions AIM : to find CNVs segments that are associated to a complex trait in our cohort, looking to replicate this findings in other samples. SUGGESTED ASSOCIATION ANALYSIS: difference in allele frequency between cases and controls Rare CNVs mapping in multiple regions defining an individual pattern of variation AIM : to find CNVs patterns that may be differentially associated to a complex traits (looking for a shared biological function) SUGGESTED ASSOCIATION ANALYSIS: enrichment of a collection of rare variants in cases or controls
19 The schizophrenia paradigm Mixture of common and rare variants likely Mendelising pedigrees uncommon - no common risk variants found to date - mathematical modelling of familial risk is inconsistent with single genes of large effects Apparently stable incidence and prevalence Reduced fecundity Multiple rare recurrent CNVs that underlie strong negative selection may account for a larger fraction of overall genetic risk Common variants Rare variants small genetic effects POWER PROBLEM rare sequencing needed at the single nucleotide/small structural level
20 walking through complexity Owen MJ et al., Curr Opin Genet Dev. 2009
21 ..converging evidences on loci Chr. 1q21.1 Chr. 15q11.2 Chr. 15q13.3
22 ..converging evidences on genes
23 genomic burden of rare variants Science 320: , 2008 Nat Rev Genet 40: , 2008
24 Detecting CNVs is not a trivial issue - Circular Binary Segmentation (Olshen et al., 2004) - cnvpartition (Illumina Inc., San Diego, CA) - Circular Binary Segmentation Modified -Nexus Copy Number (Biodiscovery Inc., El Segundo, CA) - Hidden Markov Models (HMMs) - QuantiSNP (Wellcome Trust for Human Genetics, University of Oxford) - PennCNV (University of Pennsylvania) - Golden Helix Dynamic Optimal Segmentation (Golden Helix Inc.)
25 Nexus v4 (Biodiscovery Inc.) All Chromosome overview CNV detection Whole genome overview All Chromosome visualization Single Chromosome visualization Numerical data on the aberrations
26 Threshold for Nexus parameters Log R ratio homozygous gain heterozygous gain heterozygous loss Copy number evaluation homozygous loss BB AB AA B allele frequency Allelic imbalance LOH Allelic imbalance Allelic imbalance Allelic imbalance evaluation Normal zygosity
27 B-allele frequency possible scenarios Father: AABABBBABABBBAAABABB Mother: ABBABA ABABBAAA A AA AB BB AA BB AB B A B A B B AB AB AAA AAB BBB AAA ABB ABB BB AB AA Normal LOH Imbalance 100% 0% BBB BBA BAA AAA
28 Our approaches to CNVs topic 1) Schizophrenia : exploring the two different sides 2) Validation of a de novo genomic loss of heterozygosity (LOH) for HLA haplotype as a mechanism of in vivo leukemia immune escape in patients with relapse after haploidentical transplantation and adoptive transfer of donor T cells 3) Novel gene discovery in monogenic cancer predisposition syndromes: a first proof of concept of our analysis pipeline
29 Our approaches to CNVs topic 1) Schizophrenia : exploring the two different sides 2) Validation of a de novo genomic loss of heterozygosity (LOH) for HLA haplotype as a mechanism of in vivo leukemia immune escape in patients with relapse after haploidentical transplantation and adoptive transfer of donor T cells 3) Novel gene discovery in monogenic cancer predisposition syndromes: a first proof of concept of our analysis pipeline
30 Schizophrenia : exploring the two different sides Common variant common disease scenario Rare variant common disease scenario vs n= 89 n= 117
31 Nexus v4 (Biodiscovery Inc.): the comparison feature CNV detection Frequency Comparison COMPARISON FEATURE: comparison in CNVs frequency between groups assessing which CNVs are significantly enriched
32 are we moving in the right direction? Mol Psychiatry Only SNP replicated maps in DOCK4 DOCK4 activates Rac GTPase Predominant expression in hyppocampus Upregulated at the same time dendrites start growing Knockdown results in impaired dendritic morphogenesis
33 Our approaches to CNVs topic 1) Schizophrenia : exploring the two different sides 2) Validation of a de novo genomic loss of heterozygosity (LOH) for HLA haplotype as a mechanism of in vivo leukemia immune escape in patients with relapse after haploidentical transplanation and adoptive transfer of donor T cells 3) Novel gene discovery in monogenic cancer predisposition syndromes: a first proof of concept of our analysis pipeline
34 Genomic loss of mismatched HLA in leukemia is a major mechanism of in vivo escape from T cell immunosurveillance following haploidentical HSCT Vago L. et al., Genomic Loss Of Mismatched HLA In Leukemia is a Major Mechanism of in Vivo Escape from T Cell Immunosurveillance Following Haploidentical HSCT, NEJM, in press
35 Our approaches to CNVs topic 1) Schizophrenia : exploring the two different sides 2) Validation of a de novo genomic loss of heterozygosity (LOH) for HLA haplotype as a mechanism of in vivo leukemia immune escapein patients with relapse after haploidentical transplanation and adoptive transfer of donor T cells 3) Novel gene discovery in monogenic cancer predisposition syndromes: a first proof of concept of our analysis pipeline
36 Gene discovery: looking for a needle in a haystack knowing the needle to search for Reporter pathogenic CNV in a monogenic cancer predisposition syndrome (HNPCC) = MLPA % of patients are negative for mutation/rearrangements in candidate genes and display a phenotype superimposable to known monogenic cancer predisposition syndromes NFMP-HPLC + Human1m-duo BeadChips pathogenic CNV boundaries ortogonal validation empirical testing of theoretical parameters to optimize analysis conditions
37 Gene discovery : towards the gene point of view CNV detection CNVs list Frequency Comparison CNVs regions present only in cases 120 genes Gene filtering needed!!!!
38 Gene discovery : towards the gene point of view Gene filtering Cumulative Gene Region IDs Region Code Explicited Cumulative Freq Cases Freq Controls GKAP1 0 chr9:85,616,440-85,623,279 7,5 0 CKMT1B 5,031,166 chr15:41,676,268-41,682,935 <-> chr15:41,660,781-41,676, ANO3 0 chr11:26,565,073-26,567, MSH2 702,0 chr2:47,460,187-47,511,188 <-> chr2:47,539,880-47,547, LOC chr1:147,779, ,849, PPIAL4C 0 chr1:147,779, ,849,
39 Gene discovery : identification of novel cancer predisposition genes???????? Mutation negative in candidate genes patients cohort (20-55 %) CNV detection? Frequency Comparison Gene filtering
40 CNVs genomic content is different between Monozygotic twins: frequency of differences in genetic makeup up to 10 %!!! Am J Hum Genet. 2008;82: Different tissues within an individual (mosaicism) Notini AJ et al., Cyt Genome Res : Piotrowski A. et al.,. Hum Mutat. 2008;29:
41 Many-but far from all-common CNVs can be interrogated with a tag SNP on genotyping platforms Nat Genet 40: , % of the common deletions (worldwide frequency >5%) strongly correlated to a HapMap SNP (worldwide r 2 > 0.8) Nat Genet 40: , 2008 More probes but more background rumor High density genome-wide SNP array tagged about ~50% of the common deletions Segmental duplication under-representation or cross-hybridization of paralogous sequences NAHR-driven mutation less likely to be tagged LD with surrounding SNPs: underestimation
42 Towards deep sequencing. Nature 453: 56-64, % in more than 5 ids 1695 sites of structural variation: 49 % more than 1 ids, 15% more than regions of novel insertion sequences not present in the reference genome: 40% are CNVs ranging (from few kbp up to 130 kb) nearly 50% lay outside previously reported CNVs region Comparison with the highest density SNP commercial platform (Illumina 1M and Affy6): 50% deletions cannot be detected! DE NOVO SEQUENCING OF ADDITIONAL GENOMES NEEDED!
43 Looking to individual structural variants with sequencing technologies PLoS Biol ;5:e million DNA variants (~12.3 Mb) (~30%) novel! 3,213,401 single nucleotide polymorphisms (SNPs( SNPs) 53,823 block substitutions ( bp) 559,473 homozygous indels (1 82,711 bp) 62 CNVs 292,102 heterozygous insertion/deletion events (indels( indels)(1 571 bp) 90 inversions Non-SNP DNA variation accounts for 22% of all events identified in the t donor, however they involve 74% of all variant bases
44 Assessing the relevance of CNVs in clinic Cook et al., Nature ;455:919-23
45 Aknowledgements Laboratory of genetic of complex traits, University of Milan Erika Salvi Sara Lupoli Cristina Barlassina Luisa Strik Lievers Valentina Tieran Francesca Taddeo Cristian Cosentino Fausta Schiavini Daniele Cusi Fabio Macciardi Department of Oncology and Neurosciences, University G. D Annunzio, Chieti Laura De Lellis Alessandro Cama Istituto Nazionale dei Tumori, Milan Paolo Radice IRCCS San Raffaele Luca Vago Fabio Ciceri Katharina Fleischauer Istituto Tecnologie Biomediche, CNR Alessandro Orro Andrea Calabria Paolo Cozzi UC Irvine, CA Steven G. Potkin Jessica Turner James Fallon Guia Guffanti Illumina, Inc. Mita Mancini Chiara Dal Fiume Biodiscovery, Inc. Soheil Shams
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationIdentification of regions with common copy-number variations using SNP array
Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationGenome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre
Genome-wide copy-number calling (CNAs not CNVs!) Dr Geoff Macintyre Structural variation (SVs) Copy-number variations C Deletion A B C Balanced rearrangements A B A B C B A C Duplication Inversion Causes
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationCNV Detection and Interpretation in Genomic Data
CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationNovember 9, Johns Hopkins School of Medicine, Baltimore, MD,
Fast detection of de-novo copy number variants from case-parent SNP arrays identifies a deletion on chromosome 7p14.1 associated with non-syndromic isolated cleft lip/palate Samuel G. Younkin 1, Robert
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationAmerican Psychiatric Nurses Association
Francis J. McMahon International Society of Psychiatric Genetics Johns Hopkins University School of Medicine Dept. of Psychiatry Human Genetics Branch, National Institute of Mental Health* * views expressed
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationUsing GWAS Data to Identify Copy Number Variants Contributing to Common Complex Diseases
arxiv:1010.5040v1 [stat.me] 25 Oct 2010 Statistical Science 2009, Vol. 24, No. 4, 530 546 DOI: 10.1214/09-STS304 c Institute of Mathematical Statistics, 2009 Using GWAS Data to Identify Copy Number Variants
More informationCopy Number Variations and Association Mapping Advanced Topics in Computa8onal Genomics
Copy Number Variations and Association Mapping 02-715 Advanced Topics in Computa8onal Genomics SNP and CNV Genotyping SNP genotyping assumes two copy numbers at each locus (i.e., no CNVs) CNV genotyping
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationHuman Genetics 542 Winter 2018 Syllabus
Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationAssociating Copy Number and SNP Variation with Human Disease. Autism Segmental duplication Neurobehavioral, includes social disability
Technical Note Associating Copy Number and SNP Variation with Human Disease Abstract The Genome-Wide Human SNP Array 6.0 is an affordable tool to examine the role of copy number variation in disease by
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationNon-Mendelian inheritance
Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University
More informationHuman Genetics 542 Winter 2017 Syllabus
Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping
More informationQTs IV: miraculous and missing heritability
QTs IV: miraculous and missing heritability (1) Selection should use up V A, by fixing the favorable alleles. But it doesn t (at least in many cases). The Illinois Long-term Selection Experiment (1896-2015,
More informationThe Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0
The Loss of Heterozygosity (LOH) Algorithm in Genotyping Console 2.0 Introduction Loss of erozygosity (LOH) represents the loss of allelic differences. The SNP markers on the SNP Array 6.0 can be used
More informationMULTIFACTORIAL DISEASES. MG L-10 July 7 th 2014
MULTIFACTORIAL DISEASES MG L-10 July 7 th 2014 Genetic Diseases Unifactorial Chromosomal Multifactorial AD Numerical AR Structural X-linked Microdeletions Mitochondrial Spectrum of Alterations in DNA Sequence
More informationPopulation Genetics of Structural Variation Speaker Dr. Don Conrad
Population Genetics of Structural Variation Dr. Don Conrad Wellcome Trust Sanger Institute Cambridge, UK 1 Overview Ascertainment of CNVs What CNV data is available Humans, chimpanzee, macaque, Drosophila,
More informationLecture 17: Human Genetics. I. Types of Genetic Disorders. A. Single gene disorders
Lecture 17: Human Genetics I. Types of Genetic Disorders A. Single gene disorders B. Multifactorial traits 1. Mutant alleles at several loci acting in concert C. Chromosomal abnormalities 1. Physical changes
More informationCITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationComparative analyses of seven algorithms for copy number variant identification from single nucleotide polymorphism arrays
Published online 8 February 2010 Nucleic Acids Research, 2010, Vol. 38, No. 9 e105 doi:10.1093/nar/gkq040 Comparative analyses of seven algorithms for copy number variant identification from single nucleotide
More informationApproach to Mental Retardation and Developmental Delay. SR Ghaffari MSc MD PhD
Approach to Mental Retardation and Developmental Delay SR Ghaffari MSc MD PhD Introduction Objectives Definition of MR and DD Classification Epidemiology (prevalence, recurrence risk, ) Etiology Importance
More informationADVANCED PGT SERVICES
Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art
More informationWhole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis
HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More information5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationQuantitative genetics: traits controlled by alleles at many loci
Quantitative genetics: traits controlled by alleles at many loci Human phenotypic adaptations and diseases commonly involve the effects of many genes, each will small effect Quantitative genetics allows
More informationCNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.
Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationClinical Genomics. Ina E. Amarillo, PhD FACMGG
Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: LOSS,
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationWelcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm
Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationNew Enhancements: GWAS Workflows with SVS
New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationAn Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018
An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationA rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France
A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is
More informationApplications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns
Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه
More informationComparing CNV detection methods for SNP arrays Laura Winchester, Christopher Yau and Jiannis Ragoussis
BRIEFINGS IN FUNCTIONAL GENOMICS AND PROTEOMICS. VOL 8. NO 5. 353^366 doi:10.1093/bfgp/elp017 Comparing CNV detection methods for SNP arrays Laura Winchester, Christopher Yau and Jiannis Ragoussis Advance
More informationSeven cases of intellectual disability analysed by genomewide SNP analysis. Rodney J. Scott
Seven cases of intellectual disability analysed by genomewide SNP analysis Rodney J. Scott Ability to interrogate Genomic Material ~1930 Crude analyses 2012 Highly precise analyses A (very) brief history
More informationLACTASE PERSISTENCE: EVIDENCE FOR SELECTION
LACTASE PERSISTENCE: EVIDENCE FOR SELECTION INTRODUCTION The ability of some human adults to digest lactose the sugar in milk is evidence of recent human evolution. All mammalian babies can digest lactose,
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationTHE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GENOME-WIDE MICROARRAY ANALYSIS IN A CASE-CONTROL STUDY REVEALS EVELATED LEVEL OF GLOBAL COPY
More informationStructural Variants and Susceptibility to Common Human Disorders Dr. Xavier Estivill
Structural Variants and Susceptibility Genetic Causes of Disease Lab Genes and Disease Program Center for Genomic Regulation (CRG) Barcelona 1 Complex genetic diseases Changes in prevalence (>10 fold)
More informationSNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY.
SAMPLE REPORT SNP Array NOTE: THIS IS A SAMPLE REPORT AND MAY NOT REFLECT ACTUAL PATIENT DATA. FORMAT AND/OR CONTENT MAY BE UPDATED PERIODICALLY. RESULTS SNP Array Copy Number Variations Result: GAIN,
More informationMissing Heritablility How to Analyze Your Own Genome Fall 2013
Missing Heritablility 02-223 How to Analyze Your Own Genome Fall 2013 Heritability Heritability: the propor>on of observed varia>on in a par>cular trait (as height) that can be agributed to inherited gene>c
More informationAntigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are
More informationImaging Genetics: Heritability, Linkage & Association
Imaging Genetics: Heritability, Linkage & Association David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University July 17, 2011 Memory Activation & APOE ε4 Risk
More informationDuring the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,
ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More information22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)
22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases
More informationUnit 5 Review Name: Period:
Unit 5 Review Name: Period: 1 4 5 6 7 & give an example of the following. Be able to apply their meanings: Homozygous Heterozygous Dominant Recessive Genotype Phenotype Haploid Diploid Sex chromosomes
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationCognitive, affective, & social neuroscience
Cognitive, affective, & social neuroscience Time: Wed, 10:15 to 11:45 Prof. Dr. Björn Rasch, Division of Cognitive Biopsychology University of Fribourg 1 Content } 5.11. Introduction to imaging genetics
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationAnalysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing
www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian
More informationChromosomal Mutations
Notes 2/17 Chromosomal Mutations A chromosome mutation is an unpredictable change that occurs in a chromosome. These changes are most often brought on by problems that occur during meiosis or by mutagens
More informationAgilent s Copy Number Variation (CNV) Portfolio
Technical Overview Agilent s Copy Number Variation (CNV) Portfolio Abstract Copy Number Variation (CNV) is now recognized as a prevalent form of structural variation in the genome contributing to human
More informationSingle Gene (Monogenic) Disorders. Mendelian Inheritance: Definitions. Mendelian Inheritance: Definitions
Single Gene (Monogenic) Disorders Mendelian Inheritance: Definitions A genetic locus is a specific position or location on a chromosome. Frequently, locus is used to refer to a specific gene. Alleles are
More informationComprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation (CNV) analysis in humans
Haraksingh et al. BMC Genomics (2017) 18:321 DOI 10.1186/s12864-017-3658-x RESEARCH ARTICLE Comprehensive performance comparison of high-resolution array platforms for genome-wide Copy Number Variation
More informationAsingle inherited mutant gene may be enough to
396 Cancer Inheritance STEVEN A. FRANK Asingle inherited mutant gene may be enough to cause a very high cancer risk. Single-mutation cases have provided much insight into the genetic basis of carcinogenesis,
More informationTutorial on Genome-Wide Association Studies
Tutorial on Genome-Wide Association Studies Assistant Professor Institute for Computational Biology Department of Epidemiology and Biostatistics Case Western Reserve University Acknowledgements Dana Crawford
More informationWhat lies beneath: challenges in reporting SNP array results. Jonathan Waters
What lies beneath: challenges in reporting SNP array results Jonathan Waters Challenges in variant interpretation Austin Court, Birmingham Monday 4 th July 2016 What lies beneath: challenges in reporting
More informationBio 312, Spring 2017 Exam 3 ( 1 ) Name:
Bio 312, Spring 2017 Exam 3 ( 1 ) Name: Please write the first letter of your last name in the box; 5 points will be deducted if your name is hard to read or the box does not contain the correct letter.
More informationGenome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S.
Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. December 17, 2014 1 Introduction Asthma is a chronic respiratory disease affecting
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More information