Title: Purine and pyrimidine metabolism: Convergent evidence on. chronic antidepressant treatment response in mice and humans
|
|
|
- Lee Alberta Cox
- 5 years ago
- Views:
Transcription
1 Supplementary Information Title: Purine and pyrimidine metabolism: Convergent evidence on chronic antidepressant treatment response in mice and humans Dong Ik Park 1,7, Carine Dournes 2,7, Inge Sillaber 3, Manfred Uhr 4, John M. Asara 5, Nils C. Gassen 2, Theo Rein 2, Marcus Ising 4, Christian Webhofer 1, Michaela D. Filiou 2, Marianne B. Müller 1,6, Christoph W. Turck 1, * 1 Max Planck Institute of Psychiatry, Department of Translational Research in Psychiatry, 80804, Munich, Germany; 2 Max Planck Institute of Psychiatry, Department of Stress Neurobiology and Neurogenetics, Munich, Germany; 3 Phenoquest AG, Martinsried, Germany; 4 Max Planck Institute of Psychiatry, Department of Clinical Research, Munich, Germany ; 5 Division of Signal Transduction, Beth Israel Deaconess Medical Center, and Department of Medicine, Harvard Medical School, Boston, MA 02115; 6 Experimental Psychiatry, Department of Psychiatry and Psychotherapy & Focus Program Translational Neuroscience, Johannes Gutenberg University Medical Center, Mainz, Germany 7 These authors contributed equally to this work. 1
2 Supplementary Results Supplementary Figure S1. The effect of chronic paroxetine treatment on female urine sniffing test (FUST). Sniffing time at (a) baseline and (b) after 28 days of paroxetine treatment. Chronic paroxetine treatment induced slightly significant difference of sniffing time between paroxetine-treated long- time floating (PLF) and paroxetine-treated short-time floating (PSF) groups. n(veh/plf/psf) = 43/22/34. *p < 0.05 (two-tailed t-test), ***p < (oneway ANOVA with Tukey s test for multiple comparisons). 2
3 Supplementary Figure S2. Covariates analysis. Paroxetine levels in (a) whole brain and (b) plasma. PLF and PSF groups did not show significant paroxetine levels differences, n(plf/psf)=5/8. The effect of (c) age and (d) body weight gain on FST floating time. Significant interactions of age and body weight gain with floating time were not observed. n(veh/plf/psf)=50/9/86. Data are expressed as the mean ± SEM. *p < 0.05, ***p < (one-way ANOVA with Tukey s test for multiple comparisons). Pearson correlation coefficients (r) with P values are indicated in the correlation graphs. 3
4 Supplementary Figure S3. Hippocampal SAM metabolites (q < 0.05, FDR < 0.1) and their significant correlates (r > 0.7, p < 0.05). 4
5 Supplementary Figure S4. Levels of hippocampal metabolites that are part of (a) pyrimidine and (b) purine metabolism pathways and correlation with forced swim test (FST) floating time. n = 5/group. Bars represent mean ± SEM. *p < 0.05, **p < 0.01, ***p < vs PLF (two-tailed t-test). Pearson correlation coefficients (r) with p values are indicated in the correlation graphs. 5
6 Supplementary Figure S5. Significant plasma metabolite level changes after chronic paroxetine treatment. Plasma SAM metabolites (q < 0.05, FDR < 0.1) and their significant correlates (r > 0.7, p < 0.05) in (a) PSF and (b) PLF groups. 6
7 Supplementary Figure S6. Plasma pathway metabolites. (a) Pyrimidine and (b) purine metabolism metabolite levels in the PSF group were elevated by chronic paroxetine treatment. The metabolite levels in the PLF group did not show alterations after chronic paroxetine administration. (c) Both PLF and PSF mice showed that glycine, serine and threonine metabolite levels were significantly down-regulated by chronic paroxetine treatment. The PLF and PSF groups exhibited similar metabolite levels both at T0 and T4. n = 5/group. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < (two-tailed t-test). 7
8 Supplementary Figure S7. Correlation of plasma pathway metabolite levels with FST floating time. Pearson correlation coefficients (r) with p values are indicated in the correlation graphs. 8
9 Supplementary Figure S8. Common plasma SAM signatures between PLF and PSF groups. q value < 0.05 in either PLF or PSF groups, FDR <
10 Supplementary Figure S9. Full-length western blot images of Figure 4a. 10
11 Supplementary Figure S10. Energy-related metabolite ratios and myoinositol correlation between hippocampus and plasma. (a) ATP/ADP and NAD+/NADH ratios in the hippocampus between the PLF and PSF group. n = 5/group. (b) Myo-inositol correlation between hippocampus and plasma. n = 10. Bars represent mean ± SEM. *p < 0.05 (two-tailed t-test). Pearson correlation coefficients (r) with P values are indicated in the correlation graphs. 11
12 Supplementary Figure S11. Correlation between hippocampus and plasma metabolite levels. Pearson correlation coefficients (r) with P values are indicated in the correlation graphs. 12
13 Supplementary Table S1. Demographic and clinical characteristics of antidepressant responders and non-responders included in PBMCs protein expression analysis 13
14 Supplementary Table S2. Demograhic and clinical characteristics of antidepressant responders and non-responders included in ex vivo PBMCs cultivation and paroxetine treatment. 14
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
Pyruvate Alanine 0.15 *** ** ***
SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
SUPPLEMENTARY FIGURES. The Gatekeepers in the Mouse Ophthalmic Artery: Endothelium-Dependent. Mechanisms of Cholinergic Vasodilation
SUPPLEMENTARY FIGURES The Gatekeepers in the Mouse Ophthalmic Artery: Endothelium-Dependent Mechanisms of Cholinergic Vasodilation Caroline Manicam 1*, Julia Staubitz 1, Christoph Brochhausen 2, Franz
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
Proteome Analysis of Schizophrenia Brain Tissue
Proteome Analysis of Schizophrenia Brain Tissue Daniel Martins-de-Souza Max Planck Institute for Psychiatry Proteomics and Biomarkers München - Germany Laboratory of Neuroscience (LIM-27) Dept of Psychiatry,
SUPPLEMENTAL: Functional connectomics of affective and psychotic pathology
SUPPLEMENTAL: Functional connectomics of affective and psychotic pathology Justin T. Baker a,b*, Daniel G. Dillon b,c, Lauren M. Patrick d, Joshua L. Roffman b,e,f, Roscoe O. Brady, Jr. a,b,g, Diego A.
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Social stress induces neurovascular pathology promoting depression
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0010-3 In the format provided by the authors and unedited. Social stress induces neurovascular pathology promoting depression Caroline
Relative Rates. SUM159 CB- 839-Resistant *** n.s Intracellular % Labeled by U- 13 C-Asn 0.
A Relative Growth Rates 1.2 1.8.6.4.2 B Relative Rates 1.6 1.4 1.2 1.8.6.4.2 LPS2 Parental LPS2 Q-Independent SUM159 Parental SUM159 CB-839-Resistant LPS2 Parental LPS2 Q- Independent SUM159 Parental SUM159
Reflections On The Development Of Glutamate-Based Antidepressants
Reflections On The Development Of Glutamate-Based Antidepressants Phil Skolnick, Ph.D., D.Sc. (hon.) Chief Scientific Officer ASCP, May 2018 1 Conflict of Interest I am a full time of employee of Opiant
Supplemental Information. Checkpoint Blockade Immunotherapy. Induces Dynamic Changes. in PD-1 CD8 + Tumor-Infiltrating T Cells
Immunity, Volume 50 Supplemental Information Checkpoint Blockade Immunotherapy Induces Dynamic Changes in PD-1 CD8 + Tumor-Infiltrating T Cells Sema Kurtulus, Asaf Madi, Giulia Escobar, Max Klapholz, Jackson
Supplementary Information
Supplementary Information NEPRILYSIN IS A MEDIATOR OF ALTERNATIVE RENIN- ANGIOTENSIN- SYSTEM ACTIVATION IN THE MURINE AND HUMAN KIDNEY Oliver Domenig 1#, Arndt Manzel 2#, Nadja Grobe 3, Eva Koenigshausen
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Malenka, RC N5579A Article Reporting Checklist for Nature Neuroscience # Main s: 6 # lementary s: 0 # lementary Tables: 0 # lementary Videos: 0
Supplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Simon Musall NNA47695 Article Reporting Checklist for Nature Neuroscience # Main Figures: 6 # Supplementary Figures: 14 # Supplementary Tables:
LONG-TERM ADMINISTRATION OF MELATONIN ATTENUATES NEUROINFLAMMATION IN THE AGED MOUSE BRAIN
Supplementary data to: LONG-TERM ADMINISTRATION OF MELATONIN ATTENUATES NEUROINFLAMMATION IN THE AGED MOUSE BRAIN Kannika Permpoonputtana 1, Patlada Tangweerasing 2, Sujira Mukda 2, Parichart Boontem 3,
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Daniel O'Connor NNA53650A Article Reporting Checklist for Nature Neuroscience # Main Figures: 7 # Supplementary Figures: 10 # Supplementary Tables:
Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis
A20 (TNFAIP3) deficiency in myeloid cells triggers erosive polyarthritis resembling rheumatoid arthritis Mourad Matmati 1,2 *, Peggy Jacques 3 *, Jonathan Maelfait 1,2, Eveline Verheugen 3, Mirjam Kool
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Roger Thompson NNA52598C Article Reporting Checklist for Nature Neuroscience # Main Figures: 7 # Supplementary Figures: 9 # Supplementary Tables:
a Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Subhojit Roy NNA51787 Article Reporting Checklist for Nature Neuroscience # Main Figures: Eight # lementary Figures: Seven # lementary Tables:
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded
Supplementary Figure 1. Metabolic landscape of cancer discovery pipeline. RNAseq raw counts data of cancer and healthy tissue samples were downloaded from TCGA and differentially expressed metabolic genes
Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
Metabolic response induced by parasitic plant-fungus interactions hinder amino sugar and nucleotide sugar metabolism in the host
Supplementary information Metabolic response induced by parasitic plant-fungus interactions hinder amino sugar and nucleotide sugar metabolism in the host Dong-Kyu Lee, Soohyun Ahn, Hae Yoon Cho, Hye Young
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: NNA49200 Manuscript Type: Matthew Walker & Bryce Mander Article Reporting Checklist for Nature Neuroscience # Main Figures: 4 # Supplementary Figures: 3 # Supplementary
Name/Institution: Fernanda Neutzling Kaufmann, PhD student at Post Graduate Program in Biochemistry, Federal University of Santa Catarina, Brazil
PROGRESS REPORT Committee for Aid and Education in Neurochemistry (CAEN) CATEGORY 1A: Visit by the applicant to another laboratory July, 2018 Name/Institution: Fernanda Neutzling Kaufmann, PhD student
Supporting Information
Revisiting default mode network function in major depression: evidence for disrupted subsystem connectivity Fabio Sambataro 1,*, Nadine Wolf 2, Maria Pennuto 3, Nenad Vasic 4, Robert Christian Wolf 5,*
Social transmission and buffering of synaptic changes after stress
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0044-6 In the format provided by the authors and unedited. Social transmission and buffering of synaptic changes after stress Toni-Lee
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Rutishauser NNA57105 Article Reporting Checklist for Nature Neuroscience # Main Figures: 8 # Supplementary Figures: 6 # Supplementary Tables: 1
Dissected tissues were minced and lysed in lysis buffer (1x Tris buffered saline (TBS), 1% NP-40,
Data Supplement for Dincheva et al., Effect of Early-Life Fluoxetine on Anxiety-Like Behaviors in BDNF Val66Met Mice. Am J Psychiatry (doi: 10.1176/appi.ajp.2017.15121592) Contents Supplemental Methods
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
Steps in Inferential Analyses. Inferential Statistics. t-test
Steps in Inferential Analyses Inferential Statistics Dr. K. A. Korb University of Jos VassarStats: http://faculty.vassar.edu/lowry/vassarstats.html In any inferential statistic, the first step is always
Anatomical MRI and DTI in the Diagnosis of Alzheimer s Disease: A European Multicenter Study
Journal of Alzheimer s Disease 31 (2012) S1 S5 IOS Press S1 Supplementary Data Anatomical MRI and DTI in the Diagnosis of Alzheimer s Disease: A European Multicenter Study Stefan J. Teipel a,b,, Martin
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Tali Sharot NNA549D Article Reporting Checklist for Nature Neuroscience # Main ures: 4 # lementary ures: 5 # lementary Tables: 4 # lementary Videos:
Schwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Bernhard Staresina A51406B Article Reporting Checklist for Nature Neuroscience # Main Figures: 5 # Supplementary Figures: 10 # Supplementary Tables:
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
The Relation of Internet Addiction and Excessive Daytime Sleepiness in Korean College Students
, pp.248-252 http://dx.doi.org/10.14257/astl.2015.103.53 The Relation of Internet Addiction and Excessive Daytime Sleepiness in Korean College Students Mee-Kyung Shin Korea Nazarene University, Department
SUPPLEMENTARY INFORMATION
Encoding of conditioned fear in central amygdala inhibitory circuits Stephane Ciocchi 1,*, Cyril Herry 1,,*, François Grenier 1, Steffen B.E. Wolff 1, Johannes J. Letzkus 1, Ioannis Vlachos 3, Ingrid Ehrlich
Lack of GPR88 enhances medium spiny neuron activity and alters. motor- and cue- dependent behaviors
Lack of GPR88 enhances medium spiny neuron activity and alters motor- and cue- dependent behaviors Albert Quintana, Elisenda Sanz, Wengang Wang, Granville P. Storey, Ali D. Güler Matthew J. Wanat, Bryan
Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Effect of concomitant administration of three different antidepressants with vitamin B6 on depression and obsessive compulsive disorder in mice models
Research in Pharmaceutical Sciences, February 217; 12(1): 46-52 Received: April 216 Accepted: August 216 School of Pharmacy & Pharmaceutical Sciences Isfahan University of Medical Sciences Original Article
1. Below is the output of a 2 (gender) x 3(music type) completely between subjects factorial ANOVA on stress ratings
SPSS 3 Practice Interpretation questions A researcher is interested in the effects of music on stress levels, and how stress levels might be related to anxiety and life satisfaction. 1. Below is the output
Package labstats. December 5, 2016
Type Package Package labstats December 5, 2016 Title Data Sets for the Book ``Experimental Design for Laboratory Biologists'' Version 1.0.1 Date 2016-12-04 Author Stanley E. Lazic Maintainer Stanley E.
Supporting Information
Supporting Information Deng et al. 0.073/pnas.09038206 SI Text Animals and Subretinal Injections. Tr / mice were a gift from Dr. Janis Lem. GNAT2 cpfl3, rd7 and wildtype ALR/LtJ mice were purchased from
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical
Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously
Paeoniflorin ameliorates interferon-alpha-induced neuroinflammation and depressive-like behaviors in mice
/, 2017, Vol. 8, (No. 5), pp: 8264-8282 Paeoniflorin ameliorates interferon-alpha-induced neuroinflammation and depressive-like behaviors in mice Jianwei Li 1,*, Shaohui Huang 1,*, Weiliang Huang 1,*,
BIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 25 no. 2 2009, pages 237 242 doi:10.1093/bioinformatics/btn613 Genetics and population analysis Prioritizing risk pathways: a novel association approach to searching
Suppl. Information Supplementary Figure 1. Strategy/latency analysis of individual mice during maze learning. a,
Goal-oriented searching mediated by ventral hippocampus early in trial-and-error learning Ruediger, S, Spirig, D., Donato, F., Caroni, P. Suppl. Information Supplementary Figure 1. Strategy/latency analysis
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
AGENDA for San Diego, November 1-3, 2018
AGENDA for San Diego, November 1-3, 2018 THURSDAY, NOV. 1, 2018 5.0 CE s Quieting the Hungry Ghost: * Learning Objectives Mindful Relapse Prevention for Maintaining Healthy Habits with Richard Fields,
Time-dependent metabolomic profiling of Ketamine drug action reveals hippocampal pathway alterations and biomarker candidates
reveals hippocampal pathway alterations and biomarker candidates The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
William Wikoff : UC Davis (Committee chair) Pavel Aronov: Stanford University. John Asara: Harvard University. Vladimir Shulaev: University of Texas
MRG: Metabolomics Research Group William Wikoff : UC Davis (Committee chair) Pavel Aronov: Stanford University John Asara: Harvard University it Vladimir Shulaev: University of Texas Chris Turck: Max Planck
The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided into five regions: cortex, hippocampus,
Supplemental material Supplemental method RNA extraction, reverse transcription, and real-time PCR The levels of mrna expression in the mouse brain were measured at 52 dpi after the brains were divided
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
StratomeX Visual Analysis of Large-Scale Heterogeneous Genomics Data for Cancer Subtype Characterization
StratomeX Visual Analysis of Large-Scale Heterogeneous Genomics Data for Cancer Subtype Characterization Alexander Lex 1, Marc Streit 2, Hans-Jörg Schulz 3, Christian Partl 1, Dieter Schmalstieg 1, Peter
1.0. FSL NMDAR-fEPSP 0.8. amplitude (mv) Intensity (µa) 2.0 SD FSL Time (ms)
a 2.5 1. AMPAR-fEPSP slope (mv/ms) 2. 1. NMDAR-fEPSP amplitude (mv).8.6.4.5.2. 2 4 6 8. 1 2 3 4 5 Intensity (µa) Intensity (µa) b 2. PPF Ratio (fepsp2/fepsp1) 1..5. 5 1 2 5 Time (ms) Supplementary Figure
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Alex Pouget NN-A46249B Article Reporting Checklist for Nature Neuroscience # Main Figures: 7 # Supplementary Figures: 3 # Supplementary Tables:
SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.
Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms
Supplemental information Acid-sensing ion channel 1a contributes to hippocampal LTP inducibility through multiple mechanisms Ming-Gang Liu, Hu-Song Li, Wei-Guang Li, Yan-Jiao Wu, Shi-Ning Deng, Chen Huang,
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
2010 EDRS PROGRAM AND SCHEDULE. 1:15 3:00 p.m. Symposium 1: Prevention of Eating Disorders and Obesity
THURSDAY, OCTOBER 7, 2010: 1:00 1:15 p.m. Welcome from President 2010 EDRS PROGRAM AND SCHEDULE 1:15 3:00 p.m. Symposium 1: Prevention of Eating Disorders and Obesity Linking Eating Disorders and Overweight
Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1
Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in
Nature Immunology: doi: /ni Supplementary Figure 1. Transcriptional program of the TE and MP CD8 + T cell subsets.
Supplementary Figure 1 Transcriptional program of the TE and MP CD8 + T cell subsets. (a) Comparison of gene expression of TE and MP CD8 + T cell subsets by microarray. Genes that are 1.5-fold upregulated
SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
Supplementary Figure 1
Supplementary Figure 1 AAV-GFP injection in the MEC of the mouse brain C57Bl/6 mice at 4 months of age were injected with AAV-GFP into the MEC and sacrificed at 7 days post injection (dpi). (a) Brains
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Prof. Giulio Tononi N56649CZ Article Reporting Checklist for Nature Neuroscience # Main s: 5 # lementary s: 8 # lementary s: 4 # lementary Videos:
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
The BEACH protein LRBA is Required for Hair Bundle Maintenance in Cochlear Hair
The BEACH protein LRBA is Required for Hair Bundle Maintenance in Cochlear Hair Cells and for Hearing Short title: LRBA is Required for Hair Bundle Maintenance in Cochlear Hair Cells Christian Vogl 1,*,
Buenos Aires, October 28 th, 2015
Buenos Aires, October 28 th, 2015 Final Report: Category C - Return Home Award Awarded to: Silvina Laura Diaz Affiliation: Instituto de Biología Celular y Neurociencias Prof. E. De Robertis, Universidad
Supplementary figure 1 (related to fig 1)
Histological score linical Score Weight loss (%) olon length (cm) Supplementary figure (related to fig ) N ### ## ays on % E ### - - - - N ays on % $$ $$ # ## N. N N Supplementary figure : Lack of fibre
Research Perspective on Controversies In Prehospital Care
Research Perspective on Controversies In Prehospital Care Christopher Fischer, MD Beth Israel Deaconess Medical Center Harvard Affiliated Emergency Medicine Residency Boston, MA Introduction What is Research?
14-3-3ζ deficient mice in the BALB/c background display behavioural and. anatomical defects associated with neurodevelopmental disorders
Supplementary information 14-3-3ζ deficient mice in the BALB/c background display behavioural and anatomical defects associated with neurodevelopmental disorders Xiangjun Xu 1, Emily J. Jaehne 2, Zarina
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) 108 (b-c) (d) (e) (f) (g)
Supplementary Figure 1 Information on transgenic mouse models and their recording and optogenetic equipment. (a) In four mice, cre-dependent expression of the hyperpolarizing opsin Arch in pyramidal cells
A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
PKMζ maintains memories by regulating GluR2- dependent AMPA receptor trafficking
Supplementary information PKMζ maintains memories by regulating GluR2- dependent AMPA receptor trafficking Paola Virginia Migues, Oliver Hardt, Dong Chuan Wu, Karine Gamache, Todd Charlton Sacktor, Yu
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Reporting Checklist for Nature Neuroscience
Corresponding Author: Manuscript Number: Manuscript Type: Wu Li NNA48469A Article Reporting Checklist for Nature Neuroscience # Main Figures: 6 # Supplementary Figures: 0 # Supplementary Tables: 0 # Supplementary