LONG-TERM ADMINISTRATION OF MELATONIN ATTENUATES NEUROINFLAMMATION IN THE AGED MOUSE BRAIN
|
|
|
- Baldwin Warner
- 5 years ago
- Views:
Transcription
1 Supplementary data to: LONG-TERM ADMINISTRATION OF MELATONIN ATTENUATES NEUROINFLAMMATION IN THE AGED MOUSE BRAIN Kannika Permpoonputtana 1, Patlada Tangweerasing 2, Sujira Mukda 2, Parichart Boontem 3, Chutikorn Nopparat 2, Piyarat Govitrapong 2,3,4,* 1 National Institute for Child and Family Development, Mahidol University, Thailand 2 Research Center for Neuroscience, Institute of Molecular Biosciences, Mahidol University, Thailand 3 Chulabhorn Graduate Institute, Chulabhorn Royal Academy, Thailand 4 Department of Pharmacology, Faculty of Science, Mahidol University, Thailand * Corresponding author: Piyarat Govitrapong, Chulabhorn Graduate Institute, Chulabhorn Royal Academy, 54 Kamphaeng Phet 6 Road, Lak Si, Bangkok 10210, Thailand, piyarat.gov@mahidol.ac.th, piyarat@cgi.ac.th This is an Open Access article distributed under the terms of the Creative Commons Attribution License ( Supplementary Table 1: The effect of melatonin on CD11b and GFAP levels in the hippocampus CD11b Hippocampus N N N N Mean S.E.M ** # Prefrontal cortex N N N N Mean S.E.M ** # GFAP Hippocampus N N N N Mean S.E.M ** # Prefrontal cortex N N N N Mean S.E.M *** # CD11b and GFAP levels were determined by Western blot analyses. A one-way ANOVA was performed for statistical analysis. Data represent the mean ± S.E.M. from 4. ** p < 0.01 and ***p < compared with young, and # p < 0.05 compared with S1
2 Supplementary Table 2: The effect of melatonin on IL-1β, IL-6, and TNF-α levels in the hippocampus IL-1β Hippocampus N N N N Mean S.E.M *** ## Prefrontal cortex N N N N Mean S.E.M *** ## IL-6 Hippocampus N N N N Mean S.E.M ** # Prefrontal cortex N N N N Mean S.E.M *** ## TNF-α Hippocampus N N N N Mean S.E.M * ## Prefrontal cortex N N N N Mean S.E.M * ### IL-1β, IL-6, and TNF-α levels were determined by Western blot analyses. A one-way ANOVA was performed for statistical analysis. Data represent the mean ± S.E.M. from 4. *p < 0.05, **p < 0.01 and ***p < compared with young, and # p < 0.05, ## p < 0.01 and ### p < compared with. S2
3 Supplementary Table 3: The effect of melatonin on pnf-κb levels in the hippocampus and the pnf-κb Hippocampus N N N N Mean S.E.M ** ### Prefrontal cortex N N N N Mean S.E.M * # pnf-κb levels were determined by Western blot analyses. A one-way ANOVA was performed for statistical analysis. Data represent the mean ± S.E.M. from 4. *p < 0.05 and **p < 0.01 compared with young, and # p < 0.05 and ### p < compared with. S3
4 Supplementary Table 4: The effect of melatonin on NR2A, NR2B, and CaMKII levels in the hippocampus NR2A Hippocampus N N N N Mean S.E.M ** # Prefrontal cortex N N N N Mean S.E.M * # NR2B Hippocampus N N N N Mean S.E.M *** # Prefrontal cortex N N N N Mean S.E.M * # CaMKII Hippocampus N N N N Mean S.E.M * # Prefrontal cortex N N N N Mean S.E.M * # NR2A, NR2B, and CaMKII levels were determined by Western blot analyses. A one-way ANOVA was performed for statistical analysis. Data represent the mean ± S.E.M. from 4. *p < 0.05, **p < 0.01 and ***p < compared with young, and # p < 0.05 compared with. S4
5 Supplementary Table 5: The effect of melatonin on BDNF levels in the hippocampus and the prefrontal cortex of BDNF Hippocampus N N N N Mean S.E.M * # Prefrontal cortex N N N N Mean S.E.M ** # BDNF levels were determined by Western blot analyses. A one-way ANOVA was performed for statistical analysis. Data represent the mean ± S.E.M. from 4. *p < 0.05, **p < 0.01 compared with young, and # p < 0.05 compared with S5
Fig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
Hypothalamic TLR2 triggers sickness behavior via a microglia-neuronal axis
Hypothalamic TLR triggers sickness behavior via a microglia-neuronal axis Sungho Jin, *, Jae Geun Kim,, *, Jeong Woo Park, Marco Koch,, Tamas L. Horvath and Byung Ju Lee Department of Biological Sciences,
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Original article: MELATONIN REGULATES THE AGING MOUSE HIPPOCAMPAL HOMEOSTASIS VIA THE SIRTUIN1-FOXO1 PATHWAY
Original article: MELATONIN REGULATES THE AGING MOUSE HIPPOCAMPAL HOMEOSTASIS VIA THE SIRTUIN1-FOXO1 PATHWAY Anorut Jenwitheesuk 1, Parichart Boontem 2, Prapimpun Wongchitrat 3, Jiraporn Tocharus 4 Sujira
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
Serum cytokine levels in control and tumor-bearing male and female mice at day 15.
Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Takayuki Hirai, Kenzo Uchida, Hideaki Nakajima, Tomoo Inukai, Naoto Takeura, Shuji Watanabe, Hisatoshi Baba
Chronic progressive compression induces the phenotype changes of the activated microglia/macrophages in the spinal cord of spinal hyperostotic twy/twy mouse: implications in human cervical compressive
Plasmodium Vivax Malaria Transmission in a Network of Villages
World Academy of Science, Engineering and Technology 44 28 Vivax Malaria Transmission in a Network of Villages P. Pongsumpun, and I. M. Tang Abstract Malaria is a serious, acute and chronic relapsing infection
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Dissected tissues were minced and lysed in lysis buffer (1x Tris buffered saline (TBS), 1% NP-40,
Data Supplement for Dincheva et al., Effect of Early-Life Fluoxetine on Anxiety-Like Behaviors in BDNF Val66Met Mice. Am J Psychiatry (doi: 10.1176/appi.ajp.2017.15121592) Contents Supplemental Methods
Cognitive effects may be linked to 19/11/2012
Cognitive effects may be linked to 19/11/2012 active transport and urban air pollution Luc Int Panis 2012 Polis Conference Perugia Session: III A: The benefits of active travel 19/11/2012 2 New: neurological
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Supplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
Supplementary Fig. 1: TBR2+ cells in different brain regions.
Hip SVZ OB Cere Hypo Supplementary Fig. 1: TBR2 + cells in different brain regions. Three weeks after the last tamoxifen injection, TBR2 immunostaining images reveal a large reduction of TBR2 + cells in
Dengue Vaccines Mahidol
We have made it easy for you to find a PDF Ebooks without any digging. And by having access to our ebooks online or by storing it on your computer, you have convenient answers with dengue vaccines mahidol.
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
Paeoniflorin ameliorates interferon-alpha-induced neuroinflammation and depressive-like behaviors in mice
/, 2017, Vol. 8, (No. 5), pp: 8264-8282 Paeoniflorin ameliorates interferon-alpha-induced neuroinflammation and depressive-like behaviors in mice Jianwei Li 1,*, Shaohui Huang 1,*, Weiliang Huang 1,*,
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed
Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal
Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
The Role of Brain Inflammation in Epileptogenesis in TSC. CONTRACTING ORGANIZATION: Washington University School of Medicine St Louis, M
AD Award Number: W81XWH-12-1-0190 TITLE: The Role of Brain Inflammation in Epileptogenesis in TSC PRINCIPAL INVESTIGATOR: Michael Wong CONTRACTING ORGANIZATION: Washington University School of Medicine
Transmission network dynamics of Plasmodium Vivax Malaria
Transmission network dynamics of Plasmodium Vivax Malaria P. Pongsumpun, and I.M.Tang Abstract One of the top ten killer diseases in the world is Malaria. In each year, there are between 3 to 5 million
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70%
Primary Mouse Cerebral Cortex Neurons V: 80% TE: 70% Pictures: 9 days after electroporation Red: MAP2 Blue: GFAP Green: GFP The cells were from Embryonic Day 14 Mouse Cerebral Cortex Primary Mouse Hippocampal
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
In vivo effect of anti-inflammatory compounds on HIV-1 gp120 -mediated brain inflammation
In vivo effect of anti-inflammatory compounds on HIV-1 gp120 -mediated brain inflammation Tamima Ashraf, PhD candidate Supervisor: Dr. Reina Bendayan University of Toronto, Leslie Dan Faculty of Pharmacy,
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development
Disrupting GluA2-GAPDH Interaction Affects Axon and Dendrite Development 1 Frankie Hang Fung Lee, 1 Ping Su, 1 Yu Feng Xie, 1 Kyle Ethan Wang, 2 Qi Wan and 1,3 Fang Liu 1 Campbell Research Institute, Centre
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
14-3-3ζ deficient mice in the BALB/c background display behavioural and. anatomical defects associated with neurodevelopmental disorders
Supplementary information 14-3-3ζ deficient mice in the BALB/c background display behavioural and anatomical defects associated with neurodevelopmental disorders Xiangjun Xu 1, Emily J. Jaehne 2, Zarina
Social stress induces neurovascular pathology promoting depression
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-017-0010-3 In the format provided by the authors and unedited. Social stress induces neurovascular pathology promoting depression Caroline
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney
SUPPLEMENTAL FIGURE LEGENDS Figure S1 Genetic or pharmacologic COX-2 inhibition led to increased kidney macrophage infiltration. Wild type or COX-2 -/- mice (2 months old, C57/Bl6 background) were treated
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Supplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108
Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing
GW(g)/BW(g) GW(g)/BW(g) Con Dex Con Dex. GW(g)/BW(g) Relative mrna levels. Atrogin-1 Murf-1. Atrogin-1 Murf-1. Soleus
a b c GW(g) GW(g) GW(g) 0.20 0.15 0.10 0.05 0.00 0.20 0.15 0.10 0.05 Den * ** GW(g)/BW(g) Den Dex Dex GW(g)/BW(g) d 0.00 Fasting GW(g) e 0.15 Cancer Cachexia f GW(g) 0.10 0.05 0.00 Young ** Old g GW(g)/BW(g)
Nature Neuroscience: doi: /nn Supplementary Figure 1. Lick response during the delayed Go versus No-Go task.
Supplementary Figure 1 Lick response during the delayed Go versus No-Go task. Trial-averaged lick rate was averaged across all mice used for pyramidal cell imaging (n = 9). Different colors denote different
A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype
Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype
Title: Purine and pyrimidine metabolism: Convergent evidence on. chronic antidepressant treatment response in mice and humans
Supplementary Information Title: Purine and pyrimidine metabolism: Convergent evidence on chronic antidepressant treatment response in mice and humans Dong Ik Park 1,7, Carine Dournes 2,7, Inge Sillaber
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Quantification of myelin fragments in the aging brain (a) Electron microscopy on corpus callosum is shown for a 18-month-old wild type mice. Myelin fragments (arrows) were detected
Journal of Chemical and Pharmaceutical Research
Available on line www.jocpr.com Journal of Chemical and Pharmaceutical Research ISSN No: 0975-7384 CODEN(USA): JCPRC5 J. Chem. Pharm. Res., 2011, 3(4):196-203 In Vitro Effect of Thai herbal extracts with
Age-related decrease in glucagon-like peptide-1 in mouse prefrontal cortex but not in hippocampus despite the preservation of its receptor
American Journal of BioScience 2015; 3(1): 11-27 Published online January 29, 2015 (http://www.sciencepublishinggroup.com/j/ajbio) doi: 10.11648/j.ajbio.20150301.13 ISSN: 2330-0159 (Print); ISSN: 2330-0167
Diabetic silkworms for evaluation of therapeutically effective drugs
Supplementary information Diabetic silkworms for evaluation of therapeutically effective drugs against type II diabetes. Yasuhiko Matsumoto, Masaki Ishii, Yohei Hayashi, Shinya Miyazaki, Takuya Sugita,
Pyruvate Alanine 0.15 *** ** ***
SUPPLEMENTARY FIGURES Glucose ΔµM from fresh media / mg protein -1-2 -3 - -.1 -.3 -.5 Lactate Alanine Formate ΔµM from fresh media / mg protein 5 3 2 1.15.1.5.6..2.. NS-3 WT-NS G93A-NS Supplementary Figure
Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke
SUPPLEMENTARY INFORMATION doi:10.1038/nature09511 Supplementary Table I Blood pressure and heart rate measurements pre- and post-stroke Pre Post 7-days Systolic Diastolic BPM Systolic Diastolic BPM Systolic
- 1 - CURRICULUM VITAE
- 1 - CURRICULUM VITAE NAME Tullayakorn Plengsuriyakarn NATIONALITY Thai EDUCATION 2013 Postdoctoral Fellowship Department of Clinical Product Development, Institute of Tropical Medicine, Nagasaki University,
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
NS1 Protein Expression in the JaOArS982 Strain of Japanese Encephalitis Virus Does Not Enhance Virulence in Mice
Tropical Medicine and Health Vol. 43 No.4, 2015, 233 237 doi: 10.2149/tmh.2015-27 Copyright 2015 by The Japanese Society of Tropical Medicine 233 Short Communications NS1 Protein Expression in the JaOArS982
The Marmoset Monkey as Model for Neurological Disorders
The Marmoset Monkey as Model for Neurological Disorders Jan Langermans and Ingrid Philippens From Laboratory to Clinic Disease models neuroscience: Parkinson, Sleep, Stress, Alzheimer, MS MS Models: rhmog
NK cells promote neutrophil recruitment in the brain during sepsisinduced. neuroinflammation
NK cells promote neutrophil recruitment in the brain during sepsisinduced neuroinflammation Hao He 1, Tingting Geng 1, Piyun Chen 1, Meixiang Wang 1, Jingxia Hu 1, Li Kang 1, Wengang Song 1, * & Hua Tang
Nature Neuroscience: doi: /nn Supplementary Figure 1. PICALM expression in brain capillary endothelium in human brain and in mouse brain.
Supplementary Figure 1 PICALM expression in brain capillary endothelium in human brain and in mouse brain. a, Double immunostaining for PICALM (red, left) and lectin positive endothelial profiles (blue,
Chapter 7. Discussion and impact
Chapter 7 Discussion and impact 225 Affective pathology is a complex construct which encompasses a pathological disturbance in primary emotions, rapidly shifting from neutral to intense perception, associated
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Supplementary table I. Real-time primers used in the study. The fold change was obtained by
Supplementary table I. Real-time primers used in the study. The fold change was obtained by normalizing the gene expression number to those of HPRT, then comparing the samples to untreated or naive mice.
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Amniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
Zhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
293T cells were transfected with indicated expression vectors and the whole-cell extracts were subjected
SUPPLEMENTARY INFORMATION Supplementary Figure 1. Formation of a complex between Slo1 and CRL4A CRBN E3 ligase. (a) HEK 293T cells were transfected with indicated expression vectors and the whole-cell
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
Original article: COMPARISON OF MELATONIN WITH GROWTH FACTORS IN PROMOTING PRECURSOR CELLS PROLIFERATION IN ADULT MOUSE SUBVENTRICULAR ZONE
Original article: COMPARISON OF MELATONIN WITH GROWTH FACTORS IN PROMOTING PRECURSOR CELLS PROLIFERATION IN ADULT MOUSE SUBVENTRICULAR ZONE Areechun Sotthibundhu a,b, Kasima Ekthuwapranee c,d, Piyarat
NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse
Supplementary information to: Mechanism of lipopolysaccharide-induced skin edema formation in the mouse Ivan Zanoni*, Renato Ostuni*, Simona Barresi, Marco Di Gioia, Achille Broggi, Barbara Costa, Roberta
Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov
Macrophages and Exosomes Employ Brain Inflammation for CNS Delivery of Therapeutics A. Kabanov Targeting Brain Inflammation in Disease Biochemical studies of brains from individuals with many neurologic
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Curriculum Vitae. Education: Residency - Department of Neurosurgery
Curriculum Vitae Steven A. Dutcher, D.O., Ph.D., FAANS, FACOS Palm Beach Neurosurgery, LLC 3319 State Road 7 601 University Blvd Suite #313 Suite #203 Wellington, FL 33449 Jupiter, FL 33458 (561)433 4444
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs
Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95
Supplementary Material S3 Further Seed Regions
Supplementary Material S3 Further Seed Regions Figure I. Changes in connectivity with the right anterior insular cortex. (A) wake > mild sedation, showing a reduction in connectivity between the anterior
CURRICULUM VITAE. Jaratsak Ruangpeerakul M.D. Fellow in Dermatology(SIRIRAJ) Board of Dermatology(SIRIRAJ) Diploma Thai board of Family medicine
CURRICULUM VITAE Jaratsak Ruangpeerakul M.D. Fellow in Dermatology(SIRIRAJ) Board of Dermatology(SIRIRAJ) Diploma Thai board of Family medicine PERSONAL DETAILS Name: Home Address: Dr. Jaratsak Ruangpeerakul
Title of file for HTML: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References
Title of file for HTML: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References Supplementary Information Supplementary Figure 1. The mean parameter
SUPPLEMENTARY INFORMATION
Figure S1. Loss of Ena/VASP proteins inhibits filopodia and neuritogenesis. (a) Bar graph of filopodia number per stage 1 control and mmvvee (Mena/ VASP/EVL-null) neurons at 40hrs in culture. Loss of all
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
S100B+ Cell Density day Spine Formation (%)
b * CP * HC CP Th DAPI S100B ** 50 40 30 * 20 10 0-10 -20 * * ** 9 6 3 0 0-50 50-100 100-150 150-200 Distance from Prism Face (um) 1-day Spine Formation (%) 1-day Spine Elimination (%) 12 Distance from
Supplemental Materials. Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in. Pancreatic Cancer.
Supplemental Materials Stromal Modulation Reverses Primary Resistance to Immune Checkpoint Blockade in Pancreatic Cancer Jun Zhao 1, Zhilan Xiao 2, 3, Tingting Li 1, 4, Huiqin Chen 5, Ying Yuan 5, Alan
JLC Lee: Memory reconsolidation mediates the strengthening of memories by additional learning
JLC Lee: Memory reconsolidation mediates the strengthening of memories by additional learning 8 6 4 Cond1 Cond2 Test VEH ANI Session Supplementary Fig. 1. Protein synthesis inhibition after a second contextual
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Supplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
Numerical Simulation of Blood Flow in the System of Human Coronary Arteries with and without Bypass Graft
Numerical Simulation of Blood Flow in the System of Human Coronary Arteries with and without Bypass Graft BURASKORN NUNTADILOK 1, BENCHAWAN WIWATANAPATAPHEE 1 MEECHOKE CHUEDOUNG 1, THANONGCHAI SIRIAPISITH
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice
Supplementary Information Epigenetic modulation of inflammation and synaptic plasticity promotes resilience against stress in mice Wang et. al. IL-6 in plasma (pg/ml) Rac1/HPRT (% of control) PSD9/HPRT
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β