Supplementary Table 1. In vitro side effect profiling study for LDN/OSU
|
|
|
- Godwin Nicholson
- 6 years ago
- Views:
Transcription
1 Supplementary Table 1. In vitro side effect profiling study for LDN/OSU Receptor Percent Inhibition 10 µm Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective 24.98% Adrenergic, Alpha 2, Non-selective 27.18% Adrenergic, Beta, Non-selective % Dopamine Transporter 8.69% Dopamine, D1 (h) 8.48% Dopamine, D2s (h) 4.06% GABA A, Agonist Site % GABA A, BDZ, alpha 1 site 12.73% GABA-B 13.60% Glutamate, AMPA Site (Ionotropic) 12.06% Glutamate, Kainate Site (Ionotropic) -1.03% Glutamate, NMDA Agonist Site (Ionotropic) 0.12% Glutamate, NMDA, Glycine (Stry-insens Site) 9.84% (Ionotropic) Glycine, Strychnine-sensitive 0.99% Histamine, H1-5.54% Histamine, H % Histamine, H3 4.80% Melatonin, Non-selective -5.54% Muscarinic, M1 (hr) -1.88% Muscarinic, M2 (h) 0.82% Muscarinic, Non-selective, Central 29.04% Muscarinic, Non-selective, Peripheral 0.29% Nicotinic, Neuronal ( -BnTx insensitive) 7.85% Norepinephrine Transporter 2.87% Opioid, Non-selective -0.09% Opioid, Orphanin, ORL1 (h) 11.55% Serotonin Transporter -3.02% Serotonin, Non-selective 26.33% Sigma, Non-Selective 10.19% Steroids Estrogen 11.16% 1
2 Receptor Percent Inhibition 10 µm Testosterone (cytosolic) (h) 12.50% Ion Channels Calcium Channel, Type L (Dihydropyridine Site) 43.18% Calcium Channel, Type N 4.15% Potassium Channel, ATP-Sensitive -4.05% Potassium Channel, Ca2+ Act., VI 17.80% Potassium Channel, I(Kr) (herg) (h) -6.44% Sodium, Site % Second Messengers Nitric Oxide, NOS (Neuronal-Binding) % Prostaglandins Leukotriene, LTB4 (BLT) 7.56% Leukotriene, LTD4 (CysLT1) % Thromboxane A2 (h) 11.30% Growth Factors/Hormones Corticotropin Releasing Factor, Non-selective 10.67% Oxytocin 5.41% Platelet Activating Factor, PAF 13.75% Thyrotropin Releasing Hormone, TRH 14.11% Brain/Gut Peptides Angiotensin II, AT1 (h) 22.25% Angiotensin II, AT % Bradykinin, BK % Chloecystokinin, CCK1 (CCKA) % Chloecystokinin, CCK2 (CCKB) 4.17% Endothelin, ET-A (h) -2.53% Endothelin, ET-B (h) 21.03% Galanin, Non-Selective -2.38% Neurokinin, NK1 8.40% Neurokinin, NK2 (NKA) (h) 23.17% Neurokinin, NK3 (NKB) -6.89% Vasoactive Intestinal Peptide, Non-selective 18.80% Vasopressin % Enzymes Decarbosylase, Glutamic Acid % 2
3 Receptor Percent Inhibition 10 µm Esterase, Acetylcholine 9.27% Oxidase, MAO-A, Peripheral % Oxidase, MAO-B, Peripheral -3.95% Transferase, Choline Acetyl 7.43% ADME-Tox Metbolism, Cytochrome P450, CYP1A2 (h) 68.51% Metabolism, Cytochrom P450, CYP2A6 (h) -0.76% Metabolism, Cytochrome P450, CYP2C19 (h) 21.49% Metabolism, Cytochrome P450, CYP2C9-1 (h) 28.48% Metabolism, Cytochrome P450, CYP2D6 (h) 1.72% Metabolism, Cytochrome P450, CYP2E1 (h) 2.11% Metabolism, Cytochrome P450, CYP3A4 (h) 9.16% 3
4 Supplementary Table 2. Kinome wide profiling results for LDN/OSU *A total of 230 kinases were tested. Only kinases with 10% inhibition at 10 µm are shown. 10%* Mean Percent Inhibition Kinase Conc. Tested (μm) LDN ABL1 1 2 ABL CK1-GAMMA3 1 5 CK1-GAMMA EPH-A1 1 7 EPH-A EPHA2 1 2 EPHA EPH-A4 1 5 EPH-A EPH-A5 1 7 EPH-A EPH-A8 1 1 EPH-A EPH-B1 1 4 EPH-B EPHB2 1 8 EPHB EPHB4 1 1 EPHB FGR 1 8 FGR FYN 1 14 FYN HCK 1 1 HCK KIT 1 14 KIT KIT-D816V 1 0 KIT-D816V LYNA 1 4 LYNA LYNB 1 4 4
5 LYNB MKNK1 1 3 MKNK MSK MSK PDGFR-ALPHA 1 5 PDGFR-ALPHA RET 1 14 RET 10 4 SPHK1 1-1 SPHK SPHK2 1 1 SPHK TEC 1 3 TEC TXK 1 2 TXK YES 1 3 YES
6 Supplementary Table 3. Kinome wide profiling list No. Kinase Kinase Name 1 ABL1 c-abl oncogene 1, non-receptor tyrosine kinase 2 ABL-T315I c-abl oncogene 1, non-receptor tyrosine kinase (mutant variant) 3 AKT1 v-akt murine thymoma viral oncogene homolog 1 4 AKT2 v-akt murine thymoma viral oncogene homolog 2 5 AKT3 v-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 6 ALK anaplastic lymphoma receptor tyrosine kinase 7 ALK4 activin A receptor, type IB 8 AMPKA1 (A1B1G1) protein kinase, AMP-activated, alpha 1 catalytic subunit 9 AMPKA2 (A2B1G1) protein kinase, AMP-activated, alpha 2 catalytic subunit 10 ARG v-abl Abelson murine leukemia viral oncogene homolog 2 11 ARK5 NUAK family, SNF1-like kinase, 1 12 AuroraA aurora kinase A 13 AuroraB aurora kinase B 14 AuroraC aurora kinase C 15 AXL AXL receptor tyrosine kinase 16 BLK B lymphoid tyrosine kinase 17 BMX BMX non-receptor tyrosine kinase 18 BRAF v-raf murine sarcoma viral oncogene homolog B1 19 BRK PTK6 protein tyrosine kinase 6 20 BRSK1 BR serine/threonine kinase 1 21 BRSK2 BR serine/threonine kinase 2 22 BTK Bruton agammaglobulinemia tyrosine kinase 23 CAMK1D calcium/calmodulin-dependent protein kinase ID 24 CAMK2A calcium/calmodulin-dependent protein kinase II alpha 25 CAMK2D calcium/calmodulin-dependent protein kinase II delta 26 CAMK4 calcium/calmodulin-dependent protein kinase IV 6
7 27 CDK1/cyclinB cyclin-dependent kinase 1 28 CDK2/cyclinA cyclin-dependent kinase 2 29 CDK2/cyclinE cyclin-dependent kinase 2 30 CDK3/cyclinE cyclin-dependent kinase 3 31 CDK4/cyclinD cyclin-dependent kinase 4 32 CDK5/p35 cyclin-dependent kinase 5 33 CDK6/cyclinD3 cyclin-dependent kinase 6 34 CHEK1 CHK1 checkpoint human homolog (S. pombe) 35 CHEK2 CHK2 checkpoint human homolog (S. pombe) 36 CK1a casein kinase 1, alpha 1 37 CK1g1 casein kinase 1, gamma 1 38 CK1g2 casein kinase 1, gamma 2 39 CK1g3 casein kinase 1, gamma 3 40 CK2 casein kinase 2, alpha 1 polypeptide 41 CLK2 CDC-like kinase 2 42 CLK3 CDC-like kinase 3 43 CRAF v-raf-1 murine leukemia viral oncogene homolog 1 44 CSK c-src tyrosine kinase 45 DAPK1 death-associated protein kinase 1 46 DCAMKL2 doublecortin-like kinase 2 47 DDR2 discoidin domain receptor tyrosine kinase 2 48 DYRK1A dual-specificity tyrosine-(y)-phosphorylation regulated kinase 1A 49 DYRK1B dual-specificity tyrosine-(y)-phosphorylation regulated kinase 1B 50 DYRK2 dual-specificity tyrosine-(y)-phosphorylation regulated kinase 2 51 DYRK3 dual-specificity tyrosine-(y)-phosphorylation regulated kinase 3 52 DYRK4 dual-specificity tyrosine-(y)-phosphorylation regulated kinase 4 53 EGFR epidermal growth factor receptor 54 EGFR-T790M epidermal growth factor receptor (mutant variant) 7
8 55 EPHA1 EPH receptor A1 56 EPHA2 EPH receptor A2 57 EPHA3 EPH receptor A3 58 EPHA4 EPH receptor A4 59 EPHA5 EPH receptor A5 60 EPHA8 EPH receptor A8 61 EPHB1 EPH receptor B1 62 EPHB2 EPH receptor B2 63 EPHB3 EPH receptor B3 64 EPHB4 EPH receptor B4 65 ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) 66 ERBB4 v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) 67 FER fer (fps/fes related) tyrosine kinase 68 FES feline sarcoma oncogene 69 FGFR1 fibroblast growth factor receptor 1 70 FGFR2 fibroblast growth factor receptor 2 71 FGFR3 fibroblast growth factor receptor 3 72 FGFR4 fibroblast growth factor receptor 4 73 FGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 74 FLT1 fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) 75 FLT3 fms-related tyrosine kinase 3 76 FLT4 fms-related tyrosine kinase 4 77 FMS colony stimulating factor 1 receptor 78 FYN FYN oncogene related to SRC, FGR, YES 79 GRK6 G protein-coupled receptor kinase 6 80 GRK7 G protein-coupled receptor kinase 7 81 GSK3A glycogen synthase kinase 3 alpha 82 GSK3B glycogen synthase kinase 3 beta 8
9 83 Haspin germ cell associated 2 (haspin) 84 HCK hemopoietic cell kinase 85 HIPK1 homeodomain interacting protein kinase 1 86 HIPK2 homeodomain interacting protein kinase 2 87 HIPK3 homeodomain interacting protein kinase 3 88 HIPK4 homeodomain interacting protein kinase 4 89 IGF1R insulin-like growth factor 1 receptor 90 IKKA conserved helix-loop-helix ubiquitous kinase 91 IKKB inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta 92 IKKE inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon 93 INSR insulin receptor 94 IRAK4 interleukin-1 receptor-associated kinase 4 95 IRR insulin receptor-related receptor 96 ITK IL2-inducible T-cell kinase 97 JAK1 Janus kinase 1 98 JAK2 Janus kinase 2 99 JAK3 Janus kinase JNK1 mitogen-activated protein kinase JNK2 mitogen-activated protein kinase JNK3 mitogen-activated protein kinase KDR kinase insert domain receptor (a type III receptor tyrosine kinase) 104 KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog 105 KIT-D816V v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (mutant variant) 106 LATS2 LATS, large tumor suppressor, homolog 2 (Drosophila) 107 LCK lymphocyte-specific protein tyrosine kinase 108 LOK serine/threonine kinase LRRK2 leucine-rich repeat kinase LTK leukocyte receptor tyrosine kinase 9
10 111 LYNA v-yes-1 Yamaguchi sarcoma viral related oncogene homolog, isoform A 112 LYNB v-yes-1 Yamaguchi sarcoma viral related oncogene homolog, isoform B 113 MAP4K2 mitogen-activated protein kinase kinase kinase kinase MAP4K4 mitogen-activated protein kinase kinase kinase kinase MAP4K5 mitogen-activated protein kinase kinase kinase kinase MAPK1 mitogen-activated protein kinase MAPK3 mitogen-activated protein kinase MAPKAPK2 mitogen-activated protein kinase-activated protein kinase MAPKAPK3 mitogen-activated protein kinase-activated protein kinase MARK1 MAP/microtubule affinity-regulating kinase MARK3 MAP/microtubule affinity-regulating kinase MARK4 MAP/microtubule affinity-regulating kinase MEK1 mitogen-activated protein kinase kinase MELK maternal embryonic leucine zipper kinase 125 MER c-mer proto-oncogene tyrosine kinase 126 MET met proto-oncogene (hepatocyte growth factor receptor) 127 MINK misshapen-like kinase MKNK1 MAP kinase interacting serine/threonine kinase MNK2 MAP kinase interacting serine/threonine kinase MRCKA CDC42 binding protein kinase alpha (DMPK-like) 131 MRCKB CDC42 binding protein kinase beta (DMPK-like) 132 MSK1 ribosomal protein S6 kinase, 90kDa, polypeptide MSK2 ribosomal protein S6 kinase, 90kDa, polypeptide MSSK1 SRSF protein kinase MST1 serine/threonine kinase MST2 serine/threonine kinase MST3 serine/threonine kinase MST4 MST3 and SOK1-Related Kinase 10
11 139 MUSK muscle, skeletal, receptor tyrosine kinase 140 NEK1 NIMA (never in mitosis gene a)-related kinase NEK2 NIMA (never in mitosis gene a)-related kinase NEK6 NIMA (never in mitosis gene a)-related kinase NEK7 NIMA (never in mitosis gene a)-related kinase NEK9 NIMA (never in mitosis gene a)- related kinase P38a mitogen-activated protein kinase P38b mitogen-activated protein kinase P38g mitogen-activated protein kinase P38d mitogen-activated protein kinase P70S6K1 ribosomal protein S6 kinase, 70kDa, polypeptide PAK1 p21 protein (Cdc42/Rac)-activated kinase PAK2 p21 protein (Cdc42/Rac)-activated kinase PAK3 p21 protein (Cdc42/Rac)-activated kinase PAK4 p21 protein (Cdc42/Rac)-activated kinase PAK5 p21 protein (Cdc42/Rac)-activated kinase PAK6 p21 protein (Cdc42/Rac)-activated kinase PAR1Ba MAP/microtubule affinity-regulating kinase PASK PAS domain containing serine/threonine kinase 158 PDGFRa platelet-derived growth factor receptor, alpha polypeptide 159 PDGFRa-D842V platelet-derived growth factor receptor, alpha polypeptide (mutant variant) 160 PDGFRb platelet-derived growth factor receptor, beta polypeptide 161 PDK1 pyruvate dehydrogenase kinase, isozyme PHKg1 phosphorylase kinase, gamma 1 (muscle) 163 PHKg2 phosphorylase kinase, gamma 2 (testis) 164 PI3Ka phosphoinositide-3-kinase, catalytic, alpha polypeptide 165 PI3Kd phosphoinositide-3-kinase, catalytic, delta polypeptide 166 PI4Kb phosphatidylinositol 4-kinase, catalytic, beta 11
12 167 PIM1 pim-1 oncogene 168 PIM2 pim-2 oncogene 169 PIM3 pim-3 oncogene 170 PKA protein kinase, camp-dependent, catalytic, alpha 171 PKCa protein kinase C, alpha 172 PKCb1 protein kinase C, beta 173 PKCb2 protein kinase C, beta 174 PKCg protein kinase C, gamma 175 PKCh protein kinase C, eta 176 PKCq protein kinase C, theta 177 PKCi protein kinase C, iota 178 PKN1 protein kinase N1 179 PKN2 protein kinase N2 180 PLK1 polo-like kinase PRAK mitogen-activated protein kinase-activated protein kinase PRKD1 protein kinase D1 183 PRKD2 protein kinase D2 184 PRKD3 protein kinase D3 185 PRKG1 protein kinase, cgmp-dependent, type I 186 PRKG2 protein kinase, cgmp-dependent, type II 187 PRKX protein kinase, X-linked 188 PTK5 fyn-related kinase 189 PYK2 PTK2B protein tyrosine kinase 2 beta 190 RET ret proto-oncogene 191 ROCK1 Rho-associated, coiled-coil containing protein kinase ROCK2 Rho-associated, coiled-coil containing protein kinase RON macrophage stimulating 1 receptor (c-met-related tyrosine kinase) 194 ROS c-ros oncogene 1, receptor tyrosine kinase 12
13 195 RSK1 ribosomal protein S6 kinase, 90kDa, polypeptide RSK2 ribosomal protein S6 kinase, 90kDa, polypeptide RSK3 ribosomal protein S6 kinase, 90kDa, polypeptide RSK4 ribosomal protein S6 kinase, 90kDa, polypeptide SGK1 serum/glucocorticoid regulated kinase SGK2 serum/glucocorticoid regulated kinase SGK3 serum/glucocorticoid regulated kinase family, member SNF1LK (SIK) salt-inducible kinase SNF1LK2 (QIK) salt-inducible kinase SPHK1 sphingosine kinase SPHK2 sphingosine kinase SRC v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) 207 SRMS src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites 208 SRPK1 SRSF protein kinase SRPK2 SRSF protein kinase SYK spleen tyrosine kinase 211 TAOK2 TAO kinase TAOK3 TAO kinase TBK1 TANK-binding kinase TEC tec protein tyrosine kinase 215 TIE2 TEK tyrosine kinase, endothelial 216 TNIK TRAF2 and NCK interacting kinase 217 TNK1 tyrosine kinase, non-receptor, TNK2 tyrosine kinase, non-receptor, TRKA neurotrophic tyrosine kinase, receptor, type TRKB neurotrophic tyrosine kinase, receptor, type TRKC neurotrophic tyrosine kinase, receptor, type TSSK1 testis-specific serine kinase 1B 13
14 223 TSSK2 testis-specific serine kinase TTK TTK protein kinase 225 TXK TXK tyrosine kinase 226 TYK2 tyrosine kinase TYRO3 TYRO3 protein tyrosine kinase 228 YES v-yes-1 Yamaguchi sarcoma viral oncogene homolog ZAP70 zeta-chain (TCR) associated protein kinase 70kDa 230 ZIPK death-associated protein kinase 3 14
15 Supplementary Figure 1 No toxicity was observed in the brain of mice after long-term treatment with LDN/OSU Wild-type mice received 40 mg/kg of compound daily for two months. Brains were harvested for cresyl violet staining, nuclear staining with Hoechst and immunostaining with GFAP and CD11b. No neuronal loss or glial activation was found. Six animals for each group were analyzed. Scale bar: 50 µm 15
16 Supplementary Figure 2 LDN/OSU , an inactive compound, does not provide protective effects in pilocarpineinduced status epilepticus mouse model. (A) Structure of LDN/OSU (B) LDN/OSU could not increase EAAT2 protein expression in PA-EAAT2 cells and mouse brains. (C-D) Hippocampal damage. Three sets of brains at 2 weeks post-se were analyzed with cresyl violet staining (15-20 sections/mouse). (C) Representative images of dentate hilus. Scale bar: 20 µm (D) Quantitative analysis of hilar cell quantity. LDN/OSU could not protect pilocarpine-induced neuronal death. *p<
2. Appendix Tables legend General Legend applicable for Table S1 to S4 (Page 10)
Appendix Data The hvps- signalling module counteracts inhibition of the PIK-Akt pathway to maintain mtorc activity and tumour growth Ruzica Bago, Eeva Sommer, Pau Castel, Claire Crafter, Fiona P. Bailey,
Supplementary Data Figure S1. A) PKI-587 suppression of p-akt in A498 and (+/- 10
Supplementary Data Figure S1. A) PKI-587 suppression of p-akt in A498 and 786-0 (+/- 10 μm Verapamil), and B) PKI-587 suppression of p-akt in BT474, & U87MG. 3 1 0.3 0.1 0.03 0 [μm] A) 786-0 - + p-akt
Mechanisms of resistance to JAK inhibitors. L. Knoops
Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the
Supplementary information. Supplementary Table 1. Kinase Type Format N Average (IC 50 )
Supplementary information Supplementary Table 1 Kinase Type Format N Average (IC 50 ) SD ALK Y Lantha 6 > 10 n.d. AURORA_A S/T Caliper 6 > 10 n.d. AXL Y Lantha 3 > 10 n.d. BTK Y Caliper 6 > 10 n.d. cabl
SUPPLEMENTAL DATA. Supplemental Experimental Procedures
SUPPLEMENTAL DATA An ATP-competitive mtor inhibitor reveals rapamycin-resistant functions of mtorc1 Carson C. Thoreen, Seong A. Kang, Jae Won Chang, Qingsong Liu, Jianming Zhang, Yi Gao, Laurie J. Reichling,
Overcoming Resistance to HER2 Inhibitors Through State-Specific Kinase Binding
Supplementary Information Overcoming Resistance to Inhibitors Through State-Specific Kinase Binding Chris J. Novotny 1, Sirkku Pollari 2, Jin H. Park 3, Mark A. Lemmon 3,4, Weijun Shen 2*, Kevan M. Shokat
Brigatinib overcomes ALK resistance mechanisms preclinically Zhang et al Supplementary information
Supplementary information The potent ALK inhibitor brigatinib (AP26113) overcomes mechanisms of resistance to first- and second-generation ALK inhibitors in preclinical models Sen Zhang, Rana Anjum, Rachel
SUPPLEMENTAL TABLES. Spectrum and Degree of CDK Drug Interactions Predicts Clinical Performance
SUPPLEMENTAL TABLES Spectrum and Degree of CDK Drug Interactions Predicts Clinical Performance Ping Chen 1, Nathan V. Lee 2, Wenyue Hu 3, Meirong Xu 2, Rose Ann Ferre 1, Hieu Lam 2, Simon Bergqvist 2,
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm)
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm) Class I Class II HDAC1 HDAC2 HDAC3 HDAC8 HDAC4 HDAC5 HDAC6 HDAC7 HDAC9 HDAC10 4.5 12.6 9.1 79.8 13.2 11.4
Supplemental text file, including:
Supplemental text file, including: Supplemental Table S1: Kinase profile for XL147 Supplemental Table S2: Effects of XL147 on PI3K Pathway Signaling in MCF7 and PC-3 Cells Supplemental Table S3: XL147
Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and
Supplementary Material for Pacholec, M. et al. manuscript SRT1720, SRT2183, SRT1460, and resveratrol are not direct activators of SIRT1 Supplementary Figure Legends Figure S1. Determination of SIRT1 K
Supplementary information
Supplementary information Pyk2 activates the NLRP3 inflammasome by directly phosphorylating ASC and contributes to inflammasome-dependent peritonitis I-Che Chung 1, Chun-Nan OuYang 1, Sheng-Ning Yuan 1,
Supplementary Materials for
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 217 Supplementary Materials for Chemical genomic analysis of GPR35 signaling Heidi (Haibei)
2,4,6-Triaminopyrimidine as a Novel Hinge Binder in a Series of PI3Kδ Selective Inhibitors
SUPPORTING INFORMATION 2,4,6-Triaminopyrimidine as a Novel Hinge Binder in a Series of PI3Kδ Selective Inhibitors Leena Patel,* Jayaraman Chandrasekhar, Jerry Evarts, Aaron C. Haran, Carmen Ip, Joshua
Supporting Information
Supporting Information Bommi-Reddy et al. 10.1073/pnas.0806574105 Fig. S1. Reintroducing wild-type pvhl in VHL / cells does not affect cell growth in vitro.(a) Immunoblot analysis of 786-O and RCC4 VHL
Biomarkers for Hypothesis Testing
Biomarkers for Hypothesis Testing Definition for Drug Development: Biomarker = Any Measure of a Drug Action Proximal to a Clinical Effect Biochemical (PET, MRS & CSF* for CNS drugs) Physiological EEG,
Content Prioritization And Content Entry and Quality Control Process
Content Prioritization And Content Entry and Quality Control Process The process of data capture begins with the definition of the content module or sub-module to be built (see figure 1). Broadly we define
Supporting Information. Mitigation of Acetylcholine Esterase Activity in the 1,7-Diazacarbazole Series
Supporting Information Mitigation of Acetylcholine Esterase Activity in the 1,7-Diazacarbazole Series of Inhibitors of Checkpoint Kinase 1 Lewis Gazzard, a,* Karen Williams, g Huifen Chen, a Lorraine Axford,
SUPPLEMENTARY INFORMATION
Supplementary table 1. Inherited kinasopathies and their germline kinase mutation according to organ system involvement System-based disorders Disease name MOI Disease OMIM Gene name Symbol Locus Gene
esirna ID Gene Name Gene Description Ensembl ID
esirna ID Gene Name Gene Description Ensembl ID HU-08403-1 AAK1 AP2 associated kinase 1 ENSG00000115977 HU-15023-1 AATK apoptosis-associated tyrosine kinase ENSG00000181409 HU-07626-1 ABCC1 ATP-binding
50 nmoles substrate. 8,000 Test Points based on 100 nm in reaction
Product Insert IMAP Substrates About the IMAP Substrates To facilitate the customization of the IMAP assay to fit your specific needs, Molecular Devices offers a wide range of validated substrates and
Staurosporine Tethered Peptide Ligands for camp-dependent Protein Kinase A (PKA): Optimization and Selectivity Profiling
Staurosporine Tethered Peptide Ligands for camp-dependent Protein Kinase A (PKA): Optimization and Selectivity Profiling Carolyn D. Shomin, Scott C. Meyer and Indraneel Ghosh* Supplementary Information
Receptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
Signaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
The Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
YoungSik Cho, Sreerupa Challa, David Moquin, Ryan Genga, Tathagat Dutta Ray, Melissa Guildford, and Francis Ka-Ming Chan
Supplemental Data Phosphorylation-Driven Assembly of the RIP1-RIP3 Complex Regulates Programmed Necrosis and Virus-Induced Inflammation YoungSik Cho, Sreerupa Challa, David Moquin, Ryan Genga, Tathagat
Cell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
Signal transduction and protein kinase inhibitors. Feng Qian ( 钱峰 )
Signal transduction and protein kinase inhibitors Feng Qian ( 钱峰 ) fengqian@sjtu.edu.cn Protein Kinases in the Human Genome 518 kinases 1.7 % of human genome Lipid kinases Nucleotide kinases Cell Signaling
Assay.GeneName Index Acc.no. Functional PIP5K1C; phosphatidylinositol-4-phosphate 5-kinase; type I; gamma 1 NM_012398
Assay.GeneName Index Acc.no. Functional PIP5K1C; phosphatidylinositol-4-phosphate 5-kinase; type I; gamma 1 NM_012398 1-phosphatidylinositol-4-phosphate 5-kinase activit IRAK2; interleukin-1 receptor-associated
Investigations of helminth kinomes - from understanding parasite biology to drug discovery. Andreas J. Stroehlein
Investigations of helminth kinomes - from understanding parasite biology to drug discovery Andreas J. Stroehlein BSc Bioinformatics The Pan-Proteome of the Bacterial Pathogens Causing Bovine Respiratory
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Biomathematical and Biomechanical Modeling of the Circulatory and Ventilatory Systems
Biomathematical and Biomechanical Modeling of the Circulatory and Ventilatory Systems Volume 4 For further volumes: http://www.springer.com/series/10155 Marc Thiriet Intracellular Signaling Mediators in
Supplemental Materials
Irreversible inhibition of BTK kinase by a novel highly selective inhibitor CHMFL-BTK- 11 suppresses inflammatory response in rheumatoid arthritis model Hong Wu 1,2,7, Qiong Huang 3,7, Ziping Qi 1,7, Yongfei
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary
Cellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
MBG301. Class IV. Classification of GPCRs according to their effector function (according to Lodish)
MBG301 Class IV Classification of GPCRs according to their effector function (according to Lodish) 1. Adenylcyclase activation by GPCRs 2. Ion channel regulation by GPCRs 3. Phospholipase C (PLC) activation
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells
Developing a clinically feasible personalized medicine approach to pediatric
Developing a clinically feasible personalized medicine approach to pediatric septic shock Hector R. Wong, Natalie Z. Cvijanovich, Nick Anas, Geoffrey L. Allen, Neal J. Thomas, Michael T. Bigham, Scott
Cell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
Principles of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
Revision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
a. Tyrosine kinases AA STK18 serine/threonine kinase 18
AA73873 STK8 serine/threonine kinase 8 a. Tyrosine kinases < Brain, frontal cortex 7 Brain, frontal cortex 73 Brain, frontal cortex 7 Brain, temporal cortex 73 Brain, temporal cortex 7 Brain, occipital
Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes
Oncogenes and Proto-oncogenes Jekyll and Hyde A double edged sword Origin of oncogenes? Oncogene hypothesis Retroviral oncogenes and cell proto-oncogenes (v-onc) (c-onc) The role of c-onc in cancer How
Supporting Information. Discovery of. 2-(2-Oxo-1-Phenyl-5-Pyridin-2-yl-1,2-Dihydropyridin-3-yl)Benzonitrile. (Perampanel): A Novel, Noncompetitive
Supporting Information Discovery of 2-(2-Oxo-1-Phenyl-5-Pyridin-2-yl-1,2-Dihydropyridin-3-yl)Benzonitrile (Perampanel): A Novel, Noncompetitive α-amino-3-hydroxy-5-methyl-4-isoxazolepropanoic Acid (AMPA)
Receptors Families. Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia
Receptors Families Assistant Prof. Dr. Najlaa Saadi PhD Pharmacology Faculty of Pharmacy University of Philadelphia Receptor Families 1. Ligand-gated ion channels 2. G protein coupled receptors 3. Enzyme-linked
Section: Chapter 5: Multiple Choice. 1. The structure of synapses is best viewed with a(n):
Section: Chapter 5: Multiple Choice 1. The structure of synapses is best viewed with a(n): p.155 electron microscope. light microscope. confocal microscope. nissle-stained microscopic procedure. 2. Electron
Regulation of cell function by intracellular signaling
Regulation of cell function by intracellular signaling Objectives: Regulation principle Allosteric and covalent mechanisms, Popular second messengers, Protein kinases, Kinase cascade and interaction. regulation
Introduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 2 Questions of the Day: How does the hormone insulin trigger the uptake of glucose in the cells that it targets. Introduction! Signal transduction
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
MAPK Pathway
MAPK Pathway Mitogen-activated protein kinases (MAPK) are proteins that are serine/ threonine specific kinases which are activated by a wide range of stimuli including proinflammatory cytokines, growth
BL 424 Chapter 15: Cell Signaling; Signal Transduction
BL 424 Chapter 15: Cell Signaling; Signal Transduction All cells receive and respond to signals from their environments. The behavior of each individual cell in multicellular plants and animals must be
INTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs).
RayBio Phosphorylation Antibody Array I For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs). User Manual (Revised Jul 25, 2007) (Cat# AAH-PRTK-1-2;
Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
Howard Temin. Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase.
Howard Temin Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase Nobel prize 1975 Figure 3.6 The Biology of Cancer ( Garland Science 2007)
Executive Summary. Reproduction prohibited v
Kinases are a large family of proteins that have now become firmly established as a major class of drug targets for the pharmaceutical industry. The sequencing of the Human Genome has led to the identification
11/8/16. Cell Signaling Mechanisms. Dr. Abercrombie 11/8/2016. Principal Parts of Neurons A Signal Processing Computer
Cell Signaling Mechanisms Dr. Abercrombie 11/8/2016 Principal Parts of Neurons A Signal Processing Computer A Multitude of Synapses and Synaptic Actions Summation/Synaptic Integration 1 The Synapse Signal
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
Genetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
DMSO GNF7156 GNF4877 DA/ U Ed/ nilusni M o u s e b e t a c e l l p r o li f e r a t i o n GNF4877 G N F G N F Ki6 e 3
GNF4877 Vehicle % E d u + In s + c e lls Insulin/ Ki67 Insulin/EdU/DAPI a b DMSO GNF7156 GNF4877 c d M o u s e b e ta c e ll p r o life r a tio n e GNF4877 4 3 G N F 7 1 5 6 C h iro n 9 9 2 1 2 Insulin/Ki67
Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
I. Top scoring maps. 1.IFN gamma signaling
I. Top scoring maps 1.IFN gamma signaling Interferon-gamma signaling Interferons (IFNs) are pleiotropic cytokines that mediate anti-viral responses, inhibit proliferation and participate in immune surveillance
Enzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
SUPPLEMENTARY INFORMATION
Supplementary Information S3 TAM- family small molecule kinase inhibitors in development Compound Indication(s) Target Profile Develop Primary Target MERTK TYRO3 Other targets ment Phase Refs Cabozantinib
Neurotransmitter Systems II Receptors. Reading: BCP Chapter 6
Neurotransmitter Systems II Receptors Reading: BCP Chapter 6 Neurotransmitter Systems Normal function of the human brain requires an orderly set of chemical reactions. Some of the most important chemical
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
Vets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system
Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds
Growth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of
Preface IMMUNORECEPTOR SIGNALING AS ATOPIC OF RESEARCH has a history of about 30 years. Though the effects of plant lectins on lymphocyte activation were studied back in the 1960s, the modern era began
Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
Identification of 4-phenylquinolin-2(1H)-one as a specific allosteric inhibitor of Akt
Supporting Information Identification of 4-phenylquinolin-2(1H)-one as a specific allosteric inhibitor of Akt Bill X. Huang 1, Kenny Newcomer 1, Karl Kevala 1, Elena Barnaeva 2, Wei Zheng 2, Xin Hu 2,
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
Overcoming EGFR T790M and C797S resistance with mutantselective allosteric inhibitors
Overcoming EGFR T790M and C797S resistance with mutantselective allosteric inhibitors The Harvard community has made this article openly available. Please share how this access benefits you. Your story
IUPHAR Nomenclature Report: The Class Frizzled
supplemental material IUPHAR Nomenclature Report: The Class Frizzled receptors Gunnar Schulte Section of Receptor Biology & Signaling, Dept. Physiology & Pharmacology, Karolinska Institutet, S-171 77 Stockholm,
Cellular Physiology (PHSI3009) Contents:
Cellular Physiology (PHSI3009) Contents: Cell membranes and communication 2 nd messenger systems G-coupled protein signalling Calcium signalling Small G-protein signalling o RAS o MAPK o PI3K RHO GTPases
Signal Transduction: Information Metabolism. Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire
Signal Transduction: Information Metabolism Chem 454: Regulatory Mechanisms in Biochemistry University of Wisconsin-Eau Claire Introduction Information Metabolism How cells receive, process and respond
G-Protein Coupled Receptors GPCRs. GPCRs
2 type of ligands 1 G-Protein Coupled Receptors GPCRs One of the largest protein families: > 1000 type of GPCRs in mammals >3% of the human genes Major drug targets: ~ 60 % of approved drugs interact with
Lecture: CHAPTER 13 Signal Transduction Pathways
Lecture: 10 17 2016 CHAPTER 13 Signal Transduction Pathways Chapter 13 Outline Signal transduction cascades have many components in common: 1. Release of a primary message as a response to a physiological
NanoBRET: A Quantitative Technique to Measure Kinase Target Engagement in Live Cells Matthew Robers
anobret: A Quantitative Technique to Measure Kinase Target Engagement in Live Cells Matthew Robers Sr. Research Scientist & Group Leader Premise: Targets may behave differently in cells than in isolation
Chapter 11: Inherited Disorders of Human Memory Mental Retardation Syndromes. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 11: Inherited Disorders of Human Memory Mental Retardation Syndromes From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 11: Mental Retardation Syndromes Table I: Mouse
How to compute a semantic similarity threshold. Charles Bettembourg, Christian Diot, Olivier Dameron
How to compute a semantic similarity threshold Charles Bettembourg, Christian Diot, Olivier Dameron Abstract The analysis of gene annotations related to Gene Ontology plays an important role in the interpretation
- Biosignaling: Signal transduction. References: chapter 8 of Lippincots chapter 1 3 of Lehningers
Basic concepts of Metabolism Metabolism and metabolic pathway Metabolic Map Catabolism Anabolism - Regulation of Metabolism Signals from within the cell (Intracellular) Communication between cells. - Biosignaling:
Signal Transduction I
Signal Transduction I Prof. Tianhua Zhou Department of Cell Biology Zhejiang University School of Medicine Office hours by appointment tzhou@zju.edu.cn Signal transduction: Key contents for signal transduction:
Basics of Pharmacology
Basics of Pharmacology Pekka Rauhala Transmed 2013 What is pharmacology? Pharmacology may be defined as the study of the effects of drugs on the function of living systems Pharmacodynamics The mechanism(s)
Lecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
Signal-Transduction Cascades - 2. The Phosphoinositide Cascade
Signal-Transduction Cascades - 2 The Phosphoinositide Cascade Calcium ion as a second messenger Tyrosine kinase and receptor dimerization scribd.com Faisal Khatib JU The Phosphoinositide Cascade Used by
2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
SUPPORTING INFORMATION
SUPPORTING INFORMATION Discovery and Preclinical Characterization of 6-Chloro-5-[4-(1- hydroxycyclobutyl)phenyl]-1h-indole-3-carboxylic Acid (PF-06409577), a Direct Activator of Adenosine Monophosphate-activated
Psych 181: Dr. Anagnostaras
Psych 181: Dr. Anagnostaras Lecture 5 Synaptic Transmission Introduction to synaptic transmission Synapses (Gk., to clasp or join) Site of action of most psychoactive drugs 6.5 1 Synapses Know basic terminology:
The elements of G protein-coupled receptor systems
The elements of G protein-coupled receptor systems Prostaglandines Sphingosine 1-phosphate a receptor that contains 7 membrane-spanning domains a coupled trimeric G protein which functions as a switch
Sarah Jaar Marah Al-Darawsheh
22 Sarah Jaar Marah Al-Darawsheh Faisal Mohammad Receptors can be membrane proteins (for water-soluble hormones/ligands) or intracellular (found in the cytosol or nucleus and bind to DNA, for lipid-soluble
Kinases 1. Kinase Inhibitors 13. Kinase Inhibitor Sets 21. Kinase Substrates 22. Kinase Activators 24. Phosphatases 26. Phosphatase Inhibitors 26
Table of contents Kinases 1 Kinase Inhibitors 13 Kinase Inhibitor Sets 21 Kinase Substrates 22 Kinase Activators 24 Phosphatases 26 Phosphatase Inhibitors 26 Cytokines 27 Antibodies 28 Research Sets 28
Neuron types and Neurotransmitters
Neuron types and Neurotransmitters Faisal I. Mohammed. PhD, MD University of Jordan 1 Transmission of Receptor Information to the Brain the larger the nerve fiber diameter the faster the rate of transmission
Chem Lecture 10 Signal Transduction
Chem 452 - Lecture 10 Signal Transduction 111130 Here we look at the movement of a signal from the outside of a cell to its inside, where it elicits changes within the cell. These changes are usually mediated
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Receptors and Drug Action. Dr. Subasini Pharmacology Department Ishik University, Erbil
Receptors and Drug Action Dr. Subasini Pharmacology Department Ishik University, Erbil Receptors and Drug Action Receptor Receptor is defined as a macromolecule or binding site located on the surface or
Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_ KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK
Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_014911.2 KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK NM_001080395.2 AATYK, AATYK1, KIAA0641, LMR1, LMTK1, p35bp apoptosis-associated
Effects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
Protein kinases are enzymes that add a phosphate group to proteins according to the. ATP + protein OH > Protein OPO 3 + ADP
Protein kinase Protein kinases are enzymes that add a phosphate group to proteins according to the following equation: 2 ATP + protein OH > Protein OPO 3 + ADP ATP represents adenosine trisphosphate, ADP