Supplementary Materials for
|
|
|
- Beatrix Hancock
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 217 Supplementary Materials for Chemical genomic analysis of GPR35 signaling Heidi (Haibei) Hu a,, Huayun Deng a, Shizhang Ling a,, Haiyan Sun a,, Terry Kenakin b, Xinmiao Liang c, Ye Fang a,* a Biochemical Technologies, Science and Technology Division, Corning Incorporated, Corning, NY 14831, USA b Department of Pharmacology, University of North Carolina School of Medicine, Chapel Hill, NC 27599, USA c Key Laboratory of Separation Science for Analytical Chemistry, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian, Liaoning, China Current address: Medical Laboratory Science, Jefferson College of Health Science, Roanoke, VA 2413, USA Current address: Department of Medicine, Johns Hopkins University, Baltimore, MD, USA Current address: Laboratory for Inflammation and Cancer, Biodesign Institute, Arizona State University, Tempe, Arizona * Correspondence to: fangy2@corning.com 1
2 This PDF file includes: Fig. S1. Intra-plate data normalization for shrna hit identification. Fig. S2. Characterization of GPR35 signaling pathway in HT-29 cells. Fig. S3. Pathway deconvolution of the DMR of zaprinast. Fig. S4. Impact of different compounds on the EGFR tyrosine kinase activity. Fig. S5. Effects of GPR35 agonist-treatment on HIF-1α protein levels in serum starved HT-29 cells under normoxic condition. Fig. S6. Kinase network for resulting in resensitization of cells. Table S1. Excel data summarizing DNA microarray data and genes that gave rise to intensity greater RFU under at least one treatment condition and displayed at least two fold changes in expression level. Table S2. The gene names, shrna clones, and robust z-scores for the kinase hits identified for the early (1 min post stimulation) and late (5 min) events of the YE21 DMR. Table S3. The gene names, shrna clones, and robust z-scores for a small set of kinase hits identified, where at least two shrnas for the specific kinase altered the YE21 DMR by 2 MAD (median absolute deviation), but with opposite directions. 2
3 a b - RNAi d RNAi Robust Z-score (late DMR) Robust Z-score (early DMR) - RNAi c RNAi Fig. S1. Intra-plate data normalization for shrna hit identification. (a,b) The DMR amplitude, as indicated by response in picometer,, at 1 min (a) or 5 min (b) post stimulation with YE21 as a function of shrna treatment. (c,d) The robust zscore, a z-score not adversely affected by outliers, was calculated using [(experimental data median) / median absolute deviation (MAD)] and plotted as a function of each shrna treatment, based on the DMR amplitude at 1 min (c) or 5 min (d) post stimulation with YE21. Here, an intra-plate normalization approach was applied (see Methods). 3
4 a 4 3 camp (nm) 2 1 b -1 4 Control Forskolin YE21 Zaprinast Pamoic acid 3 camp (nm) 2 1 c Fold increase (Fluo Control FSK YE21 + FSK ZAP + FSK PA + FSK Carbachol 1. DMSO YE21.5 Zaprinast. Pamoic acid 5 15 Time (sec) Fig.S2 Characterization of GPR35 signaling pathway in HT-29 cells. (a) camp concentration as a function of compounds, each at 2 M. Cells were stimulated with each compound at 2 µm for 3 min. (b) camp concentration as a function of compounds. Cells were stimulated for 3 min with.5 M forskolin (FSK) in the absence or presence of a GPR35 agonist, each at 2 µm. (c) Fluo-4 Direct calcium assay signals, real-time fluorescence emission ratios, of three GPR35 agonists as well as carbachol, each at 1 M. Carbachol is an agonist for the endogenous G q -coupled muscarinic M3 receptor in HT29, and used as the positive control. The data represent mean standard deviation of 4 replicates for (a to c). These results suggest that three agonists tested, pamoic acid (PA), YE21, and zaprinast (ZAP), all were inactive in increasing camp (a), decreasing the forskolin-elevated camp (b), or causing Ca 2+ mobilization (c). 4
5 a b c d 5 Control PTx Control Forskolin e f g h Control NSC Control CTx Control Y Mock - ROCK2 RNAi Control Gq inhibitor Control U Fig. S3 Pathway deconvolution of the DMR of zaprinast. (a-h) The DMR of zaprinast in HT29 cells without (Control) or with pretreatment by ng/ml pertussis toxin (PTx) (a); ng/ml cholera toxin (CTx) (b); 1 µm forskolin (c); 1 µm FR9359 (G q inhibitor) (d); 25µM NSC23766 (e); 1 µm Y27632 (f); one ROCK2 sirna (g); 1 µm U126 (h). In (a-h), data represents mean + standard deviation, N=4 (2 independent measurements, each in duplicate). The standard deviation is shown in gray. 5
6 Ratio of RFU at 52nm/495nm Negative control Positive control 1 um staurosporine 1uM gefitinib Compound YE21 Pamoic acid Zaprinast Fig. S4. Effects of different compounds on EGFR tyrosine kinase activity. All compounds were assayed at 25 µm, except for the two control compounds (staurosporine and Iressa) whose concentrations were indicated in the graph. Negative control: no EGFR kinase. Positive control: 5ng/ml EGFR plus.1µm the substrate as recommended by the supplier. Data are representative of three independent experiments. 6
7 HIF-1α β-actin Fig. S5. Effects of GPR35 agonist-treatment on HIF-1α protein levels in serum starved HT- 29 cells under normoxic condition. The concentrations of compounds were: 1 µm pamoic acid (PA), 1 µm zaprinast, 1 µm YE21, 1 µm ML145, 1 µm bortezomib (BO), or 1 µm deferoxamine mesylate (DFX). Both BO and DFX were used as the positive controls. Whole cell lysates were prepared at 5 hours post-treatment and HIF-1α protein levels were determined by immunoblotting. Sample integrity was confirmed by immunoblotting for the β-actin as a control. Data are representative of three independent experiments. 7
8 a b c Zaprinast CSNK2A1 PDGFRB PRKAA2 TSSK2 Buffer Zaprinast PSKH1 GRK1 MELK NEK6 Buffer Zaprinast MAP2K5 PDPK1 PIM2 WEE1 EIF2AK3 Buffer d e f Buffer TSSK2 PDGFRB CSNK2A1 PRKAA2 YE Buffer PSKH1 GRK1 MELK NEK6 YE Buffer MAP2K5 PDPK1 PIM2 WEE1 EIF2AK3 YE21 g Fig. S6. Kinase network for resulting in resensitization of cells. Here, the cells were treated with specific shrnas, followed by stimulation with 1 µm YE21 for 1 hour, and then 1 µm zaprinast for another hour. Hits were selected based on that after shrnai knockdown, cells gave rise to a DMR of YE21 comparable to the mock treated cells, but still responded to the subsequent stimulation with zaprinast. The network was generated using STRING 1. Connecting lines are color coded by the type of evidence used to build the network (details can be found in Unconnected hits were also listed. GO enrichment analysis suggests that cytoskeleton organization (GO term 71), and response to stress (GO term 695) played important roles in the resensitization. Among these kinases, seven of them (MAP2K5, MELK, EIF2AK3, NEK6, MAPKAPK3, TLK2, WEE1) are known to involve in cell response to stress. Furthermore, five kinases, including TSSK2, PSKH1, MAP2K5, TLK2, and NEK6, are known to associate with cytoskeleton, while three (TSSK2, PSKH1, NEK6) are linked to microtubule organizing center, three (TSSK2, PDPK1 and PDGFRB) are linked to cytoplasmic membrane-bounded vesicle. Although these results have not been validated yet, these findings suggest a possibility that these kinases, at least in part, are involved the cellular mechanisms for GPR35 desensitization and resensitization process. 8
9 Table S2. The gene names, shrna clones, and robust z-scores for the kinase hits identified for the early (1 min post stimulation) and late (5 min) events of the YE21 DMR. These hits were identified when at least two shrna clones for a single kinase within the library altered the YE21 DMR by 2 MAD (median absolute deviation); that is, a robust z- score of 2 or -2. Results showed that there were 99 kinases in total, among which 42 were specific to the early DMR, 26 specific to the late DMR, and 32 common to both events. For the early DMR, there were 46 kinases whose knockdown decreased the DMR, and 27 kinases whose knockdown potentiated the DMR. On the other hand, for the late DMR, there were 35 kinases whose knockdown decreased the DMR, and 23 whose knockdown potentiated the DMR. Gene name shrna clone Early DMR Robust z-score Late DMR robust z-score AAK1 AAK1 NM_14911.x-969s1c1 NM_ s1c ABL1 ABL1 ABL1 NM_5157.x-3369s1c1 NM_ s1c1 NM_ s1c ACVR1B ACVR1B NM_2328.x-783s1c1 NM_2328.x-48s1c AKT1 AKT1 NM_ s1c1 NM_5163.x-144s1c AKT3 AKT3 NM_ s1c1 NM_ s1c ALPK1 ALPK1 ALPK1 NM_ ,NM_ NM_ ,NM_ NM_ ,NM_ ATM ATM NM_ s1c1 NM_ s1c AURKB AURKB NM_4217.x-883s1c1 NM_4217.x-468s1c BCKDK BCKDK NM_5881.x-681s1c1 NM_5881.x-85s1c BLK BLK NM_ s1c1 NM_1715.x-261s1c1 BMPR1A BMPR1A NM_4329.x-88s1c1 NM_ s1c1-1.6 BMPR2 BMPR2 NM_124.x-1962s1c1 NM_124.x-488s1c BRD2 BRD2 BRD2 NM_ s1c1 NM_ s1c1 NM_ s1c BRDT NM_ s1c
10 1 BRDT BRDT NM_ s1c1 NM_ s1c BUB1B BUB1B NM_1211.x-3346s1c1 NM_1211.x-521s1c1-1. CAMK2A CAMK2A CAMK2A NM_ x-394s1c1 NM_ x-1181s1c1 NM_ x-1116s1c CAMK2B CAMK2B NM_122.x-2338s1c1 NM_122.x-1815s1c CAMK2G CAMK2G NM_1222.x-2251s1c1 NM_1222.x-279s1c CAMKK1 CAMKK1 NM_17227.x-1434s1c1 NM_17227.x-578s1c1 CAMKV CAMKV NM_2446.x-91s1c1 NM_2446.x-346s1c CDC2L1 CDC2L1 CDC2L1 CDC2L1 CDC2L1 NM_ s1c1 NM_ s1c1 NM_ s1c1 NM_ s1c1 NM_ s1c CDC2L6 CDC2L6 NM_1576.x-1837s1c1 NM_1576.x-639s1c CDK3 CDK3 NM_1258.x-197s1c1 NM_1258.x-618s1c CDK4 CDK4 NM_75.x-258s1c1 NM_ s1c CDK5 CDK5 CDK5 NM_ s1c1 NM_ s1c1 NM_ s1c CDK6 CDK6 NM_ s1c1 NM_ s1c CDK9 CDK9 NM_ s1c1 NM_ s1c CDKL1 CDKL1 NM_ s1c1 NM_ s1c CHEK1 CHEK1 NM_1274.x-58s1c1 NM_ s1c1 -. CLK1 CLK1 CLK1 NM_471.x-1435s1c1 NM_471.x-1746s1c1 NM_471.x-762s1c CLK4 CLK4 NM_2666.x-1413s1c1 NM_2666.x-661s1c CSNK1G1 CSNK1G2 NM_2248.x-1348s1c1 NM_ s1c DDR1 DDR1 NM_1954.x-1857s1c1 NM_1954.x-1358s1c
11 11 DYRK3 DYRK3 NM_3582.x-658s1c1 NM_ s1c DYRK4 DYRK4 NM_3845.x-1755s1c1 NM_ s1c EIF2AK2 EIF2AK2 NM_2759.x-474s1c1 NM_2759.x-149s1c EPHA3 EPHA3 EPHA3 EPHA3 NM_ s1c1 NM_ s1c1 NM_ s1c1 NM_ s1c EPHA5 EPHA5 NM_ s1c1 NM_ s1c EPHA7 EPHA7 NM_ s1c1 NM_ s1c ERBB3 ERBB3 NM_ s1c1 NM_ s1c FER FER NM_5246.x-1193s1c1 NM_5246.x-883s1c1.7.5 FES FES NM_5.x-1641s1c1 NM_5.x-1875s1c FGFR1 FGFR1 NM_64.x-2463s1c1 NM_ s1c GAK GAK NM_ s1c1 NM_5255.x-4s1c GRK7 GRK7 NM_13929.x-1781s1c1 NM_13929.x-1725s1c IGF1R IGF1R NM_ s1c1 NM_ s1c IRAK1 IRAK1 IRAK1 NM_1569.x-2188s1c1 NM_1569.x-149s1c1 NM_ s1c ITK ITK NM_ s1c1 NM_5546.x-614s1c JAK1 JAK1 JAK1 JAK1 NM_2227.x-849s1c1 NM_ s1c1 NM_ s1c1 NM_ s1c LIMK1 LIMK1 NM_2314.x-314s1c1 NM_ s1c MAP2K3 MAP2K3 NM_2756.x-136s1c1 NM_2756.x-826s1c1.7.8 MAP3K6 MAP3K6 MAP3K6 NM_4672.x-139s1c1 NM_4672.x-1283s1c1 NM_4672.x-832s1c MAP3K9 MAP3K9 NM_ s1c1 NM_ s1c
12 12 MAPK14 MAPK14 NM_1315.x-371s1c1 NM_13912.x-877s1c MARK4 MARK4 MARK4 MARK4 NM_ s1c1 NM_ s1c1 NM_ s1c1 NM_ s1c MELK MELK NM_ s1c1 NM_ s1c MET MET MET NM_ s1c1 NM_ s1c1 NM_ s1c MINK1 MINK1 NM_ s1c1 NM_ s1c1.5.6 MKNK1 MKNK1 NM_ s1c1 NM_ s1c MLKL MLKL MLKL NM_ s1c1 NM_ x-1935s1c1 NM_ s1c MST1R MST1R NM_2447.x-69s1c1 NM_ s1c NTRK2 NTRK2 NM_618.x-2123s1c1 NM_ s1c PAK4 PAK4 PAK4 PAK4 PAK4 NM_5884.x-193s1c1 NM_5884.x-285s1c1 NM_5884.x-154s1c1 NM_5884.x-463s1c1 NM_5884.x-1335s1c PDK2 PDK2 PDK2 NM_2611.x-834s1c1 NM_2611.x-158s1c1 NM_2611.x-83s1c PFTK1 PFTK1 PFTK1 NM_12395.x-416s1c1 NM_12395.x-1166s1c1 NM_12395.x-456s1c PHKG1 PHKG1 NM_ s1c1 NM_ s1c PIM1 PIM1 NM_ s1c1 NM_ s1c1 1.4 PLK4 PLK4 PLK4 PLK4 NM_14264.x-433s1c1 NM_ s1c1 NM_ s1c1 NM_ s1c PRKACB PRKACB PRKACB NM_ s1c1 NM_ s1c1 NM_2731.x-722s1c PRKCE PRKCE NM_5.x-591s1c1 NM_5.x-1288s1c
13 13 PRKCH PRKCH NM_ s1c1 NM_ s1c PRKDC PRKDC NM_ s1c1 NM_ s1c PTK2 PTK2 PTK2 PTK2 NM_ s1c1 NM_ s1c1 NM_567.x-2659s1c1 NM_ s1c RET RET RET NM_ s1c1 NM_ s1c1 NM_ s1c RIOK2 RIOK2 NM_ s1c1 NM_ s1c RIPK1 RIPK1 RIPK1 NM_384.x-147s1c1 NM_ s1c1 NM_ s1c ROCK2 ROCK2 ROCK2 NM_ s1c1 NM_ s1c1 NM_ s1c ROR2 ROR2 ROR2 ROR2 NM_456.x-3357s1c1 NM_ s1c1 NM_ s1c1 NM_456.x-1564s1c ROS1 ROS1 NM_2944.x-3659s1c1 NM_2944.x-294s1c RPS6KA5 RPS6KA5 NM_4755.x-677s1c1 NM_4755.x-336s1c1 -.1 RPS6KB1 RPS6KB1 NM_3161.x-151s1c1 NM_3161.x-1561s1c RYK RYK NM_2958.x-377s1c1 NM_2958.x-1526s1c SIK3 SIK3 NM_ s1c1 NM_ s1c STK11 STK11 NM_455.x-55s1c1 NM_455.x-548s1c STK24 STK24 STK24 NM_ s1c1 NM_ s1c1 NM_3576.x-66s1c STK32B STK32B NM_ s1c1 NM_ s1c STK4 STK4 NM_ s1c1 NM_ s1c STRADA STRADA NM_ s1c1 NM_ s1c STRADB STRADB NM_ s1c1 NM_ s1c
14 14 TGFBR1 TGFBR1 NM_ s1c1 NM_ s1c TNIK TNIK XM_ s1c1 XM_ s1c TSSK6 TSSK6 NM_ s1c1 NM_ s1c1.8.2 TWF2 TWF2 NM_ s1c1 NM_ s1c TXK TXK NM_ s1c1 NM_ s1c1-1.6 TYK2 TYK2 TYK2 NM_3331.x-329s1c1 NM_3331.x-533s1c1 NM_3331.x-478s1c ULK2 ULK2 NM_ s1c1 NM_ s1c UNK UNK UNK UNK XM_ s1c1 NM_16151.x-1186s1c1 NM_ s1c1 NM_ s1c YES1 YES1 YES1 NM_ s1c1 NM_ s1c1 NM_ s1c ZAP7 ZAP7 NM_179.x-182s1c1 NM_179.x-2393s1c
15 Table S3. The gene names, shrna clones, and robust z-scores for a small set of kinase hits identified, where at least two shrnas for the specific kinase altered the YE21 DMR by 2 MAD (median absolute deviation), but with opposite directions. There were 15 kinases in total. These kinases were excluded from the follow-up analysis. Gene name shrna clone Early DMR Robust z score ALPK2 NM_ s1c1 NM_ s1c1 2.9 AXL NM_21913.x-1881s1c1 NM_1699.x-1854s1c1 CDC2L2 NM_ s1c1-1. NM_ s1c1.6 CDC2L5 NM_3718.x-516s1c1-6.4 NM_3718.x-34s1c1 CDC42BPA NM_14826.x-1153s1c1-3.4 NM_635.x-537s1c1 CDK1 NM_ s1c1-8.5 NM_52987.x-186s1c1 3. CDKL3 NM_1658.x-1442s1c1-4.4 NM_1658.x-25s1c1 1.4 CSNK1E NM_ s1c1-3.8 NM_ x-895s1c1 1.5 EPHA1 NM_ s1c1-3.2 NM_ s1c1 FGFR3 NM_142.x-1972s1c1-5.5 NM_142.x-3699s1c1 3.8 MYLK4 XM_ s1c1-2. XM_ s1c1 PKN1 NM_2741.x-525s1c1-3.2 NM_2741.x-264s1c1 2. PTK6 NM_ s1c1 - NM_ s1c1 2.6 RPS6KB2 NM_ s1c1-4.8 NM_3952.x-44s1c1 2.6 TTK NM_ s1c1 - NM_ s1c1 Late DMR robust z score
16 Table S1 Excel data summarizing DNA microarray data and genes that gave rise to intensity greater RFU under at least one treatment condition and displayed at least two fold changes in expression level. 16
SUPPLEMENTAL DATA. Supplemental Experimental Procedures
SUPPLEMENTAL DATA An ATP-competitive mtor inhibitor reveals rapamycin-resistant functions of mtorc1 Carson C. Thoreen, Seong A. Kang, Jae Won Chang, Qingsong Liu, Jianming Zhang, Yi Gao, Laurie J. Reichling,
2,4,6-Triaminopyrimidine as a Novel Hinge Binder in a Series of PI3Kδ Selective Inhibitors
SUPPORTING INFORMATION 2,4,6-Triaminopyrimidine as a Novel Hinge Binder in a Series of PI3Kδ Selective Inhibitors Leena Patel,* Jayaraman Chandrasekhar, Jerry Evarts, Aaron C. Haran, Carmen Ip, Joshua
Loss of viability Z score threshold. Gene not essential
Gene essential Z score gene A BT20 BT474 CAL120 CAL51 CAMA1 HCC1143 HCC202 JIMT1 MCF7 MDAM134 MDAMB157 MDAMB231 MDAMB453 MDAMB468 SKBR3 SUM149 SUM44 T47D VP229 Loss of viability Z score threshold BT20
Brigatinib overcomes ALK resistance mechanisms preclinically Zhang et al Supplementary information
Supplementary information The potent ALK inhibitor brigatinib (AP26113) overcomes mechanisms of resistance to first- and second-generation ALK inhibitors in preclinical models Sen Zhang, Rana Anjum, Rachel
Supporting Information
Supporting Information Bommi-Reddy et al. 10.1073/pnas.0806574105 Fig. S1. Reintroducing wild-type pvhl in VHL / cells does not affect cell growth in vitro.(a) Immunoblot analysis of 786-O and RCC4 VHL
Staurosporine Tethered Peptide Ligands for camp-dependent Protein Kinase A (PKA): Optimization and Selectivity Profiling
Staurosporine Tethered Peptide Ligands for camp-dependent Protein Kinase A (PKA): Optimization and Selectivity Profiling Carolyn D. Shomin, Scott C. Meyer and Indraneel Ghosh* Supplementary Information
Supplemental Materials
Irreversible inhibition of BTK kinase by a novel highly selective inhibitor CHMFL-BTK- 11 suppresses inflammatory response in rheumatoid arthritis model Hong Wu 1,2,7, Qiong Huang 3,7, Ziping Qi 1,7, Yongfei
Supplementary Data Figure S1. A) PKI-587 suppression of p-akt in A498 and (+/- 10
Supplementary Data Figure S1. A) PKI-587 suppression of p-akt in A498 and 786-0 (+/- 10 μm Verapamil), and B) PKI-587 suppression of p-akt in BT474, & U87MG. 3 1 0.3 0.1 0.03 0 [μm] A) 786-0 - + p-akt
Identification of 4-phenylquinolin-2(1H)-one as a specific allosteric inhibitor of Akt
Supporting Information Identification of 4-phenylquinolin-2(1H)-one as a specific allosteric inhibitor of Akt Bill X. Huang 1, Kenny Newcomer 1, Karl Kevala 1, Elena Barnaeva 2, Wei Zheng 2, Xin Hu 2,
2. Appendix Tables legend General Legend applicable for Table S1 to S4 (Page 10)
Appendix Data The hvps- signalling module counteracts inhibition of the PIK-Akt pathway to maintain mtorc activity and tumour growth Ruzica Bago, Eeva Sommer, Pau Castel, Claire Crafter, Fiona P. Bailey,
Supplementary information. Supplementary Table 1. Kinase Type Format N Average (IC 50 )
Supplementary information Supplementary Table 1 Kinase Type Format N Average (IC 50 ) SD ALK Y Lantha 6 > 10 n.d. AURORA_A S/T Caliper 6 > 10 n.d. AXL Y Lantha 3 > 10 n.d. BTK Y Caliper 6 > 10 n.d. cabl
esirna ID Gene Name Gene Description Ensembl ID
esirna ID Gene Name Gene Description Ensembl ID HU-08403-1 AAK1 AP2 associated kinase 1 ENSG00000115977 HU-15023-1 AATK apoptosis-associated tyrosine kinase ENSG00000181409 HU-07626-1 ABCC1 ATP-binding
Overcoming Resistance to HER2 Inhibitors Through State-Specific Kinase Binding
Supplementary Information Overcoming Resistance to Inhibitors Through State-Specific Kinase Binding Chris J. Novotny 1, Sirkku Pollari 2, Jin H. Park 3, Mark A. Lemmon 3,4, Weijun Shen 2*, Kevan M. Shokat
SUPPLEMENTARY INFORMATION
Meta-Analysis Supplementary Fig.. Schematic of experimental design. Large scale shrna screens for proliferation/viability were performed in 9 cell lines using a library of 52 shrnas targeting 957 genes
Mechanisms of resistance to JAK inhibitors. L. Knoops
Mechanisms of resistance to JAK inhibitors L. Knoops 1 : Resistance to tyrosine kinase inhibition in cancer are related in sequence and structure. The main diagram illustrates the similarity between the
Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_ KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK
Gene Symbol Accession Alias/Prev Symbol Official Full Name AAK1 NM_014911.2 KIAA1048, DKFZp686K16132 AP2 associated kinase 1 (AAK1) AATK NM_001080395.2 AATYK, AATYK1, KIAA0641, LMR1, LMTK1, p35bp apoptosis-associated
Discovery of Orally Efficacious Phosphoinositide-3-Kinase delta Inhibitors with Improved
SUPPORTIG IFORMATIO Discovery of Orally Efficacious Phosphoinositide-3-Kinase delta Inhibitors with Improved Metabolic Stability Leena Patel,* Jayaraman Chandrasekhar, Jerry Evarts, Kristen Forseth, Aaron
Supplementary Table 1. In vitro side effect profiling study for LDN/OSU
Supplementary Table 1. In vitro side effect profiling study for LDN/OSU-0212320. Receptor Percent Inhibition 10 µm Neurotransmitter Related Adenosine, Non-selective 7.29% Adrenergic, Alpha 1, Non-selective
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/297/ra90/dc1 Supplementary Materials for Using Functional Signature ntology (FUSIN) to Identify Mechanisms of Action for Natural Products Malia B. Potts, Hyun
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.38/nature83 Supplementary figure An Overview of Experimental Flow Hypothesis: The tumor microenvironment has a significant impact on cancer cell chemoresistance. Screen Coculture
Analysis of Kinase Gene Expression Patterns across 5681 Human Tissue Samples Reveals Functional Genomic Taxonomy of the Kinome
https://helda.helsinki.fi Analysis of Kinase Gene Expression Patterns across 5681 Human Tissue Samples Reveals Functional Genomic Taxonomy of the Kinome Kilpinen, Sami 2010 Kilpinen, S, Ojala, K & Kallioniemi,
NanoBRET: A Quantitative Technique to Measure Kinase Target Engagement in Live Cells Matthew Robers
anobret: A Quantitative Technique to Measure Kinase Target Engagement in Live Cells Matthew Robers Sr. Research Scientist & Group Leader Premise: Targets may behave differently in cells than in isolation
Supporting Information. Mitigation of Acetylcholine Esterase Activity in the 1,7-Diazacarbazole Series
Supporting Information Mitigation of Acetylcholine Esterase Activity in the 1,7-Diazacarbazole Series of Inhibitors of Checkpoint Kinase 1 Lewis Gazzard, a,* Karen Williams, g Huifen Chen, a Lorraine Axford,
YoungSik Cho, Sreerupa Challa, David Moquin, Ryan Genga, Tathagat Dutta Ray, Melissa Guildford, and Francis Ka-Ming Chan
Supplemental Data Phosphorylation-Driven Assembly of the RIP1-RIP3 Complex Regulates Programmed Necrosis and Virus-Induced Inflammation YoungSik Cho, Sreerupa Challa, David Moquin, Ryan Genga, Tathagat
Cover Page. The handle holds various files of this Leiden University dissertation
Cover Page The handle http://hdl.handle.net/1887/36568 holds various files of this Leiden University dissertation Author: Scholten, Florine E.M. Title: Host factors involved in chikungunya virus replication
Supplementary information
Supplementary information Pyk2 activates the NLRP3 inflammasome by directly phosphorylating ASC and contributes to inflammasome-dependent peritonitis I-Che Chung 1, Chun-Nan OuYang 1, Sheng-Ning Yuan 1,
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.
Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue
Targeted Agent and Profiling Utilization Registry (TAPUR ) Study. February 2018
Targeted Agent and Profiling Utilization Registry (TAPUR ) Study February 2018 Precision Medicine Therapies designed to target the molecular alteration that aids cancer development 30 TARGET gene alterations
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm)
Supplemental Table S1: Inhibition of HDAC class I and class II family by CUDC-101 (IC50 in nm) Class I Class II HDAC1 HDAC2 HDAC3 HDAC8 HDAC4 HDAC5 HDAC6 HDAC7 HDAC9 HDAC10 4.5 12.6 9.1 79.8 13.2 11.4
SUPPLEMENTAL TABLES. Spectrum and Degree of CDK Drug Interactions Predicts Clinical Performance
SUPPLEMENTAL TABLES Spectrum and Degree of CDK Drug Interactions Predicts Clinical Performance Ping Chen 1, Nathan V. Lee 2, Wenyue Hu 3, Meirong Xu 2, Rose Ann Ferre 1, Hieu Lam 2, Simon Bergqvist 2,
Supplemental text file, including:
Supplemental text file, including: Supplemental Table S1: Kinase profile for XL147 Supplemental Table S2: Effects of XL147 on PI3K Pathway Signaling in MCF7 and PC-3 Cells Supplemental Table S3: XL147
Discovery of a Highly Potent and Selective Indenoindolone Type 1 pan-flt3 Inhibitor
Supporting Information Discovery of a Highly Potent and Selective Indenoindolone Type 1 pan-flt3 Inhibitor John M. Hatcher a,b,e, Ellen Weisberg c,e, Taebo Sim d, Richard M. Stone c, Suiyang Liu c, James
How to compute a semantic similarity threshold. Charles Bettembourg, Christian Diot, Olivier Dameron
How to compute a semantic similarity threshold Charles Bettembourg, Christian Diot, Olivier Dameron Abstract The analysis of gene annotations related to Gene Ontology plays an important role in the interpretation
Use of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway
Use of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway SUPPLEMENTAL DATA Characterization of the CAMYEL sensor and calculation of intracellular
IntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
a. Tyrosine kinases AA STK18 serine/threonine kinase 18
AA73873 STK8 serine/threonine kinase 8 a. Tyrosine kinases < Brain, frontal cortex 7 Brain, frontal cortex 73 Brain, frontal cortex 7 Brain, temporal cortex 73 Brain, temporal cortex 7 Brain, occipital
SUPPLEMENTARY INFORMATION
Supplementary Figure S1 Supplementary Figure S1. Expression of the PKA-inhibitor PKI does not prevent intracellular growth of Salmonella. MCF7 cells were transfected with an expression construct containing
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada?
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Alberto Ocana Albacete University Hospital Salamanca May 19th, 2016 WHAT IS PERSONALIZED MEDICINE? Molecular
Assay.GeneName Index Acc.no. Functional PIP5K1C; phosphatidylinositol-4-phosphate 5-kinase; type I; gamma 1 NM_012398
Assay.GeneName Index Acc.no. Functional PIP5K1C; phosphatidylinositol-4-phosphate 5-kinase; type I; gamma 1 NM_012398 1-phosphatidylinositol-4-phosphate 5-kinase activit IRAK2; interleukin-1 receptor-associated
For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs).
RayBio Phosphorylation Antibody Array I For Simultaneously Detecting the Relative Level of Tyrosine Phosphorylation of Human Receptor Tyrosine Kinases (RTKs). User Manual (Revised Jul 25, 2007) (Cat# AAH-PRTK-1-2;
Integrated proteomic analysis of post-translational modifications by serial enrichment
Supplementary Information: Integrated proteomic analysis of post-translational modifications by serial enrichment Philipp Mertins; Jana W Qiao; Jinal Patel; Namrata D Udeshi; Karl R Clauser; DR Mani; Michael
Targeting S-Adenosylmethionine biosynthesis with a novel allosteric inhibitor of Mat2A
Targeting S-Adenosylmethionine biosynthesis with a novel allosteric inhibitor of Mat2A Supplementary information Casey L. Quinlan* 1, Stephen E. Kaiser* 2, Ben Bolaños 2, Dawn Nowlin 1, Rita Grantner 1,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
Importance of calcium assay parameters in drug discovery
Actelion Pharmaceutical Allschwill Hamamatsu 10th FDSS User Meeting June 2014 Importance of calcium assay parameters in drug discovery Sabine Rouanet Dr. Isabelle Bertrand Directeur: Pr. Jean-Charles Schwartz
SUPPORTING INFORMATION
SUPPORTING INFORMATION Discovery and Preclinical Characterization of 6-Chloro-5-[4-(1- hydroxycyclobutyl)phenyl]-1h-indole-3-carboxylic Acid (PF-06409577), a Direct Activator of Adenosine Monophosphate-activated
Supporting Information
Supporting Information Discovery of Highly Isoform Selective rally Bioavailable Phosphoinositide-3-Kinase (PI3K)- Inhibitors. ils Pemberton,,* Mickael Mogemark,,* Susanne Arlbrandt, Peter Bold, Rhona J
Synaptotagmin mediated vesicle fusion regulates cell migration
Supplementary Information Synaptotagmin mediated vesicle fusion regulates cell migration Richard A. Colvin, Terry K. Means, Thomas J. Diefenbach, Luis F. Moita, Robert P. Friday, Sanja Sever, Gabriele
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/271/ra25/dc1 Supplementary Materials for Phosphoproteomic Analysis Implicates the mtorc2-foxo1 Axis in VEGF Signaling and Feedback Activation of Receptor Tyrosine
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42
Interleukin-6 promotes pancreatic cancer cell migration by rapidly activating the small GTPase CDC42 Gina L. Razidlo, Kevin M. Burton, and Mark A. McNiven SUPPORTING INFORMATION Figure S1. IL-6 promotes
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
SUPPLEMENTARY FIGURES AND TABLES
PD 0332991, a selective cyclin D kinase 4/6 inhibitor, sensitizes lung cancer cells to treatment with epidermal growth factor receptor tyrosine kinase inhibitors SUPPLEMENTARY FIGURES AND TABLES Supplementary
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
SUPPLEMENTARY INFORMATION
Supplementary table 1. Inherited kinasopathies and their germline kinase mutation according to organ system involvement System-based disorders Disease name MOI Disease OMIM Gene name Symbol Locus Gene
Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer
S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.
Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
DMSO GNF7156 GNF4877 DA/ U Ed/ nilusni M o u s e b e t a c e l l p r o li f e r a t i o n GNF4877 G N F G N F Ki6 e 3
GNF4877 Vehicle % E d u + In s + c e lls Insulin/ Ki67 Insulin/EdU/DAPI a b DMSO GNF7156 GNF4877 c d M o u s e b e ta c e ll p r o life r a tio n e GNF4877 4 3 G N F 7 1 5 6 C h iro n 9 9 2 1 2 Insulin/Ki67
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Protein Arrays High Throughput Protein Quantification from Total Cell Lysates
Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Supplemental Figures and Tables
Supplemental Figures and Tables Title: Functionally-defined Therapeutic Targets in Diffuse Intrinsic Pontine Glioma Authors: Catherine S. Grasso, Yujie Tang, Nathalene Truffaux, Noah E. Berlow, Lining
Supplementary Material. Part I: Sample Information. Part II: Pathway Information
Supplementary Material Part I: Sample Information Three NPC cell lines, CNE1, CNE2, and HK1 were treated with CYC202. Gene expression of 380 selected genes were collected at 0, 2, 4, 6, 12 and 24 hours
Validation & Assay Performance Summary
Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation
Supporting Information Discovery of a Selective Phosphoinositide 3- Kinase (PI3K)-γ Inhibitor (IPI-549) as an Immuno-Oncology Clinical Candidate
Supporting Information Discovery of a Selective Phosphoinositide 3- Kinase (PI3K)-γ Inhibitor (IPI-549) as an Immuno-Oncology Clinical Candidate Catherine A. Evans,* Tao Liu, André Lescarbeau, Somarajan
Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry
SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
Supplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral.
Supplemental Figure 1: Anti-GDF15 antibody blocks binding of GDF15 to hgfral. Anti-GDF15 antibody (mab26, a neutralizing monoclonal antibody to wtgdf15) blocks binding of GDF15 to human GFRAL in a dose-dependent
Optimization of a LanthaScreen Kinase assay for NTRK1 (TRKA)
Optimization of a LanthaScreen Kinase assay for NTRK1 (TRKA) Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development
EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
Supplementary Information. Targeting BRK-positive Breast Cancer with Small
Supplementary Information Targeting BRK-positive Breast Cancer with Small Molecule Kinase Inhibitors Jie Jiang 1#, Fu Gui 1#, Zhixiang He 1#, Li Li 1, Yunzhan Li 1, Shunying Li 2, Xinrui Wu 1, Zhou Deng
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
Targeting the Hsp90-Cdc37-client protein interaction to disrupt Hsp90 chaperone machinery
Li et al. Journal of Hematology & Oncology (2018) 11:59 https://doi.org/10.1186/s13045-018-0602-8 REVIEW Targeting the Hsp90-Cdc37-client protein interaction to disrupt Hsp90 chaperone machinery Ting Li
Supplementary Information
Supplementary Information An orally available, small-molecule interferon inhibits viral replication Hideyuki Konishi 1, Koichi Okamoto 1, Yusuke Ohmori 1, Hitoshi Yoshino 2, Hiroshi Ohmori 1, Motooki Ashihara
Improved Stability of the LANCE Ultra Signal in Kinase Assays
Improved Stability of the LANCE Ultra Signal in Kinase Assays LANCE Ultra is a high throughput screening (HTS) technology platform optimized for homogeneous time-resolved fluorescence resonance energy
Investigations of helminth kinomes - from understanding parasite biology to drug discovery. Andreas J. Stroehlein
Investigations of helminth kinomes - from understanding parasite biology to drug discovery Andreas J. Stroehlein BSc Bioinformatics The Pan-Proteome of the Bacterial Pathogens Causing Bovine Respiratory
underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa
SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell
F-actin VWF Vinculin. F-actin. Vinculin VWF
a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),
Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
Optimization of a LanthaScreen Kinase assay for ZAP70
Optimization of a LanthaScreen Kinase assay for ZAP70 Overview This protocol describes how to develop a LanthaScreen kinase assay designed to detect and characterize kinase inhibitors. The development
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
q 2017 by The University of Chicago. All rights reserved. DOI: /690105
q 2017 by The University of Chicago. All rights reserved. DOI: 10.1086/690105 Appendix from R. M. Cox et al., Hormonally Mediated Increases in Sex-Biased Gene Expression Accompany the Breakdown of Between-
SureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
Sample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%
Supplemental Table 1: Estimated tumor purity, allele frequency, and independent read depth for all gene mutations classified as either potentially pathogenic or VUS in the metatastic and primary tumor
Supplementary Materials
Supplementary Materials Supplementary Figure S1 Regulation of Ubl4A stability by its assembly partner A, The translation rate of Ubl4A is not affected in the absence of Bag6. Control, Bag6 and Ubl4A CRISPR
Content Prioritization And Content Entry and Quality Control Process
Content Prioritization And Content Entry and Quality Control Process The process of data capture begins with the definition of the content module or sub-module to be built (see figure 1). Broadly we define
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram
Nature Immunology: doi: /ni.3631
Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above
Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay