Legends for Supplemental Figures.

Size: px
Start display at page:

Download "Legends for Supplemental Figures."

Transcription

1 1 Legends for Supplemental Figures. Supplemental Figure 1. Proteasome Inhibition does not abrogate the expression of FA core complex proteins or formation of the FA core complex. (Full-length blots are presented in Supplemental Fig. 3L-N) (A) Simplified model of the FA pathway. Eight FA proteins (FANCA, B, C, E, F, G, L and M), FAAP24 and FAAP100 form a multi-subunit ubiquitin ligase complex (FA core complex). In response to DNA damage and during normal S phase progression, the FANCD2 protein is monoubiquitinated on lysine 561 in an FA core complex (E3 ubiquitin ligase)- and UBE2T (E2 ubiquitin conjugating enzyme)-dependent manner. ATR kinase is required for increase of FANCD2 monoubiquitination in response to DNA damage. Monoubiquitinated FANCD2 is targeted to nuclear foci where it colocalizes with γh2ax, ATR, RPA, the MRN complex, BRCA1, BRCA2, RAD51, PALB2, FANCJ and other proteins. BRCA1 is required for nuclear foci formation of FANCD2 in response to DNA damage. All of these factors are required for cellular resistance to DNA crosslinking agents. On the other hand, PCNA is monoubiquitinated on K164 by RAD6 and RAD18, and this monoubiquitination activates translesion synthesis. The deubiquitinating enzyme USP1 negatively regulates monoubiquitination of both FANCD2 and PCNA. (B) Treatment with proteasome inhibitors did not affect the expression of FA core complex proteins. HeLa cells were exposed to IR (15Gy) and incubated in the presence of MG132 (2µM) for the indicated time. Expression of FANCA, C, D2, F, and G was examined by western blotting. Asterisks (*) indicate non-specific bands.

2 2 (C) Expression of FA core complex proteins and UBE2T was not affected by treatment with proteasome inhibitors. HeLa cells were exposed to IR (15Gy) and incubated in the presence of MG132 (2µM) for 8 hours. Expression of FANCA, C, D2, E, F, G, M and UBE2T was examined by western blotting. (D) Treatment with proteasome inhibitors did not affect the formation of FA core complex. HeLa cells were exposed to IR (15Gy) and/or incubated in the presence of MG132 (2µM) for 8 hours. A FANCA antibody was used to isolate immunocomplexes from whole cell extracts. IP products were analyzed by western blotting using FANCA, C and G antibodies. FANCC and FANCG co-immunoprecipitated with FANCA in all conditions. Supplemental Figure 2. Analysis of ATR and ATM activation after DNA damage in the presence of proteasome inhibitors. (Full-length blots are presented in Supplemental Fig. 3O-Q) (A) Proteasome inhibition did not inhibit cisplatin-, HU- and UV-induced CHK1 phosphorylation, while it inhibited RPA2 phosphorylation and FANCD2 monoubiquitination. HeLa cells were incubated in cisplatin (CDDP 25µM) or hydroxyurea (1mM) for 24 hours, or exposed to UV radiations (50J/m2), and incubated in the presence of bortezomib for 8 hours. FANCD2, CHK1, CHK1-Ser345P and RPA2 immunoblots were performed using whole cell extracts. (B) Proteasome inhibition inhibits IR-induced CHK1 and RPA2 phosphorylations. HeLa cells were incubated in the presence of bortezomib (1µM) for 4 hours, irradiated (15Gy)

3 3 and incubated for the indicated time after irradiation. FANCD2, CHK1, CHK1-Ser345P and RPA2 immunoblots were performed using whole cell extracts. (C) Proteasome inhibition does not inhibit IR-induced phosphorylation of ATM substrates. HeLa cells were treated as described in (B). ATM-dependent phosphorylations of ATM Ser1981, NBS1 Ser343, CHK2 Thr68, and FANCD2 Thr691 in response to IR were analyzed by western blotting. Supplemental Figure 3. Non-cropped pictures of blots and gels. The Western-blot membranes were cut to allow multiple simultaneous hybridizations. (A-D) Non-cropped pictures of blots presented in Figure 1. (E and F) Non-cropped pictures of gels and blots presented in Figure 2. (G-J) Non-cropped pictures blots presented in Figure 3. (K) Non-cropped pictures of blot presented in Figure 6. (L-N) Non-cropped pictures of blot presented in Supplemental Figure 1. (O-Q) Non-cropped pictures of blot presented in Supplemental Figure 2. Material and Methods for Supplemental Figures Western blot analysis. Mouse monoclonal antibodies directed against ATM- Ser1981P ( , Rockland, 1/2000), CHK1 (G-4, Santa Cruz, 1/1000), RPA2 (Ab-2, Calbiochem, 1/1000), rabbit polyclonal antibodies against ATM (GTX17955, Genetex, Inc., 1/5000), phospho-chk1 (Ser345) (#2341, Cell Signaling, 1/500), CHK2 (07-057, Upstate, 1/1000), phospho-chk2 (Thr68) (#2661, Cell Signaling, 1/1000), FANCA (#7488, a gift of Dr. Maureen Hoatlin, 1/1000), FANCC ((1), 1/500), phosho-

4 4 FANCD2 (Thr691) ((2), 1/500), FANCE (gift of Drs. XiaoZhe Wang and Alan D Andrea, 1/2000), FANCF ((3), 1/1000), FANCG ((4), 1/1000), FANCM ((5), gift of Dr. Weidong Wang (National Institute on Aging), 1/2000), and UBE2T (BC004152, ProteinTech Group (Chicago, IL), 1/2000) were used as a primary antibodies. Immunoprecipitation. Using a polyclonal antibody to FANCA (#7488, gift from Dr. Maureen Hoatlin, Oregon Health and Science University), immunoprecipitation was performed as previously described (6). References for supplemental data 1. Yamashita T, Barber DL, Zhu Y, Wu N, D'Andrea AD. The Fanconi anemia polypeptide FACC is localized to the cytoplasm. Proc Natl Acad Sci U S A 1994; 91: Ho GP, Margossian S, Taniguchi T, D'Andrea AD. Phosphorylation of FANCD2 on two novel sites is required for mitomycin C resistance. Mol Cell Biol 2006; 26: Siddique MA, Nakanishi K, Taniguchi T, Grompe M, D'Andrea AD. Function of the Fanconi anemia pathway in Fanconi anemia complementation group F and D1 cells. Exp Hematol 2001; 29: Garcia-Higuera I, Kuang Y, Naf D, Wasik J, D'Andrea AD. Fanconi anemia proteins FANCA, FANCC, and FANCG/XRCC9 interact in a functional nuclear complex. Mol Cell Biol 1999; 19:

5 5 5. Meetei AR, Medhurst AL, Ling C, et al. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nat Genet 2005; 37: Taniguchi T, D'Andrea AD. The Fanconi Anemia Protein, FANCE, Promotes the Nuclear Accumulation of FANCC. Blood 2002; 100:

6

7

8

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

Cellular response to DNA interstrand crosslinks: the Fanconi anemia pathway

Cellular response to DNA interstrand crosslinks: the Fanconi anemia pathway Cell. Mol. Life Sci. (2016) 73:3097 3114 DOI 10.1007/s00018-016-2218-x Cellular and Molecular Life Sciences REVIEW Cellular response to DNA interstrand crosslinks: the Fanconi anemia pathway David Lopez-Martinez

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Molecular Mechanisms of Fanconi Anemia

Molecular Mechanisms of Fanconi Anemia MEDICAL INTELLIGENCE UNIT Molecular Mechanisms of Fanconi Anemia Shamim I. Ahmad, B.Sc, M.Sc, Ph.D. School of Biomedical and Natural Sciences Nottingham Trent University Nottingham, England, U.K. Sandra

More information

Prognostic value of DNA repair based stratification of hepatocellular carcinoma

Prognostic value of DNA repair based stratification of hepatocellular carcinoma Prognostic value of DNA repair based stratification of hepatocellular carcinoma Zhuo Lin 1, 2 #, Shi-Hao Xu 3 #, Hai-Qing Wang 4, Yi-Jing Cai 1, 2, Li Ying 3, Mei Song 1, 2, Yu-Qun Wang 1, 2, Shan-Jie

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1

More information

Non-specific chemical inhibition. the Fanconi anemia pathway sensitizes cancer cells to cisplatin.

Non-specific chemical inhibition. the Fanconi anemia pathway sensitizes cancer cells to cisplatin. Non-specific chemical inhibition of the Fanconi anemia pathway sensitizes cancer cells to cisplatin The Harvard community has made this article openly available. Please share how this access benefits you.

More information

The PTEN phosphatase functions cooperatively with the. Fanconi anemia proteins in DNA crosslink repair

The PTEN phosphatase functions cooperatively with the. Fanconi anemia proteins in DNA crosslink repair The PTEN phosphatase functions cooperatively with the Fanconi anemia proteins in DNA crosslink repair Elizabeth A. Vuono, 1 Ananda Mukherjee, 2 David A. Vierra, 1 Morganne M. Adroved, 1 Charlotte Hodson,

More information

RNF4-mediated polyubiquitination regulates the Fanconi anemia/brca pathway

RNF4-mediated polyubiquitination regulates the Fanconi anemia/brca pathway The Journal of Clinical Investigation Research article RNF4-mediated polyubiquitination regulates the Fanconi anemia/brca pathway Jenny Xie, 1 Hyungjin Kim, 1 Lisa A. Moreau, 1 Shannon Puhalla, 2 Judy

More information

Fanconi anemia pathway the way of DNA interstrand cross-link repair

Fanconi anemia pathway the way of DNA interstrand cross-link repair Department of Hematology, Central South University Third Xiangya Hospital 1 ; Department of Hematology, Central South University Xiangya Hospital 2, Changsha, China Fanconi anemia pathway the way of DNA

More information

The Fanconi anemia ID2 complex: Dueling saxes at the crossroads

The Fanconi anemia ID2 complex: Dueling saxes at the crossroads Cell Cycle ISSN: 1538-4101 (Print) 1551-4005 (Online) Journal homepage: http://www.tandfonline.com/loi/kccy20 The Fanconi anemia ID2 complex: Dueling saxes at the crossroads Rebecca A Boisvert & Niall

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Brian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology

Brian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology Brian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology Epithelial Ovarian Cancer - Standard Current Treatment: Surgery with De-bulking + Platinum-Taxane based Chemotherapy - No

More information

Human Papillomaviruses Activate the ATM DNA Damage Pathway for Viral Genome Amplification upon Differentiation

Human Papillomaviruses Activate the ATM DNA Damage Pathway for Viral Genome Amplification upon Differentiation Human Papillomaviruses Activate the ATM DNA Damage Pathway for Viral Genome Amplification upon Differentiation Cary A. Moody, Laimonis A. Laimins* Department of Microbiology and Immunology, Feinberg School

More information

Molecular cross-talk among chromosome fragility syndromes

Molecular cross-talk among chromosome fragility syndromes MEETING REVIEW Molecular cross-talk among chromosome fragility syndromes Jordi Surrallés, 1,7 Stephen P. Jackson, 2 Maria Jasin, 3 Michael B. Kastan, 4 Stephen C. West, 5 and Hans Joenje 6 1 Group of Mutagenesis,

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

SMOKING, CHROMOSOME DAMAGE AND AN ABNORMAL DNA DAMAGE RESPONSE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) Rafael Ernesto Flores Obando

SMOKING, CHROMOSOME DAMAGE AND AN ABNORMAL DNA DAMAGE RESPONSE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) Rafael Ernesto Flores Obando SMOKING, CHROMOSOME DAMAGE AND AN ABNORMAL DNA DAMAGE RESPONSE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) by Rafael Ernesto Flores Obando Licenciatura, Clinical Bio Analysis, Universidad Nacional

More information

Histone H2AX and Fanconi anemia FANCD2 function in the same pathway to maintain chromosome stability

Histone H2AX and Fanconi anemia FANCD2 function in the same pathway to maintain chromosome stability The EMBO Journal (27) 26, 134 1351 & 27 European Molecular Biology Organization All Rights Reserved 261-4189/7 www.embojournal.org Histone H2AX and Fanconi anemia FANCD2 function in the same pathway to

More information

TOUR REPORT. Report on participation of the ICMR International Fellow (ICMR IF) in Training / Research abroad

TOUR REPORT. Report on participation of the ICMR International Fellow (ICMR IF) in Training / Research abroad TOUR REPORT Report on participation of the ICMR International Fellow (ICMR IF) in Training / Research abroad 1. Name and Designation of ICMR IF : Dr. A. Venkateshwari, Assistant Professor 2. Address: Dr.

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

GENETIC TESTING FOR FANCONI ANEMIA

GENETIC TESTING FOR FANCONI ANEMIA GENETIC TESTING FOR FANCONI ANEMIA Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding

More information

Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition

Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells

More information

Molecular Cell Biology (Bio 5068) Cell Cycle I. Ron Bose, MD PhD November 14, 2017

Molecular Cell Biology (Bio 5068) Cell Cycle I. Ron Bose, MD PhD November 14, 2017 Molecular Cell Biology (Bio 5068) Cell Cycle I Ron Bose, MD PhD November 14, 2017 CELL DIVISION CYCLE M G2 S G1 DISCOVERY AND NAMING OF CYCLINS A protein (called cyclin ) was observed to increase as cells

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our

More information

RNA interferences targeting the Fanconi anemia/brca pathway upstream genes reverse cisplatin resistance in drug-resistant lung cancer cells

RNA interferences targeting the Fanconi anemia/brca pathway upstream genes reverse cisplatin resistance in drug-resistant lung cancer cells Dai et al. Journal of Biomedical Science (2015) 22:77 DOI 10.1186/s12929-015-0185-4 RESEARCH Open Access RNA interferences targeting the Fanconi anemia/brca pathway upstream genes reverse cisplatin resistance

More information

Review Article Central Role of Ubiquitination in Genome Maintenance: DNA Replication and Damage Repair

Review Article Central Role of Ubiquitination in Genome Maintenance: DNA Replication and Damage Repair International Scholarly Research Network ISRN Molecular Biology Volume 2012, Article ID 146748, 9 pages doi:10.5402/2012/146748 Review Article Central Role of iquitination in Genome Maintenance: DNA Replication

More information

Molecular pathogenesis and clinical management of Fanconi anemia

Molecular pathogenesis and clinical management of Fanconi anemia Science in medicine Molecular pathogenesis and clinical management of Fanconi anemia Younghoon Kee 1 and Alan D. D Andrea 2 1 Department of Cell Biology, Microbiology, and Molecular Biology, University

More information

Phenotypes and genotypes of the chromosomal instability syndromes

Phenotypes and genotypes of the chromosomal instability syndromes Rare Diseases Column (Review Article) Phenotypes and genotypes of the chromosomal instability syndromes Zhan-He Wu Western Sydney Genome Diagnostics, Western Sydney Genetics Program, The Children s Hospital

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

Productive Replication of Human Papillomavirus 31 Requires the DNA Repair Factor Nbs1. Running Title: Nbs1 is necessary for productive HPV replication

Productive Replication of Human Papillomavirus 31 Requires the DNA Repair Factor Nbs1. Running Title: Nbs1 is necessary for productive HPV replication JVI Accepts, published online ahead of print on 21 May 2014 J. Virol. doi:10.1128/jvi.00517-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

More information

Removal of Shelterin Reveals the Telomere End-Protection Problem

Removal of Shelterin Reveals the Telomere End-Protection Problem Removal of Shelterin Reveals the Telomere End-Protection Problem DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci DSB e CROMATINA Higher-order chromatin packaging is a barrier to

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Supporting Online Material for

Supporting Online Material for www.sciencemag.org/cgi/content/full/33/635/33/dc Supporting Online Material for A DNA Damage Response Screen Identifies RHINO, a 9-- and TopBP Interacting Protein Required for ATR Signaling This PDF file

More information

Breast Cancer Susceptibility and HLA Complex: Source of Missing Heritability?

Breast Cancer Susceptibility and HLA Complex: Source of Missing Heritability? Breast Cancer Susceptibility and HLA Complex: Source of Missing Heritability? M. Tevfik DORAK Environmental & Occupational Health College of Public Health Florida International University Miami, USA http://www.dorak.info

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation

HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1

More information

Review Article Targeting the Fanconi Anemia Pathway to Identify Tailored Anticancer Therapeutics

Review Article Targeting the Fanconi Anemia Pathway to Identify Tailored Anticancer Therapeutics Anemia Volume 2012, Article ID 481583, 7 pages doi:10.1155/2012/481583 Review Article Targeting the Fanconi Anemia Pathway to Identify Tailored Anticancer Therapeutics Chelsea Jenkins, Jenny Kan, and Maureen

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Note: regular talks are 15 minutes: 10 for the presenter, 5 for Q & A

Note: regular talks are 15 minutes: 10 for the presenter, 5 for Q & A Thursday 27th 3:00 pm Registration 4:30-6:00 Opening Session Stella Davies, Cincinnati Children's Hospital, United States Grover Bagby, Oregon Health & Sciences University, United States Mary-Beth Johnson,

More information

A. List of selected proteins with high SILAC (H/L) ratios identified in mass

A. List of selected proteins with high SILAC (H/L) ratios identified in mass Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,

More information

Lecture 10. G1/S Regulation and Cell Cycle Checkpoints. G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint

Lecture 10. G1/S Regulation and Cell Cycle Checkpoints. G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint Lecture 10 G1/S Regulation and Cell Cycle Checkpoints Outline: G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint Paper: The roles of Fzy/Cdc20 and Fzr/Cdh1

More information

Aldehydes: What Are They and Why Should They be Avoided

Aldehydes: What Are They and Why Should They be Avoided Aldehydes: What Are They and Why Should They be Avoided Alan D Andrea, M.D. Fuller-American Cancer Society Professor Dana-Farber Cancer Institute Harvard Medical School Boston, MA, U.S.A. Fanconi Anemia

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Product Datasheet. KAP1 Antibody NB Unit Size: 100 ul. Store at 4C. Do not freeze. Publications: 16

Product Datasheet. KAP1 Antibody NB Unit Size: 100 ul. Store at 4C. Do not freeze. Publications: 16 Product Datasheet KAP1 Antibody NB500-158 Unit Size: 100 ul Store at 4C. Do not freeze. Publications: 16 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb500-158

More information

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells

Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

DNA repair and synthetic lethality

DNA repair and synthetic lethality Washington University School of Medicine Digital Commons@Becker Open Access Publications 2011 DNA repair and synthetic lethality Gong-she Guo Shandong University Feng-mei Zhang Shandong University Rui-jie

More information

LEARNING ABOUT FANCONI ANEMIA

LEARNING ABOUT FANCONI ANEMIA opyr LEARNING ABOUT FANCONI ANEMIA *Jacqueline Rosenberg *Justin Mark Artwork By: Jacqueline Rosenberg 00 Posters. Ccted. F1000 OVERVIEW Fanconi Anemia (FA) is a rare disease of the blood that leads to

More information

HLA Complex Genetics & Biology

HLA Complex Genetics & Biology HLA Complex Genetics & Biology M. Tevfik DORAK Environmental & Occupational Health College of Public Health Florida International University Miami, USA http://www.dorak.info Mount Sinai Medical Center

More information

Chapter 2. Diagnostic Evaluation of FA. Definition of Fanconi Anemia. The Importance of Early Diagnosis. Blanche P. Alter, MD, MPH, FAAP

Chapter 2. Diagnostic Evaluation of FA. Definition of Fanconi Anemia. The Importance of Early Diagnosis. Blanche P. Alter, MD, MPH, FAAP Chapter 2 Diagnostic Evaluation of FA Blanche P. Alter, MD, MPH, FAAP Definition of Fanconi Anemia Fanconi anemia is an autosomal recessive disorder associated with a very high frequency of bone marrow

More information

Role of genetic testing in familial breast cancer outside of BRCA1 and BRCA2

Role of genetic testing in familial breast cancer outside of BRCA1 and BRCA2 Role of genetic testing in familial breast cancer outside of BRCA1 and BRCA2 Introduction Most commonly diagnosed cancer in South African women and the second most commonly diagnosed cancer in Black women

More information

Mdm2 Promotes Genetic Instability and Transformation Independent of p53

Mdm2 Promotes Genetic Instability and Transformation Independent of p53 MOLECULAR AND CELLULAR BIOLOGY, Aug. 2008, p. 4862 4874 Vol. 28, No. 15 0270-7306/08/$08.00 0 doi:10.1128/mcb.01584-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Mdm2 Promotes

More information

Advances in genetic studies of inherited bone marrow failure syndromes and their associated malignancies

Advances in genetic studies of inherited bone marrow failure syndromes and their associated malignancies Review Article Advances in genetic studies of inherited bone marrow failure syndromes and their associated malignancies Qi-Hong Yu 1, Shu-Ye Wang 2, Zhanhe Wu 3 1 Department of Gastroenterology, Chang

More information

THE EMERGING GENETIC AND MOLECULAR BASIS OF FANCONI ANAEMIA

THE EMERGING GENETIC AND MOLECULAR BASIS OF FANCONI ANAEMIA THE EMERGING GENETIC AND MOLECULAR BASIS OF FANCONI ANAEMIA Hans Joenje* and Ketan J. Patel The past few years have witnessed a considerable expansion in our understanding of the pathways that maintain

More information

Recruitment of HBO1 Histone Acetylase and Blocks

Recruitment of HBO1 Histone Acetylase and Blocks Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin

More information

Cytogenetic Instability in Ovarian Epithelial Cells from Women at Risk of Ovarian Cancer

Cytogenetic Instability in Ovarian Epithelial Cells from Women at Risk of Ovarian Cancer Research Article Cytogenetic Instability in Ovarian Epithelial Cells from Women at Risk of Ovarian Cancer Tanja Pejovic, 1,2,3 Jane E. Yates, 3 Hong Y. Liu, 1 Laura E. Hays, 3 Yassmine Akkari, 4 Yumi Torimaru,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Silver staining and immunoblotting of the purified TAK1 kinase complex. The TAK1 kinase complex was purified through tandem affinity methods (Protein A and FLAG), and aliquots of the purified

More information

Chapter 2. Aims & Objectives

Chapter 2. Aims & Objectives 2.1. Statement of the problem: Earlier reports have shown ambiguous alteration of histone marks in response to DNA damage in asynchronized population of cells. These histone marks not only undergo dynamic

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Analysis of molecular components, causing Fanconi Anemia-like phenotype in HPV-16 infected Head and Neck Squamous Cell Carcinomas

Analysis of molecular components, causing Fanconi Anemia-like phenotype in HPV-16 infected Head and Neck Squamous Cell Carcinomas Department of Gynecology and Obstetrics Ulm University Medical Center Prof. Dr. Wolfgang Janni Analysis of molecular components, causing Fanconi Anemia-like phenotype in HPV-16 infected Head and Neck Squamous

More information

Cancer Risks Associated With Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2

Cancer Risks Associated With Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2 AWARD NUMBER: W81XWH-15-1-0084 TITLE: Cancer Risks Associated With Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2 PRINCIPAL INVESTIGATOR: Elizabeth Swisher CONTRACTING

More information

DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer

DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations Peter de Boer Department of Obst.& Gynaecology, Div. Reproductive Medicine Radboud University Nijmegen Medical

More information

Gary Kupfer, M.D. CURRICULUM VITAE

Gary Kupfer, M.D. CURRICULUM VITAE CURRICULUM VITAE Name: Education: BS, microbiology, University of Florida, 1983 MD, Johns Hopkins University, 1989 Fellow, Pediatric Hematology/Oncology, Boston Children s Hospital, Harvard Medical School,

More information

Tumor cell reassortment within the cell cycle (including checkpoints and cell-cycle arrest)

Tumor cell reassortment within the cell cycle (including checkpoints and cell-cycle arrest) Tumor cell reassortment within the cell cycle (including checkpoints and cell-cycle arrest) Carsten Herskind Dept. of Radiation Oncology. Universitätsmedizin Mannheim Medical Faculty Mannheim, Heidelberg

More information

Cell cycle control (mammalian)

Cell cycle control (mammalian) Apr. 21, 2005 Cell cycle control (mammalian) Basic mechanisms & protein components Checkpoints Chap. 21, by Lodish et al., 5 th ed. 2004 Chap. 17, by Alberts et al., 4 th ed. 2002 鍾明怡 mychung@vghtpe.gov.tw

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

Cancer Epidemiology in Fanconi Anemia

Cancer Epidemiology in Fanconi Anemia Cancer Epidemiology in Fanconi Anemia FA Camp 2010 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Resources Source N Retrospective: Literature

More information

Ubiquitinated Fancd2 recruits Fan1 to stalled replication forks to prevent genome instability

Ubiquitinated Fancd2 recruits Fan1 to stalled replication forks to prevent genome instability Europe PMC Funders Group Author Manuscript Published in final edited form as: Science. 2016 February 19; 351(6275): 846 849. doi:10.1126/science.aad5634. Ubiquitinated Fancd2 recruits Fan1 to stalled replication

More information

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway

Trehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,

More information

SLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4

SLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4 GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase

More information

RAD51C IS A TUMOR SUPPRESSOR IN MAMMARY AND SEBACEOUS GLANDS

RAD51C IS A TUMOR SUPPRESSOR IN MAMMARY AND SEBACEOUS GLANDS RAD51C IS A TUMOR SUPPRESSOR IN MAMMARY AND SEBACEOUS GLANDS MANUELA TUMIATI Institute for Molecular Medicine Finland and Faculty of Biological and Environmental Sciences and Doctoral Program in Biomedicine,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots

More information

DSB. Double-Strand Breaks causate da radiazioni stress ossidativo farmaci

DSB. Double-Strand Breaks causate da radiazioni stress ossidativo farmaci DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci METODI DDR foci formation in irradiated (2 Gy) cells fixed 2 h later IRIF IRradiation Induced Focus Laser micro-irradiation DDR

More information

Functional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma

Functional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma Beumer et al. BMC Cancer (2015) 15:649 DOI 10.1186/s12885-015-1649-3 RESEARCH ARTICLE Functional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma Jan H. Beumer 1,2, Katherine Y. Fu 3,

More information

Study of different types of ubiquitination

Study of different types of ubiquitination Study of different types of ubiquitination Rudi Beyaert (rudi.beyaert@irc.vib-ugent.be) VIB UGent Center for Inflammation Research Ghent, Belgium VIB Training Novel Proteomics Tools: Identifying PTMs October

More information

Importance of ATM in Radiotherapy

Importance of ATM in Radiotherapy Importance of ATM in Radiotherapy Radiology and Physical Medicine María Trinidad Rueda Cáceres Radiotherapy Importance of ATM in Radiotherapy One of the standard treatment options for various malignant

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Characterization of the Role of the Phosphatase and Tensin Homolog, PTEN, in DNA Crosslink Repair

Characterization of the Role of the Phosphatase and Tensin Homolog, PTEN, in DNA Crosslink Repair University of Rhode Island DigitalCommons@URI Open Access Dissertations 2016 Characterization of the Role of the Phosphatase and Tensin Homolog, PTEN, in DNA Crosslink Repair Elizabeth Ann Vuono University

More information

Nature Structural & Molecular Biology: doi: /nsmb.3218

Nature Structural & Molecular Biology: doi: /nsmb.3218 Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted

More information

Review Article DNA Damage as a Driver for Growth Delay: Chromosome Instability Syndromes with Intrauterine Growth Retardation

Review Article DNA Damage as a Driver for Growth Delay: Chromosome Instability Syndromes with Intrauterine Growth Retardation Hindawi BioMed Research International Volume 2017, Article ID 8193892, 14 pages https://doi.org/10.1155/2017/8193892 Review Article DNA Damage as a Driver for Growth Delay: Chromosome Instability Syndromes

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

Lack of Sensitivity of Primary Fanconi s Anemia Fibroblasts to UV and Ionizing Radiation

Lack of Sensitivity of Primary Fanconi s Anemia Fibroblasts to UV and Ionizing Radiation RADIATION RESEARCH 161, 18 25 (200) 00-7587/0 $15.00 200 by Radiation Research Society. All rights of reproduction in any form reserved. Lack of Sensitivity of Primary Fanconi s Anemia Fibroblasts to UV

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

The DNA damage response pathways: at the crossroad of protein modifications

The DNA damage response pathways: at the crossroad of protein modifications 8 REVIEW Cell Research (2008) 18:8-16. 2008 IBCB, SIBS, CAS All rights reserved 1001-0602/08 $ 30.00 www.nature.com/cr npg The DNA damage response pathways: at the crossroad of protein modifications Michael

More information

White Paper. Introduction. Joseph Hwang, Ph.D., Senior Research Scientist, Cell Signaling Group EMD Millipore Corporation

White Paper. Introduction. Joseph Hwang, Ph.D., Senior Research Scientist, Cell Signaling Group EMD Millipore Corporation White Paper Data Sheet Exploring DNA Damage/Genotoxicity Using the MILLIPLEX map 7-plex DNA Damage/Genotoxicity Kit Joseph Hwang, Ph.D., Senior Research Scientist, Cell Signaling Group EMD Millipore Corporation

More information

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs

Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA

More information

Evidence for variation in human radiosensitivity: potential impact on radiological protection

Evidence for variation in human radiosensitivity: potential impact on radiological protection Evidence for variation in human radiosensitivity: potential impact on radiological protection Simon Bouffler 22 October 2015 ICRP Symposium 2015, Seoul, South Korea Current system of protection Avoid tissue

More information

Mechanism of Genomic Instability in Cells Infected with the High-Risk Human Papillomaviruses

Mechanism of Genomic Instability in Cells Infected with the High-Risk Human Papillomaviruses Mechanism of Genomic Instability in Cells Infected with the High-Risk Human Papillomaviruses Meelis Kadaja 1,2, Helen Isok-Paas 3, Triin Laos 1, Ene Ustav 2,3, Mart Ustav 3 * 1 Institute of Molecular and

More information

UNIVERSITY OF CALGARY. The Role of PIK3CA in Cisplatin Resistance of Cervical Cancer. Cole Merry A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES

UNIVERSITY OF CALGARY. The Role of PIK3CA in Cisplatin Resistance of Cervical Cancer. Cole Merry A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES UNIVERSITY OF CALGARY The Role of PIK3CA in Cisplatin Resistance of Cervical Cancer by Cole Merry A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information