Legends for Supplemental Figures.
|
|
- Gloria Harris
- 5 years ago
- Views:
Transcription
1 1 Legends for Supplemental Figures. Supplemental Figure 1. Proteasome Inhibition does not abrogate the expression of FA core complex proteins or formation of the FA core complex. (Full-length blots are presented in Supplemental Fig. 3L-N) (A) Simplified model of the FA pathway. Eight FA proteins (FANCA, B, C, E, F, G, L and M), FAAP24 and FAAP100 form a multi-subunit ubiquitin ligase complex (FA core complex). In response to DNA damage and during normal S phase progression, the FANCD2 protein is monoubiquitinated on lysine 561 in an FA core complex (E3 ubiquitin ligase)- and UBE2T (E2 ubiquitin conjugating enzyme)-dependent manner. ATR kinase is required for increase of FANCD2 monoubiquitination in response to DNA damage. Monoubiquitinated FANCD2 is targeted to nuclear foci where it colocalizes with γh2ax, ATR, RPA, the MRN complex, BRCA1, BRCA2, RAD51, PALB2, FANCJ and other proteins. BRCA1 is required for nuclear foci formation of FANCD2 in response to DNA damage. All of these factors are required for cellular resistance to DNA crosslinking agents. On the other hand, PCNA is monoubiquitinated on K164 by RAD6 and RAD18, and this monoubiquitination activates translesion synthesis. The deubiquitinating enzyme USP1 negatively regulates monoubiquitination of both FANCD2 and PCNA. (B) Treatment with proteasome inhibitors did not affect the expression of FA core complex proteins. HeLa cells were exposed to IR (15Gy) and incubated in the presence of MG132 (2µM) for the indicated time. Expression of FANCA, C, D2, F, and G was examined by western blotting. Asterisks (*) indicate non-specific bands.
2 2 (C) Expression of FA core complex proteins and UBE2T was not affected by treatment with proteasome inhibitors. HeLa cells were exposed to IR (15Gy) and incubated in the presence of MG132 (2µM) for 8 hours. Expression of FANCA, C, D2, E, F, G, M and UBE2T was examined by western blotting. (D) Treatment with proteasome inhibitors did not affect the formation of FA core complex. HeLa cells were exposed to IR (15Gy) and/or incubated in the presence of MG132 (2µM) for 8 hours. A FANCA antibody was used to isolate immunocomplexes from whole cell extracts. IP products were analyzed by western blotting using FANCA, C and G antibodies. FANCC and FANCG co-immunoprecipitated with FANCA in all conditions. Supplemental Figure 2. Analysis of ATR and ATM activation after DNA damage in the presence of proteasome inhibitors. (Full-length blots are presented in Supplemental Fig. 3O-Q) (A) Proteasome inhibition did not inhibit cisplatin-, HU- and UV-induced CHK1 phosphorylation, while it inhibited RPA2 phosphorylation and FANCD2 monoubiquitination. HeLa cells were incubated in cisplatin (CDDP 25µM) or hydroxyurea (1mM) for 24 hours, or exposed to UV radiations (50J/m2), and incubated in the presence of bortezomib for 8 hours. FANCD2, CHK1, CHK1-Ser345P and RPA2 immunoblots were performed using whole cell extracts. (B) Proteasome inhibition inhibits IR-induced CHK1 and RPA2 phosphorylations. HeLa cells were incubated in the presence of bortezomib (1µM) for 4 hours, irradiated (15Gy)
3 3 and incubated for the indicated time after irradiation. FANCD2, CHK1, CHK1-Ser345P and RPA2 immunoblots were performed using whole cell extracts. (C) Proteasome inhibition does not inhibit IR-induced phosphorylation of ATM substrates. HeLa cells were treated as described in (B). ATM-dependent phosphorylations of ATM Ser1981, NBS1 Ser343, CHK2 Thr68, and FANCD2 Thr691 in response to IR were analyzed by western blotting. Supplemental Figure 3. Non-cropped pictures of blots and gels. The Western-blot membranes were cut to allow multiple simultaneous hybridizations. (A-D) Non-cropped pictures of blots presented in Figure 1. (E and F) Non-cropped pictures of gels and blots presented in Figure 2. (G-J) Non-cropped pictures blots presented in Figure 3. (K) Non-cropped pictures of blot presented in Figure 6. (L-N) Non-cropped pictures of blot presented in Supplemental Figure 1. (O-Q) Non-cropped pictures of blot presented in Supplemental Figure 2. Material and Methods for Supplemental Figures Western blot analysis. Mouse monoclonal antibodies directed against ATM- Ser1981P ( , Rockland, 1/2000), CHK1 (G-4, Santa Cruz, 1/1000), RPA2 (Ab-2, Calbiochem, 1/1000), rabbit polyclonal antibodies against ATM (GTX17955, Genetex, Inc., 1/5000), phospho-chk1 (Ser345) (#2341, Cell Signaling, 1/500), CHK2 (07-057, Upstate, 1/1000), phospho-chk2 (Thr68) (#2661, Cell Signaling, 1/1000), FANCA (#7488, a gift of Dr. Maureen Hoatlin, 1/1000), FANCC ((1), 1/500), phosho-
4 4 FANCD2 (Thr691) ((2), 1/500), FANCE (gift of Drs. XiaoZhe Wang and Alan D Andrea, 1/2000), FANCF ((3), 1/1000), FANCG ((4), 1/1000), FANCM ((5), gift of Dr. Weidong Wang (National Institute on Aging), 1/2000), and UBE2T (BC004152, ProteinTech Group (Chicago, IL), 1/2000) were used as a primary antibodies. Immunoprecipitation. Using a polyclonal antibody to FANCA (#7488, gift from Dr. Maureen Hoatlin, Oregon Health and Science University), immunoprecipitation was performed as previously described (6). References for supplemental data 1. Yamashita T, Barber DL, Zhu Y, Wu N, D'Andrea AD. The Fanconi anemia polypeptide FACC is localized to the cytoplasm. Proc Natl Acad Sci U S A 1994; 91: Ho GP, Margossian S, Taniguchi T, D'Andrea AD. Phosphorylation of FANCD2 on two novel sites is required for mitomycin C resistance. Mol Cell Biol 2006; 26: Siddique MA, Nakanishi K, Taniguchi T, Grompe M, D'Andrea AD. Function of the Fanconi anemia pathway in Fanconi anemia complementation group F and D1 cells. Exp Hematol 2001; 29: Garcia-Higuera I, Kuang Y, Naf D, Wasik J, D'Andrea AD. Fanconi anemia proteins FANCA, FANCC, and FANCG/XRCC9 interact in a functional nuclear complex. Mol Cell Biol 1999; 19:
5 5 5. Meetei AR, Medhurst AL, Ling C, et al. A human ortholog of archaeal DNA repair protein Hef is defective in Fanconi anemia complementation group M. Nat Genet 2005; 37: Taniguchi T, D'Andrea AD. The Fanconi Anemia Protein, FANCE, Promotes the Nuclear Accumulation of FANCC. Blood 2002; 100:
6
7
8
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
More informationCellular response to DNA interstrand crosslinks: the Fanconi anemia pathway
Cell. Mol. Life Sci. (2016) 73:3097 3114 DOI 10.1007/s00018-016-2218-x Cellular and Molecular Life Sciences REVIEW Cellular response to DNA interstrand crosslinks: the Fanconi anemia pathway David Lopez-Martinez
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationMolecular Mechanisms of Fanconi Anemia
MEDICAL INTELLIGENCE UNIT Molecular Mechanisms of Fanconi Anemia Shamim I. Ahmad, B.Sc, M.Sc, Ph.D. School of Biomedical and Natural Sciences Nottingham Trent University Nottingham, England, U.K. Sandra
More informationPrognostic value of DNA repair based stratification of hepatocellular carcinoma
Prognostic value of DNA repair based stratification of hepatocellular carcinoma Zhuo Lin 1, 2 #, Shi-Hao Xu 3 #, Hai-Qing Wang 4, Yi-Jing Cai 1, 2, Li Ying 3, Mei Song 1, 2, Yu-Qun Wang 1, 2, Shan-Jie
More informationSupplementary Figure 1
Supplementary Figure 1 a γ-h2ax MDC1 RNF8 FK2 BRCA1 U2OS Cells sgrna-1 ** 60 sgrna 40 20 0 % positive Cells (>5 foci per cell) b ** 80 sgrna sgrna γ-h2ax MDC1 γ-h2ax RNF8 FK2 MDC1 BRCA1 RNF8 FK2 BRCA1
More informationNon-specific chemical inhibition. the Fanconi anemia pathway sensitizes cancer cells to cisplatin.
Non-specific chemical inhibition of the Fanconi anemia pathway sensitizes cancer cells to cisplatin The Harvard community has made this article openly available. Please share how this access benefits you.
More informationThe PTEN phosphatase functions cooperatively with the. Fanconi anemia proteins in DNA crosslink repair
The PTEN phosphatase functions cooperatively with the Fanconi anemia proteins in DNA crosslink repair Elizabeth A. Vuono, 1 Ananda Mukherjee, 2 David A. Vierra, 1 Morganne M. Adroved, 1 Charlotte Hodson,
More informationRNF4-mediated polyubiquitination regulates the Fanconi anemia/brca pathway
The Journal of Clinical Investigation Research article RNF4-mediated polyubiquitination regulates the Fanconi anemia/brca pathway Jenny Xie, 1 Hyungjin Kim, 1 Lisa A. Moreau, 1 Shannon Puhalla, 2 Judy
More informationFanconi anemia pathway the way of DNA interstrand cross-link repair
Department of Hematology, Central South University Third Xiangya Hospital 1 ; Department of Hematology, Central South University Xiangya Hospital 2, Changsha, China Fanconi anemia pathway the way of DNA
More informationThe Fanconi anemia ID2 complex: Dueling saxes at the crossroads
Cell Cycle ISSN: 1538-4101 (Print) 1551-4005 (Online) Journal homepage: http://www.tandfonline.com/loi/kccy20 The Fanconi anemia ID2 complex: Dueling saxes at the crossroads Rebecca A Boisvert & Niall
More informationSUPPLEMENTARY INFORMATION
Supplementary Discussion The cell cycle machinery and the DNA damage response network are highly interconnected and co-regulated in assuring faithful duplication and partition of genetic materials into
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationBrian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology
Brian T Burgess, DO, PhD, GYN Oncology Fellow Rachel W. Miller, MD, GYN Oncology Epithelial Ovarian Cancer - Standard Current Treatment: Surgery with De-bulking + Platinum-Taxane based Chemotherapy - No
More informationHuman Papillomaviruses Activate the ATM DNA Damage Pathway for Viral Genome Amplification upon Differentiation
Human Papillomaviruses Activate the ATM DNA Damage Pathway for Viral Genome Amplification upon Differentiation Cary A. Moody, Laimonis A. Laimins* Department of Microbiology and Immunology, Feinberg School
More informationMolecular cross-talk among chromosome fragility syndromes
MEETING REVIEW Molecular cross-talk among chromosome fragility syndromes Jordi Surrallés, 1,7 Stephen P. Jackson, 2 Maria Jasin, 3 Michael B. Kastan, 4 Stephen C. West, 5 and Hans Joenje 6 1 Group of Mutagenesis,
More informationSUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of
SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium
More informationSMOKING, CHROMOSOME DAMAGE AND AN ABNORMAL DNA DAMAGE RESPONSE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) Rafael Ernesto Flores Obando
SMOKING, CHROMOSOME DAMAGE AND AN ABNORMAL DNA DAMAGE RESPONSE IN HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) by Rafael Ernesto Flores Obando Licenciatura, Clinical Bio Analysis, Universidad Nacional
More informationHistone H2AX and Fanconi anemia FANCD2 function in the same pathway to maintain chromosome stability
The EMBO Journal (27) 26, 134 1351 & 27 European Molecular Biology Organization All Rights Reserved 261-4189/7 www.embojournal.org Histone H2AX and Fanconi anemia FANCD2 function in the same pathway to
More informationTOUR REPORT. Report on participation of the ICMR International Fellow (ICMR IF) in Training / Research abroad
TOUR REPORT Report on participation of the ICMR International Fellow (ICMR IF) in Training / Research abroad 1. Name and Designation of ICMR IF : Dr. A. Venkateshwari, Assistant Professor 2. Address: Dr.
More informationRabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))
Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :
More informationGENETIC TESTING FOR FANCONI ANEMIA
GENETIC TESTING FOR FANCONI ANEMIA Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationTumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition
Tumour growth environment modulates Chk1 signalling pathways and sensitivity to Chk1 inhibition Andrew J Massey Supplementary Information Supplementary Figure S1. Related to Fig. 1. (a) HT29 or U2OS cells
More informationMolecular Cell Biology (Bio 5068) Cell Cycle I. Ron Bose, MD PhD November 14, 2017
Molecular Cell Biology (Bio 5068) Cell Cycle I Ron Bose, MD PhD November 14, 2017 CELL DIVISION CYCLE M G2 S G1 DISCOVERY AND NAMING OF CYCLINS A protein (called cyclin ) was observed to increase as cells
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our
More informationRNA interferences targeting the Fanconi anemia/brca pathway upstream genes reverse cisplatin resistance in drug-resistant lung cancer cells
Dai et al. Journal of Biomedical Science (2015) 22:77 DOI 10.1186/s12929-015-0185-4 RESEARCH Open Access RNA interferences targeting the Fanconi anemia/brca pathway upstream genes reverse cisplatin resistance
More informationReview Article Central Role of Ubiquitination in Genome Maintenance: DNA Replication and Damage Repair
International Scholarly Research Network ISRN Molecular Biology Volume 2012, Article ID 146748, 9 pages doi:10.5402/2012/146748 Review Article Central Role of iquitination in Genome Maintenance: DNA Replication
More informationMolecular pathogenesis and clinical management of Fanconi anemia
Science in medicine Molecular pathogenesis and clinical management of Fanconi anemia Younghoon Kee 1 and Alan D. D Andrea 2 1 Department of Cell Biology, Microbiology, and Molecular Biology, University
More informationPhenotypes and genotypes of the chromosomal instability syndromes
Rare Diseases Column (Review Article) Phenotypes and genotypes of the chromosomal instability syndromes Zhan-He Wu Western Sydney Genome Diagnostics, Western Sydney Genetics Program, The Children s Hospital
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationProductive Replication of Human Papillomavirus 31 Requires the DNA Repair Factor Nbs1. Running Title: Nbs1 is necessary for productive HPV replication
JVI Accepts, published online ahead of print on 21 May 2014 J. Virol. doi:10.1128/jvi.00517-14 Copyright 2014, American Society for Microbiology. All Rights Reserved. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
More informationRemoval of Shelterin Reveals the Telomere End-Protection Problem
Removal of Shelterin Reveals the Telomere End-Protection Problem DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci DSB e CROMATINA Higher-order chromatin packaging is a barrier to
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/33/635/33/dc Supporting Online Material for A DNA Damage Response Screen Identifies RHINO, a 9-- and TopBP Interacting Protein Required for ATR Signaling This PDF file
More informationBreast Cancer Susceptibility and HLA Complex: Source of Missing Heritability?
Breast Cancer Susceptibility and HLA Complex: Source of Missing Heritability? M. Tevfik DORAK Environmental & Occupational Health College of Public Health Florida International University Miami, USA http://www.dorak.info
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationReview Article Targeting the Fanconi Anemia Pathway to Identify Tailored Anticancer Therapeutics
Anemia Volume 2012, Article ID 481583, 7 pages doi:10.1155/2012/481583 Review Article Targeting the Fanconi Anemia Pathway to Identify Tailored Anticancer Therapeutics Chelsea Jenkins, Jenny Kan, and Maureen
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationNote: regular talks are 15 minutes: 10 for the presenter, 5 for Q & A
Thursday 27th 3:00 pm Registration 4:30-6:00 Opening Session Stella Davies, Cincinnati Children's Hospital, United States Grover Bagby, Oregon Health & Sciences University, United States Mary-Beth Johnson,
More informationA. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
More informationLecture 10. G1/S Regulation and Cell Cycle Checkpoints. G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint
Lecture 10 G1/S Regulation and Cell Cycle Checkpoints Outline: G1/S regulation and growth control G2 repair checkpoint Spindle assembly or mitotic checkpoint Paper: The roles of Fzy/Cdc20 and Fzr/Cdh1
More informationAldehydes: What Are They and Why Should They be Avoided
Aldehydes: What Are They and Why Should They be Avoided Alan D Andrea, M.D. Fuller-American Cancer Society Professor Dana-Farber Cancer Institute Harvard Medical School Boston, MA, U.S.A. Fanconi Anemia
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More information(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
More informationProduct Datasheet. KAP1 Antibody NB Unit Size: 100 ul. Store at 4C. Do not freeze. Publications: 16
Product Datasheet KAP1 Antibody NB500-158 Unit Size: 100 ul Store at 4C. Do not freeze. Publications: 16 Protocols, Publications, Related Products, Reviews, Research Tools and Images at: www.novusbio.com/nb500-158
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationFile Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
More informationDNA repair and synthetic lethality
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2011 DNA repair and synthetic lethality Gong-she Guo Shandong University Feng-mei Zhang Shandong University Rui-jie
More informationLEARNING ABOUT FANCONI ANEMIA
opyr LEARNING ABOUT FANCONI ANEMIA *Jacqueline Rosenberg *Justin Mark Artwork By: Jacqueline Rosenberg 00 Posters. Ccted. F1000 OVERVIEW Fanconi Anemia (FA) is a rare disease of the blood that leads to
More informationHLA Complex Genetics & Biology
HLA Complex Genetics & Biology M. Tevfik DORAK Environmental & Occupational Health College of Public Health Florida International University Miami, USA http://www.dorak.info Mount Sinai Medical Center
More informationChapter 2. Diagnostic Evaluation of FA. Definition of Fanconi Anemia. The Importance of Early Diagnosis. Blanche P. Alter, MD, MPH, FAAP
Chapter 2 Diagnostic Evaluation of FA Blanche P. Alter, MD, MPH, FAAP Definition of Fanconi Anemia Fanconi anemia is an autosomal recessive disorder associated with a very high frequency of bone marrow
More informationRole of genetic testing in familial breast cancer outside of BRCA1 and BRCA2
Role of genetic testing in familial breast cancer outside of BRCA1 and BRCA2 Introduction Most commonly diagnosed cancer in South African women and the second most commonly diagnosed cancer in Black women
More informationMdm2 Promotes Genetic Instability and Transformation Independent of p53
MOLECULAR AND CELLULAR BIOLOGY, Aug. 2008, p. 4862 4874 Vol. 28, No. 15 0270-7306/08/$08.00 0 doi:10.1128/mcb.01584-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Mdm2 Promotes
More informationAdvances in genetic studies of inherited bone marrow failure syndromes and their associated malignancies
Review Article Advances in genetic studies of inherited bone marrow failure syndromes and their associated malignancies Qi-Hong Yu 1, Shu-Ye Wang 2, Zhanhe Wu 3 1 Department of Gastroenterology, Chang
More informationTHE EMERGING GENETIC AND MOLECULAR BASIS OF FANCONI ANAEMIA
THE EMERGING GENETIC AND MOLECULAR BASIS OF FANCONI ANAEMIA Hans Joenje* and Ketan J. Patel The past few years have witnessed a considerable expansion in our understanding of the pathways that maintain
More informationRecruitment of HBO1 Histone Acetylase and Blocks
Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin
More informationCytogenetic Instability in Ovarian Epithelial Cells from Women at Risk of Ovarian Cancer
Research Article Cytogenetic Instability in Ovarian Epithelial Cells from Women at Risk of Ovarian Cancer Tanja Pejovic, 1,2,3 Jane E. Yates, 3 Hong Y. Liu, 1 Laura E. Hays, 3 Yassmine Akkari, 4 Yumi Torimaru,
More informationSUPPLEMENTARY INFORMATION
Figure S1. Silver staining and immunoblotting of the purified TAK1 kinase complex. The TAK1 kinase complex was purified through tandem affinity methods (Protein A and FLAG), and aliquots of the purified
More informationChapter 2. Aims & Objectives
2.1. Statement of the problem: Earlier reports have shown ambiguous alteration of histone marks in response to DNA damage in asynchronized population of cells. These histone marks not only undergo dynamic
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationAnalysis of molecular components, causing Fanconi Anemia-like phenotype in HPV-16 infected Head and Neck Squamous Cell Carcinomas
Department of Gynecology and Obstetrics Ulm University Medical Center Prof. Dr. Wolfgang Janni Analysis of molecular components, causing Fanconi Anemia-like phenotype in HPV-16 infected Head and Neck Squamous
More informationCancer Risks Associated With Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2
AWARD NUMBER: W81XWH-15-1-0084 TITLE: Cancer Risks Associated With Inherited Mutations in Ovarian Cancer Susceptibility Genes Beyond BRCA1 and BRCA2 PRINCIPAL INVESTIGATOR: Elizabeth Swisher CONTRACTING
More informationDNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer
DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations Peter de Boer Department of Obst.& Gynaecology, Div. Reproductive Medicine Radboud University Nijmegen Medical
More informationGary Kupfer, M.D. CURRICULUM VITAE
CURRICULUM VITAE Name: Education: BS, microbiology, University of Florida, 1983 MD, Johns Hopkins University, 1989 Fellow, Pediatric Hematology/Oncology, Boston Children s Hospital, Harvard Medical School,
More informationTumor cell reassortment within the cell cycle (including checkpoints and cell-cycle arrest)
Tumor cell reassortment within the cell cycle (including checkpoints and cell-cycle arrest) Carsten Herskind Dept. of Radiation Oncology. Universitätsmedizin Mannheim Medical Faculty Mannheim, Heidelberg
More informationCell cycle control (mammalian)
Apr. 21, 2005 Cell cycle control (mammalian) Basic mechanisms & protein components Checkpoints Chap. 21, by Lodish et al., 5 th ed. 2004 Chap. 17, by Alberts et al., 4 th ed. 2002 鍾明怡 mychung@vghtpe.gov.tw
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More informationCancer Epidemiology in Fanconi Anemia
Cancer Epidemiology in Fanconi Anemia FA Camp 2010 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Resources Source N Retrospective: Literature
More informationUbiquitinated Fancd2 recruits Fan1 to stalled replication forks to prevent genome instability
Europe PMC Funders Group Author Manuscript Published in final edited form as: Science. 2016 February 19; 351(6275): 846 849. doi:10.1126/science.aad5634. Ubiquitinated Fancd2 recruits Fan1 to stalled replication
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationcrossmark Ca V subunits interact with the voltage-gated calcium channel
crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in
More informationTrehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
More informationSLX4 + MUS81 SLX4 + GEN1 SLX4 CONTROL SLX4
GEN MUS8 GEN MUS8 GEN MUS8 GEN MUS8 GEN C LM MUS8 XPF (loading control) D H2AX Frequency of -positive bridges (% of anaphase cells) 6 4 2 p =.8 x -4 GM855 p =.27 PSNF5 E H2AX Figure S. Analysis of anaphase
More informationRAD51C IS A TUMOR SUPPRESSOR IN MAMMARY AND SEBACEOUS GLANDS
RAD51C IS A TUMOR SUPPRESSOR IN MAMMARY AND SEBACEOUS GLANDS MANUELA TUMIATI Institute for Molecular Medicine Finland and Faculty of Biological and Environmental Sciences and Doctoral Program in Biomedicine,
More informationSupplementary Figure 1
Supplementary Figure 1 Dox Cis Cam Pac 0 15 1 15 1 15 1 15 1 15 µmole/l Ub p53 Cytotoxic anticancer agents increase p53 levels but do not generally promote the accumulation of ubiquitinated. Western blots
More informationDSB. Double-Strand Breaks causate da radiazioni stress ossidativo farmaci
DSB Double-Strand Breaks causate da radiazioni stress ossidativo farmaci METODI DDR foci formation in irradiated (2 Gy) cells fixed 2 h later IRIF IRradiation Induced Focus Laser micro-irradiation DDR
More informationFunctional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma
Beumer et al. BMC Cancer (2015) 15:649 DOI 10.1186/s12885-015-1649-3 RESEARCH ARTICLE Functional analyses of ATM, ATR and Fanconi anemia proteins in lung carcinoma Jan H. Beumer 1,2, Katherine Y. Fu 3,
More informationStudy of different types of ubiquitination
Study of different types of ubiquitination Rudi Beyaert (rudi.beyaert@irc.vib-ugent.be) VIB UGent Center for Inflammation Research Ghent, Belgium VIB Training Novel Proteomics Tools: Identifying PTMs October
More informationImportance of ATM in Radiotherapy
Importance of ATM in Radiotherapy Radiology and Physical Medicine María Trinidad Rueda Cáceres Radiotherapy Importance of ATM in Radiotherapy One of the standard treatment options for various malignant
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationCharacterization of the Role of the Phosphatase and Tensin Homolog, PTEN, in DNA Crosslink Repair
University of Rhode Island DigitalCommons@URI Open Access Dissertations 2016 Characterization of the Role of the Phosphatase and Tensin Homolog, PTEN, in DNA Crosslink Repair Elizabeth Ann Vuono University
More informationNature Structural & Molecular Biology: doi: /nsmb.3218
Supplementary Figure 1 Endogenous EGFR trafficking and responses depend on biased ligands. (a) Lysates from HeLa cells stimulated for 2 min. with increasing concentration of ligands were immunoblotted
More informationReview Article DNA Damage as a Driver for Growth Delay: Chromosome Instability Syndromes with Intrauterine Growth Retardation
Hindawi BioMed Research International Volume 2017, Article ID 8193892, 14 pages https://doi.org/10.1155/2017/8193892 Review Article DNA Damage as a Driver for Growth Delay: Chromosome Instability Syndromes
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationLack of Sensitivity of Primary Fanconi s Anemia Fibroblasts to UV and Ionizing Radiation
RADIATION RESEARCH 161, 18 25 (200) 00-7587/0 $15.00 200 by Radiation Research Society. All rights of reproduction in any form reserved. Lack of Sensitivity of Primary Fanconi s Anemia Fibroblasts to UV
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationThe DNA damage response pathways: at the crossroad of protein modifications
8 REVIEW Cell Research (2008) 18:8-16. 2008 IBCB, SIBS, CAS All rights reserved 1001-0602/08 $ 30.00 www.nature.com/cr npg The DNA damage response pathways: at the crossroad of protein modifications Michael
More informationWhite Paper. Introduction. Joseph Hwang, Ph.D., Senior Research Scientist, Cell Signaling Group EMD Millipore Corporation
White Paper Data Sheet Exploring DNA Damage/Genotoxicity Using the MILLIPLEX map 7-plex DNA Damage/Genotoxicity Kit Joseph Hwang, Ph.D., Senior Research Scientist, Cell Signaling Group EMD Millipore Corporation
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationEvidence for variation in human radiosensitivity: potential impact on radiological protection
Evidence for variation in human radiosensitivity: potential impact on radiological protection Simon Bouffler 22 October 2015 ICRP Symposium 2015, Seoul, South Korea Current system of protection Avoid tissue
More informationMechanism of Genomic Instability in Cells Infected with the High-Risk Human Papillomaviruses
Mechanism of Genomic Instability in Cells Infected with the High-Risk Human Papillomaviruses Meelis Kadaja 1,2, Helen Isok-Paas 3, Triin Laos 1, Ene Ustav 2,3, Mart Ustav 3 * 1 Institute of Molecular and
More informationUNIVERSITY OF CALGARY. The Role of PIK3CA in Cisplatin Resistance of Cervical Cancer. Cole Merry A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES
UNIVERSITY OF CALGARY The Role of PIK3CA in Cisplatin Resistance of Cervical Cancer by Cole Merry A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More information