BIOINF 3360 Computa1onal Immunomics
|
|
- Amberly Murphy
- 6 years ago
- Views:
Transcription
1 BIOINF 3360 Computa1onal Immunomics Oliver Kohlbacher Summer Personalized Cancer Vaccines Therapeu1c Cancer Vaccines Vaccines are one of the big success stories of modern medicine Edward Jenner and Luis Pasteur laid the foundaaons of prophylac1c vaccines Therapeu1c (cancer) vaccines Goal: raise an immune response against specific (e.g., cancer- associated) anagens Administered aier surgery/chemotherapy TargeAng of anagens either shared by many cancer of the same type, unique to the to a specific paaent (individualized) 2 Edward Jenner ( ) Luis Pasteur ( ) Cancer Mechanisms Cancer is a term used for diseases in which abnormal cells divide without control and are able to invade other Assues. (Na$onal Cancer Ins$tute) Abnormal cells Typically caused by genomic damage (cancer is someames called a genomic disease ) MutaAons, structural variaaons, chromosomal aberraaons can all be causes Mechanism Damage in a single cell suffices to start a cancer DysregulaAon: break the otherwise Aght cell cycle control Immune system failed to detect these aberrant cells Cells can proliferate without control 3 1
2 Cancer Immunology Immune system should be able to detect these aberraaons Existence of a tumor: immune system failed or immune response was not strong enough Once a tumor reaches a certain size, it becomes virtually impossible for immune cells to remove it Immune therapy: acavate the immune system to increase its aggressiveness towards a cancer 4 Heterogeneity & Spreading Cancers are oien not geneacally stable GeneAc makeup changes while the tumor grows Heterogeneous mix of cell types (with different genomic background) Spreading Cancers oien start spreading to other organs/assues From primary tumor to metastases: intravasaaon into bloodstream, extravasaaon into another Assue OIen also metastases in lymph nodes Micrometastases: metastases too small to be visible, thus not surgically resectable 5 Metastasis 6 2
3 Classical Cancer Treatment Surgery ResecAon of the affected Assue and metastases Radia1on therapy High- energy radiaaon can kill cancer cells in a locally well- defined area X- ray, gamma rays, or ion beams applied externally or radioacave compounds administered internally Chemotherapy CytostaAc drugs damage rapidly dividing cells more than other cells Targeted therapies (kinase inhibitors, anabodies) 7 Cancer Immunotherapy Idea Immune system provides best protecaon from cancer AcAvate immune system and direct its aeenaon to the cancer Problems Obviously the immune system failed to aeack the cancer in the first place Only works aier resecaon of the primary tumor/metastases or another classical therapy; immune system cannot infiltrate large tumors Tumor cells are modified normal cells: avoid acavaang an immune response against normal Assues Cancer is a personalized disease each cancer is different! 8 Cancer An1gens Two types of cancer anagens Over- expressed proteins Proteins not normally expressed in the Assue or only at low levels Copy number variaaons (CNV) or dysregulaaon leads to increased expression in the tumor Assue Increased copy number of MHC ligands being presented Mutated proteins Different protein sequence caused by somaac mutaaons (SNVs, single nucleoade variants, or InDels) or structural variaaon (e.g., fusion proteins) Different sequence causes novel presented MHC ligands 9 3
4 Cancer An1gens Over- expressed proteins OIen not uniquely expressed in the cancer Assue Danger of autoimmune reacaon Can be easily idenafied by expression analysis Some of these have been found to be characterisac for certain types of cancers Mutated proteins Specific to the cancer Assue (only occurring in cells derived from the iniaal mutaaon) Harder to detect: mutaaons are most of the Ame different for every paaent 10 Epitope- Based Cancer Vaccines Idea IdenAfy cancer an1gens specific for a cancer- type or a paaent Construct an epitope- based vaccine from these anagen sequences Vaccinate the paaent Immune system will find and remove micrometastases and prevent relapse Problems How to idenafy the relevant cancer anagens? How to construct the vaccine? 11 Finding Over- Expressed An1gens Omics technologies Transcriptomics Determine mrna expression levels using microarrays/rna- Seq Compare mrna expression between tumor and normal Proteomics Extract proteins, quanafy and idenafy using mass spectrometry (HPLC- MS) Less comprehensive, but reveals what is really there MHC Ligandomics Pull down MHC- pepade complexes from tumor/normal Assue, idenafy pepades using mass spectrometry Even less sensiave, but reveals what the immune system really sees of the cancer 12 4
5 Microarrays for Transcriptomics Fluorescence Readout Laser excites fluorescence dyes on chip CCD detects fluorescence signal of the whole chip Different dyes = different colors/ channels QuanAfy fluorescence per probe/ spot from the image From Transcriptomes to Pep1des Compare expression levels between normal Assue and tumor for a specific type of cancer IdenAfy proteins that are specifically over- expressed Consistently high expression in the majority of paaents Very low or not detectable expression in normal Assue Compare to expression data on other Assues! IdenAfy good epitopes for these anagens Compare to naturally processed ligands for this anagens (databases) Predict epitopes for relevant MHC class I alleles Experimental validaaon 15 5
6 Epitope- Based Vaccines 16 Purcell, McCluskey & Rossjohn, Nature Reviews Drug Discovery 6, (2007) Epitope- Based Cancer Vaccines Epitope- based vaccines have been shown to be effecave in cancer Prostate cancer: delayed progression in 4/19 paaents (Feyerabend, Prostate, 69:917, 2009) MetastaAc melanoma: increase survival, for immune responders (Becker et al., Cancer Immunol Immunother, 61:2091, 2012) Becker et al., Cancer Immunol Immunother, 61:2091, IMMATICS 6
7 IMMATICS - IMA 901 Walter et al., Nature Med, 18:1245, IMMATICS - IMA 901 Walter et al., Nature Med, 18:1245, IMMATICS - IMA 901 Walter et al., Nature Med, 18:1245,
8 IMMATICS - IMA 901 Walter et al., Nature Med, 18:1245, IMMATICS - IMA 901 IMA901 for treatment of kidney cancer (renal cell carcinoma) Nine pepades are presented on HLA- A*02 treatment for A2+ paaents only One addiaonal pepade presented on DRB PepAde mix was administered to paaents repeatedly 20 out of 27 paaents developed a T cell response to at least one of the pepade 8 paaents responded to mulaple pepades Survival increases with the number of immungenic pep1des Walter et al., Nature Med, 18:1245, Personalized Vaccines Personalized vaccines are a special case of a populaaon- opamized vaccine PopulaAon of one: HLA allele distribuaon is the paaent's HLA type Other aspects like anagen processing, anagen and allele coverage remain idenacal Sequence conservaaon is typically not an issue Personalized epitope selec1on problem: IdenAfy the best set of epitopes for a paaent's tumor specific expression and mutaaon paeern 24 8
9 Personalized Cancer Vaccines Epitope- based vaccines are an promising strategy PepAdes can be selected for each paaent individually Immune system can be acavated to target tumor- specific anagens PepAde synthesis can be done with moderate effort even under GMP condiaons Problems MHC is polymorphic: epitopes differ from paaent to paaent and from tumor to tumor Avoid side effects Regulatory issues 25 Science (2001), 291 (5507) Nature (2001), 409 (6822) Shotgun Sequencing DNA Shearing Size Selection Paired Reads (Mates) Cloning Sequencing Vector 9
10 Sanger Sequencing Sequencing Cost Comparison of costs for generating DNA sequence and their computational analysis (based on Moore's law) over the past decade. Note the logarithmic scale on the y-axis. (source: NHGRI, Sequencing by Synthesis Sequencing by synthesis produces massive amounts of data by parallelization Drawback: reduced quality of reads, read length 10
11 Illumina Metzker et al.,nat Rev Genetics (2010), 11:31 31 Illumina Sequencers Read Mapping Read mapping Alignment of short reads to a reference genome Typical problem size: mio. reads of 100 bp Variant calling Alignment needs to be inexact to permit genomic variants There are about mio. polymorphic sites in the genome Most have no effect, but some are disease- associated Difficult: disanguish variants from sequencing errors 11
12 ivac Integrated plauorm for personalized vaccine design Several individualized clinical trials for various cancers in progress Algorithmic core based on OpATope, addiaonal bioinformaacs infrastructure is needed A wealth of (high- throughput) data needs to be integrated to have as much informaaon available as possible Process ought to be automated: clinician sends appropriate tumor samples to pathology receives the synthesized vaccine no later than four weeks aier surgery Sample Collection HT Data Generation Data Analysis Synthesis & Vaccination 34 Pa1ent- Specific Variants Sequence only the exome (all exons) of the tumor and normal Assue Map reads to the human reference genome Variants can either be present in both Assues (SNPs, single nucleoade polymorphisms present in the germline) or only in the tumor (SNVs, somaac mutaaons) Variant calling has to be staasacally sound: disanguish sequencing errors from true variants Confirm idenafied variants with addiaonal (e.g., Sanger) sequencing run 35 From Reads to Variants Exome sequencing (Illumina GA IIx) Key steps Read mapping Variant calling AnnotaAon IntegraAon into an efficient pipeline for automated processing MutaAons in tumor MutaAons in normal Assue Tumor- specific muta1ons 36 12
13 From Reads to Epitopes Tumor (T) Reference Genome Normal (N) AA Seq (N T) Tumor-specific Peptides SNP C C C T C C SNV A A G G G IRQVKGDL[A V]FLNFQNNL IRQVKGDLV RQVKGDLVF QVKGDLVFL VKGDLVFLN KGDLVFLNF GDLVFLNFQ DLVFLNFQN LVFLNFQNN VFLNFQNNL Read mapping Variant calling SNP removal & translation Epitope prediction Predicted Epitopes QVKGDLVFL VFLNFQNNL 37 MHC Ligandome Analysis ExtracAon of differenaal pepades (tumor vs. normal) yields confirmed TUMAPs however at a low sensiavity MHC ligands are analyzed using LC- ESI- MS/MS (Orbitrap XL) MHC ligandomics differs from proteomics PepAde ID relies on databases SNVs need to be integrated! Search engines are opamized for trypac pepades MHC pepades are non- trypac Consensus idenaficaaon MulAple search engines, imputaaon of missing scores Increases idenaficaaon rates drasacally Nahnsen et al., J. Proteome Res., 2011, 10(8): Junker et al., J. Proteome Res., 2012, 11(7): ivac Workflow Samples (Tumor & Normal) DNA Extraction RNA Extraction MHC Ligand Shedding Exome Seq RNA Seq LC-ESI-MS/MS Read Mapping Read Mapping Quantitation HLA Typing Variant Calling Variant Calling Variant Integration & Annotation Identification Epitope Prediction Optimal Epitope Selection Peptide Synthesis and Vaccination 39 13
14 ivac Infrastructure Metadata Web Portal Other Labs openbis Database Workflow System NGS Lab Lab Storage MS Lab Lab Storage Project Storage Archival Storage Compute Cluster 40 Vaccina1on Web Portal Immunomonitoring data Interdisciplinary Tumor Board Vaccination GMP Facility 41 Ini1al ivac Trials 42 14
15 IndividuaLIVER 10 paaents suffering from surgically resectable liver cancer (cholangiocarcinoma or hepatocellular carcinoma) classified as pt1- pt4 Tumors were resected, blood samples taken as normal Assue; tumor contents: % Whole- exome seq, RNA- Seq, and MHC ligandome analysis Tumor- specific variants non- synonymous variants per paaent About 25% of the variants were found to be expressed in the tumor For every paaent we could idenafy between 1 and 9 tumor- specific pepades LC- MS could not confirm any of the variants seen on the genome level, but confirmed pepades of overexpressed Ags 43 Outlook Epitope-based vaccines are a compelling approach for personalized cancer therapy Immunological issues Optimize vaccination schemes Combination with chemotherapy Regulatory issues with personalized therapies Computational challenges Prediction of T-cell reactivity Modeling interplay with chemotherapy Efficient algorithms for fast turn-over times Computational design of personalized vaccines needs Smart data analysis algorithms Software systems able to handle high-throughput data efficiently Tight integration with clinical processes 44 15
Cancer Genomes How to Analyze Your Own Genome
Cancer Genomes 02-223 How to Analyze Your Own Genome Cancer vs. Heritable Diseases So far, we mostly discussed heritable diseases, where the disease causing mutaaons are inherited from one individual to
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationTPMI Presents: Translational Genomics Research Update, Opportunities and Challenges
TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges April 12, 2016 Darren D. O Rielly, Ph.D., FCCMG Director, Molecular Genetics Laboratory, Eastern Health Director, Translational
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationDIRECT IDENTIFICATION OF NEO-EPITOPES IN TUMOR TISSUE
DIRECT IDENTIFICATION OF NEO-EPITOPES IN TUMOR TISSUE Eustache Paramithiotis PhD Vice President, Biomarker Discovery & Diagnostics 17 March 2016 PEPTIDE PRESENTATION BY MHC MHC I Antigen presentation by
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationA Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
More informationCancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 20
More informationMetabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015
Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationReporting TP53 gene analysis results in CLL
Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationSession 4 Rebecca Poulos
The Cancer Genome Atlas (TCGA) & International Cancer Genome Consortium (ICGC) Session 4 Rebecca Poulos Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 28
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationACE ImmunoID. ACE ImmunoID. Precision immunogenomics. Precision Genomics for Immuno-Oncology
ACE ImmunoID ACE ImmunoID Precision immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. A universal biomarker platform for immuno-oncology Patient response to cancer immunotherapies
More informationThe Cancer Genome Atlas & International Cancer Genome Consortium
The Cancer Genome Atlas & International Cancer Genome Consortium Session 3 Dr Jason Wong Prince of Wales Clinical School Introductory bioinformatics for human genomics workshop, UNSW 31 st July 2014 1
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationApplications. in Oncology
Kewal K. Jain Applications of Biotechnology in Oncology Applications of Biotechnology in Oncology Applications of Biotechnology in Oncology Kewal K. Jain, MD, FRACS, FFPM Jain PharmaBiotech, Basel, Switzerland
More informationThe 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients
The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationSmall RNAs and how to analyze them using sequencing
Small RNAs and how to analyze them using sequencing RNA-seq Course November 8th 2017 Marc Friedländer ComputaAonal RNA Biology Group SciLifeLab / Stockholm University Special thanks to Jakub Westholm for
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationScreening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery
Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationMulti-omics data integration colon cancer using proteogenomics approach
Dept. of Medical Oncology Multi-omics data integration colon cancer using proteogenomics approach DTL Focus meeting, 29 August 2016 Thang Pham OncoProteomics Laboratory, Dept. of Medical Oncology VU University
More informationAssessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing
Assessing Laboratory Performance for Next Generation Sequencing Based Detection of Germline Variants through Proficiency Testing Karl V. Voelkerding, MD Professor of Pathology University of Utah Medical
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationBIT 120. Copy of Cancer/HIV Lecture
BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationPRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression.
PRECISION INSIGHTS GPS Cancer Molecular Insights You Can Rely On Tumor-normal sequencing of DNA + RNA expression www.nanthealth.com Cancer Care is Evolving Oncologists use all the information available
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationMutationTaster & RegulationSpotter
MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure
More informationUniversity of Pittsburgh Cancer Institute UPMC CancerCenter. Uma Chandran, MSIS, PhD /21/13
University of Pittsburgh Cancer Institute UPMC CancerCenter Uma Chandran, MSIS, PhD chandran@pitt.edu 412-648-9326 2/21/13 University of Pittsburgh Cancer Institute Founded in 1985 Director Nancy Davidson,
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationNGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht
NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary
More informationUniversity of Pittsburgh Annual Progress Report: 2008 Formula Grant
University of Pittsburgh Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Research Project 1: Project Title and Purpose Small Molecule Inhibitors of HIV Nef Signaling
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationThe Cancer Genome Atlas
The Cancer Genome Atlas July 14, 2011 Kenna M. Shaw, Ph.D. Deputy Director The Cancer Genome Atlas Program TCGA: Core Objectives Launched in 2006 as a pilot and expanded in 2009, the goals of TCGA are
More informationIni7al Staging of Follicular Cell-derived Thyroid Cancers: the ATA 2015 IRS and AJCC 8th Ed. Cancer Staging Systems
12/25/17 9th Annual AACE Advances in Thyroid Cancer Course Tempe, Arizona January 12-13, 2018. Ini7al Staging of Follicular Cell-derived Thyroid Cancers: the ATA 2015 IRS and AJCC 8th Ed. Cancer Staging
More informationMachine Learning For Personalized Cancer Vaccines. Alex Rubinsteyn February 9th, 2018 Data Science Salon Miami
Machine Learning For Personalized Cancer Vaccines Alex Rubinsteyn February 9th, 2018 Data Science Salon Miami OpenVax @ Mount Sinai Focus: personalized cancer vaccines Machine learning for immunology Cancer
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationEducator Navigation Guide
Decoding Breast Cancer Virtual Lab Educator Navigation Guide Decoding Cancer Nav Guide 2 Introduction In this virtual lab, students test tissue samples from different patients with breast cancer in order
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationImportance of Methodology Certification and Accreditations to Perform Assays. Stan Hamilton, MD Head, Pathology and Laboratory Medicine
Importance of Methodology Certification and Accreditations to Perform Assays Stan Hamilton, MD Head, Pathology and Laboratory Medicine 1 Disclosures No disclosures relevant to this presentation 2 A bad
More informationNew technologies for studying human immunity. Lisa Wagar Postdoctoral fellow, Mark Davis lab Stanford University School of Medicine
New technologies for studying human immunity Lisa Wagar Postdoctoral fellow, Mark Davis lab Stanford University School of Medicine New strategies: Human immunology is ideal for a systems approach We have
More informationDr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory
Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific
More informationMHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery
MHC Tetramers and Monomers for Immuno-Oncology and Autoimmunity Drug Discovery Your Partner in Drug Discovery and Research MHC Tetramer Background T-Cell Receptors recognize and bind to complexes composed
More informationHOST-PARASITE INTERPLAY
HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome
More informationDetection of copy number variations in PCR-enriched targeted sequencing data
Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation
More informationNature Genetics: doi: /ng Supplementary Figure 1. SEER data for male and female cancer incidence from
Supplementary Figure 1 SEER data for male and female cancer incidence from 1975 2013. (a,b) Incidence rates of oral cavity and pharynx cancer (a) and leukemia (b) are plotted, grouped by males (blue),
More informationThe next steps for effective cancer immunotherapy and viral vaccines. Peter Selby FACP(UK)
The next steps for effective cancer immunotherapy and viral vaccines Peter Selby FACP(UK) Richard Alan Steve Sasha Matt Nav Vile Melcher Griffin Zougman Bentham Vasudev Adel Nick Gemma Liz Samson Hornigold
More informationImmunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
More informationDeploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven
Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA
More informationPersonalized Therapy for Prostate Cancer due to Genetic Testings
Personalized Therapy for Prostate Cancer due to Genetic Testings Stephen J. Freedland, MD Professor of Urology Director, Center for Integrated Research on Cancer and Lifestyle Cedars-Sinai Medical Center
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationTP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
More informationFrom Patients to Therapies. How could the BADIPS challenge progress towards improved in vitro models and novel patient therapies?
From Patients to Therapies How could the BADIPS challenge progress towards improved in vitro models and novel patient therapies? 1 Aim of the BADIPS project 2 Overall objective BADIPS project The development
More informationEmerging Tissue and Serum Markers
Emerging Tissue and Serum Markers for Immune Checkpoint Inhibitors Kyong Hwa Park MD, PhD Medical Oncology Korea University College of Medicine Contents Immune checkpoint inhibitors in clinical practice
More informationSupplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationTumor mutational burden and its transition towards the clinic
Tumor mutational burden and its transition towards the clinic G C C A T C A C Wolfram Jochum Institute of Pathology Kantonsspital St.Gallen CH-9007 St.Gallen wolfram.jochum@kssg.ch 30th European Congress
More informationDigitizing the Proteomes From Big Tissue Biobanks
Digitizing the Proteomes From Big Tissue Biobanks Analyzing 24 Proteomes Per Day by Microflow SWATH Acquisition and Spectronaut Pulsar Analysis Jan Muntel 1, Nick Morrice 2, Roland M. Bruderer 1, Lukas
More informationBIOINF 3360 Computational Immunomics
BIOINF 3360 Computational Immunomics Oliver Kohlbacher Summer 2011 11. Summary TYOTK Things you ought to know! Caveat: These are just examples, not the full list of potential ti exam questions! TYOTK:
More informationGrand Challenge and other funding opportunities at Cancer Research UK. Jamie Meredith, 9 th Dec 15
Grand Challenge and other funding opportunities at Cancer Research UK Jamie Meredith, 9 th Dec 15 Multidisciplinary research at CRUK OVERVIEW About CRUK CRUKs research strategy A focus on multidisciplinary
More informationBIOINF 3360 Computational Immunomics
BIOINF 3360 Computational Immunomics Oliver Kohlbacher Summer 2011 11. Summary TYOTK Things you ought to know! Caveat: These are just examples, not the full list of potential exam questions! TYOTK: Immunology
More informationNew Drug development and Personalized Therapy in The Era of Molecular Medicine
New Drug development and Personalized Therapy in The Era of Molecular Medicine Ramesh K. Ramanathan MD Virginia G. Piper Cancer Center Translational Genomics Research Institute Scottsdale, AZ Clinical
More informationProteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor
Proteogenomic analysis of alternative splicing: the search for novel biomarkers for colorectal cancer Gosia Komor Translational Gastrointestinal Oncology Collect clinical samples (Tumor) tissue Blood Stool
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich
ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum
More informationIntroduction to Proteomics 1.0
Introduction to Proteomics 1.0 CMSP Workshop Pratik Jagtap Managing Director, CMSP Objectives Why are we here? For participants: Learn basics of MS-based proteomics Learn what s necessary for success using
More informationVan test naar diagnose naar
Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud
More informationINDIVIDUALIZED MEDICINE
CENTER FOR INDIVIDUALIZED MEDICINE Precision Oncology: Current Applications of omics ACP Arizona Chapter Scientific Meeting, 2014 Arizona State University in Tempe, Arizona Alan Bryce, MD 2012 MFMER slide-1
More informationThe 100,000 Genomes Project
The 100,000 Genomes Project Dr Matina Prapa, Scientific co ordinator Genomics England Clinical Interpretation Partnership William Harvey Research Institute Queen Mary University of London Genomics England
More informationTITLE: High throughput sequencing of germline and tumor from men with early-onset, metastatic prostate cancer
AWARD NUMBER: W81XWH-13-1-0371 TITLE: High throughput sequencing of germline and tumor from men with early-onset, metastatic prostate cancer PRINCIPAL INVESTIGATOR: A. Cooney, M.D. CONTRACTING ORGANIZATION:
More informationIdentification of genomic alterations in cervical cancer biopsies by exome sequencing
Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,
More information