Generation of Function Based Biomarkers in Prostate Cancer. K.C. Balaji, MD Wake Forest University School of Medicine, Winston Salem, NC
|
|
- Annabel Rogers
- 6 years ago
- Views:
Transcription
1 Generation of Function Based Biomarkers in Prostate Cancer K.C. Balaji, MD Wake Forest University School of Medicine, Winston Salem, NC
2 Substance used as an indicator of a biological state Can be used to monitor a normal physiologic state, a pathologic process, a pharmacologic response to therapeutic intervention, or a toxic exposure Examples: antibodies, radioactive isotopes, specific DNA sequences, PSA
3 Phases of Biomarker Development
4 Prostate Specific Antigen (PSA) as Prostate Fig. Specific 1 PSA clinical course Antigen and biomarker uses. (PSA) as a Biomarker in Prostate Cancer Published by AAAS Prensner J R et al. Sci Transl Med 2012;4:127rv3-127rv3
5 CA: A Cancer Journal for Clinicians Volume 62, Issue 1, pages 10-29, 4 JAN 2012 DOI: /caac United States Cancer statistics, 2012
6 Cumulative Hazard of Death from Prostate Cancer among Men 55 to 69 Years of Age. Schröder FH et al. N Engl J Med 2012;366:
7 Number of Diagnoses of All Prostate Cancers (Panel A) and Number of Prostate-Cancer Deaths (Panel B). Andriole GL et al. N Engl J Med 2009;360:
8 Why is PSA Screening for Prostate Cancer Controversial? For starters.psa is NOT a rationale based biomarker
9 Prostate Specific Antigen (hk3) PSA made by prostate tissue benign and malignant tissue Sink effect performance to monitor malignant progression improves when prostate tissue is minimal Serine protease of the human kallikrein family Liquefies the coagulum by acting on semenogellin I & II and Fibronectin Produced as a precursor molecule- the pro-psa
10 HYPOTHESIS Function based biomarkers may demonstrate improved clinical performance characteristics
11 Cancer Phenotype Benign Cells Migration Invasion Proliferation Cancer Cells
12 Cancer Biology - Hallmarks of Cancer Hanahan D, Weinberg RA. 2011
13 OPPORTUNITIES IN PROSTATE OPPORTUNITIES Future challenges and unmet needs in prostate IN cancer PROSTATE biomarker research. CANCER Prensner J R et al. Sci Transl Med 2012;4:127rv3-127rv3 Published by AAAS
14 Metastatic Cascade
15 Castration Resistant Prostate Cancer (CRPC) Schulman et al., European Urology, Vol 58, 1, pages e1 e18, July 2010
16 Differential gene expression The model LNCaP cells Derived from human prostate cancer lymph nodal metastasis Androgen dependent Produce PSA C4-2 cells Derived from LNCaP cells grown in presence of bone stromal cells Low steady state of androgen receptor Androgen independent Highly metastatic and produces osteoblastic lesions / produce PSA Wu et al., Int J Ca, 57, , 1994
17 Differential gene expression Experimental design LNCaP trna C4-2 trna mrna mrna MICROARRAY
18 Protein Kinase D1 (PKD1) is Down Regulated in Advanced Prostate Cancer 1: RPA Data LNCaP C4-2 4: PKD1 - down regulated in advanced human prostate cancer 2: Western Blotting 3: Kinase activity Varambally et al. Cancer Cell 2005 PKD1 is downregulated in breast cancer Eiseler et al. Breast Cancer Res, 2009 and in gastric cancer Kim et al. Carcinogenesis. 2008
19 Protein Kinase D1 (PKD1) Phosphatidylserine, Ca 2+, Diacylglycerol/phorbol ester, ACTIVATORS: - Regulatory peptides (neurotensin, bombesin) - Lysophosphatidic acid, - Thrombin that act through Gq, G12, Gi, and Rho, - Growth factors, such as PDGF and IGF - B/T cell antigen engagement, - Oxidative stress DAG + PKC Tissues and Cells: - Fibroblasts - Intestinal and kidney epithelial cells - Smooth muscle cells - Cardiac myocytes - Neuronal cells - Osteoblasts - B and T lymphocytes, - Mast cells and platelets, - Several human cancers
20 Localization of PKD1 in LNCaP cells 7 DIC PKD1 A MERGE B C LNCaP cells were stained with antibody specific for PKD1 (A) is DIC image (B) is showing immunolocalization of PKD1. (C) is merge of image (A) and (B) showing perinuclear and junctional staining ( Jaggi et al., 2003).
21 Epithelial cells microvilli tight junction adherens junction band of actin filaments desmosome keratin filaments gap junction hemi-desmosome basal lamina Molecular Biology of the Cell 3rd Edition, Figure 19-18
22 Cadherin Catenin Protein Complex p120 ctn Cadherin ZO-1 β-catenin/ plakoglobin α-catenin vinculin α-actinin Actin filaments Wheelock et al. Current Topics in Membranes (1996)
23 LNCaP PKD1 interacts and phosphorylates E-cadherin
24 PKD-1 and E-Cadherin regulate PC cells proliferation and soft agar colony formation
25 PKD-1 and E-Cadherin regulate PC cells proliferation and soft agar colony formation Corroboration with molecular markers
26 β-catenin mediates the PKD1 and E-cadherin functions in PC cells
27 Cadherin Catenin Protein Complex p120 ctn Cadherin ZO-1 β-catenin/ plakoglobin α-catenin vinculin α-actinin Actin filaments Wheelock et al. Current Topics in Membranes (1996)
28 PKD1 promotes β-catenin membrane trafficking
29 PKD1 is associated with membrane trafficking of β-catenin
30 C4-2 C4-2/PKD1 C4-2 C4-2/PKD1 PKD1 phosphorylates β-catenin at Thr120 active PKD dead PKD autoradio graph Staining Raamfp etldegmqip stqfdaahpt nvqr C4-2/PKD1 3T3 - + Bryostatin WT pt120 β-catenin total β-catenin ps916 PKD1 total PKD1 C4-2/PKD1 T102I /T112R /T120I T120I β-catenin α-catenin pt120 H102 pt pt normal peptide phosphopeptide Total β catenine (α HA tag) β-cat H102 Ab p230 β-cat pt120 Ab p230
31 Active Beta-catenin (unphosphorylated S37/T41) in the Nucleus Maher et al., PLoS One. 2010; 5(4): e10184
32 PKD1 represses generation of ABC
33 Table 1. Analysis of pt120 antibody staining in prostate cancer TransGolgi network staining Two-sample t test (P value) n positive (%) negative (%) Normal vs. tumor Gleason 3-6 vs Normal (72.7%) 6 (27.3%) Total tumor (7.5%) 185 (92.5%) P<0.01 Gleason (14.8%) 23 (85.2%) (6.3%) 162 (93.7%) P<0.05 Table 2. Comparison of H102 and pt120 staining patterns Normal tissue membranous β-catenin 9 8 (88.9%) Total H102 staining pt120 staining TGN β-catenin 9 8 (88.9%) Tumor tissue increased expression (32.1%) 9 (16.1%) decreased expression 56 5 (8.9%) 5 (8.9%) membranous (77.8%) 8 (14.3%) cytoplasma/nuclear (22.2%) 6 (10.7%)
34 E-cadherin and Beta-catenin Expression are Down Regulated in High Risk Prostate Cancer (6F9 monoclonal anti-beta catenin COOH terminal antibody) E-cadh Beta-cat PIN Nuc-Beta Cat
35 TGN staining of pt120 Beta- catenin antibody
36 OPPORTUNITIES Phospho-specific specific Beta-catenin characterize functional changes in cells Understanding post-translational translational modifications and implications on biological functions can facilitate development of rationale based biomarkers HYPOTHESIS: : Generation of function based biomarkers will improve performance characteristics of biomarkers in clinical setting
37 Acknowledgements Mentors, Staff and Colleagues University of Nebraska Medical Center, Omaha, NE University of Massachusetts Medical School, Worcester, MA Wake Forest University School of Medicine, Winston Salem, NC Funding: DoD, VA, Prostate Cancer Foundation Univ of Neb Med Ctr, UMass Med Sch, Wake Forest Univ Sch of Med Cancer Center, WFU Institute of Regen Med
38 References 1. Cheng Du, Chuanyou Zhang, Zhuo Li, Md. Helal Uddin Biswas and K.C. Balaji: β-catenin Phosphorylated at Threonine 120 Antagonizes Generation of Active β-catenin by Spatial Localization at Trans-Golgi Network. PLoS One. 2012;7(4):e Epub 2012 Apr Cheng Du, Chuanyou Zhang, Sazzad Hassan, Md Helal Uddin Biswas and K.C. Balaji: Protein Kinase D1 Suppresses Epithelial to Mesenchymal Transition through Phosphorylation horylation of Snail. Cancer Research; 2010 Oct 15;70(20): Epub 2010 Oct Md Helal Uddin Biswas,, Cheng Du, Chuanyou Zhang, Juerg Straubhaar,, Lucia R. Languino and K.C. Balaji: Protein Kinase D1 Inhibits Cell Proliferation through Matrix M Metalloproteinases (MMP) -22 and -9 Secretion in Prostate Cancer. Cancer Research, 2010 Mar 1;70(5): Epub 2010 Feb Sazzad Hassan, Md. Helal Uddin Biswas and K.C. Balaji: Heat Shock Protein 27 Mediates Repression of Androgen Receptor Function by Protein Kinase D1 in Prostate Cancer C Cells: Oncogene Dec 10;28(49): PMID: Cheng Du, Meena Jaggi, Chuanyou Zhang and K.C. Balaji; Protein Kinase D1 (PKD1) Mediated Phosphorylation and Subcellular Localization of β-catenin: Cancer Res 2009; 69: (3).February 1, Du, C., et al., Protein kinase D1-mediated phosphorylation and subcellular localization of beta-catenin. Cancer Res, (3): p Jaggi,, M., et al., Bryostatin 1 modulates beta-catenin subcellular localization and transcription activity through protein kinase D1 activation. Mol Cancer Ther,, (9): p Mak,, P., et al., Protein kinase D1 (PKD1) influences androgen receptor (AR) function in prostate cancer cells. Biochem Biophys Res Commun,, (4): p Syed,, V., et al., Beta-catenin mediates alteration in cell proliferation, motility and invasion of prostate cancer cells by differential expression of E-cadherin E and protein kinase D1. J Cell Biochem,, (1): p Jaggi,, M., et al., Protein kinase D1: a protein of emerging translational interest. Front Biosci,, : p Jaggi,, M., et al., E-cadherin phosphorylation by protein kinase D1/protein kinase C{mu} } is associated with altered cellular aggregation and motility in prostate cancer. Cancer Res, (2): p Rao,, P.S., et al., Metallothionein 2A interacts with the kinase domain of PKCmu in prostate cancer. Biochem Biophys Res Commun,, (3): p Jaggi,, M., et al., Protein kinase C mu is down-regulated in androgen-independent prostate cancer. Biochem Biophys Res Commun,, (2): p
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-05-1-0045 TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer PRINCIPAL INVESTIGATOR: Kethandapatti Balaji, M.D. CONTRACTING ORGANIZATION:
More informationCHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent
CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.
More informationAD (Leave blank) TITLE: Modulation of Beta-catenin activity with PKD1 in Prostate Cancer
AD (Leave blank) Award Number: W81XWH-08-1-0232 TITLE: Modulation of Beta-catenin activity with PKD1 in Prostate Cancer PRINCIPAL INVESTIGATOR: Meena Jaggi, Ph.D. CONTRACTING ORGANIZATION: Sanford Research
More informationBeta-catenin phosphorylated at threonine 120 antagonizes generation of active beta-catenin by spatial localization in trans-golgi network
University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 4-12-2012 Beta-catenin phosphorylated at threonine 120 antagonizes generation
More informationIn vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)
In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%
More informationNegative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
More informationSynthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
More informationCell Polarity and Cancer
Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways
More informationCancer Biology Course. Invasion and Metastasis
Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationPhospho-AKT Sampler Kit
Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older
More informationTITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
More informationACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationTumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.
Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications
More informationAlan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region
Identification and Characterization of Stem-like Cells in Human Esophageal Adenocarcinoma and Normal Epithelial Cell Lines No disclosures / conflict of interest Alan G. Casson FRCSC Professor of Surgery
More informationNeoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
More informationTHE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
More informationCell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01
Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. For multiple choice questions,
More informationThe Hallmarks of Cancer
The Hallmarks of Cancer Theresa L. Hodin, Ph.D. Clinical Research Services Theresa.Hodin@RoswellPark.org Hippocrates Cancer surgery, circa 1689 Cancer Surgery Today 1971: Nixon declares War on Cancer
More informationTitle: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics
Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Introduction: Prostate-specific antigen (PSA) is a serine protease produced in the prostate and secreted into ejaculate and blood.
More informationTITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
More informationThe splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer
The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department
More informationCELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.
!! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationBiochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval
Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult
More informationAnimal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari
Animal Tissue Culture SQG 3242 Biology of Cultured Cells Dr. Siti Pauliena Mohd Bohari The Culture Environment Changes of Cell s microenvironment needed that favor the spreading, migration, and proliferation
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationPathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
More informationTargeting the cgmp Pathway to Treat Colorectal Cancer
Thomas Jefferson University Jefferson Digital Commons Department of Pharmacology and Experimental Therapeutics Faculty Papers Department of Pharmacology and Experimental Therapeutics 29 Targeting the cgmp
More informationFundamental research on breast cancer in Belgium. Rosita Winkler
Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -
More informationTumor Associated Macrophages as a Novel Target for Cancer Therapy
Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations
More informationImpact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach
Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical
More informationIntercellular indirect communication
Intercellular indirect communication transmission of chemical signals: sending cell signal transmitting tissue hormone medium receiving cell hormone intercellular fluid blood neurocrine neurotransmitter
More informationnumber Done by Corrected by Doctor Maha Shomaf
number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:
More informationsupplementary information
DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#5:(October-18-2010) Cancer and Signals Outline 1 2 Outline 1 2 Cancer is a disease of malfunctioning cells. Cell Lineage: Adult
More informationEMT: Epithelial Mesenchimal Transition
EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationTITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer
AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health
More informationTITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer
AD Award Number: W81XWH-05-1-0045 TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer PRINCIPAL INVESTIGATOR: Balaji C. Kethandapatti, M.D., FRCS Meena
More informationSupplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University
More informationAdvanced Cell Biology. Lecture 36
Advanced Cell Biology. Lecture 36 Alexey Shipunov Minot State University May 3, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 36 May 3, 2013 1 / 43 Outline Questions and answers Cellular communities
More informationGrowth and Differentiation Phosphorylation Sampler Kit
Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationUnit I Problem 9 Histology: Basic Tissues of The Body
Unit I Problem 9 Histology: Basic Tissues of The Body - What is the difference between cytology and histology? Cytology: it is the study of the structure and functions of cells and their contents. Histology:
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationFGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-14-1-0505 TITLE: Targeting the Neural Microenvironment in Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Ittmann MD PhD CONTRACTING ORGANIZATION: BAYLOR COLLEGE OF MEDICINE HOUSTON,
More informationSimplify the relations between genes and diseases into typed binary relations. PubMed BioText GoPubMed
Simplify the relations between genes and diseases into typed binary relations PubMed BioText GoPubMed biological events An example sentence Gene Expression and Cancer We conclude that MMP-7 over-expression
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
Award Number: W81XWH-141-0154 TITLE: A Novel Therapeutic Modality for Advanced-Stage Prostate Cancer Treatment PRINCIPAL INVESTIGATOR: Subhash C. Chauhan CONTRACTING ORGANIZATION: University of Tennessee
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationTITLE: Breast Tumor-Generated Type 1 Collagen Breakdown Fragments Act as Matrikines to Drive Osteolysis
AD Award Number: W81XWH-08-1-0639 TITLE: Breast Tumor-Generated Type 1 Collagen Breakdown Fragments Act as Matrikines to Drive Osteolysis PRINCIPAL INVESTIGATOR: Ching Hua William Wu PhD. CONTRACTING ORGANIZATION:
More informationClaudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression
Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationProtein Biomarker Biomarker Discover y y in Organ Organ Transplantation A A Proteomics Proteomics Approach Tara r Sig del, Sig PhD 9/26/2011
Protein Biomarker Discovery in Organ Transplantation A Proteomics Approach Tara Sigdel, PhD 9/26/2011 Presented at the 2011 Stanford Mass Spectrometry Users Meeting For personal use only. Please do not
More informationThe Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway in Prostate Cancer
Grand Valley State University ScholarWorks@GVSU Masters Theses Graduate Research and Creative Practice 4-27-2017 The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway
More informationCONTRACTING ORGANIZATION: Vanderbilt University Medical Center Nashville, TN
AD Award Number: W81XWH-04-1-0867 TITLE: A Myc-Driven in Vivo Model of Human Prostate Cancer PRINCIPAL INVESTIGATOR: Simon W. Hayward, Ph.D. CONTRACTING ORGANIZATION: Vanderbilt University Medical Center
More informationPATHOBIOLOGY OF NEOPLASIA
PATHOBIOLOGY OF NEOPLASIA Department of Pathology Gadjah Mada University School of Medicine dr. Harijadi Blok Biomedis, 6 Maret 2009 [12] 3/17/2009 1 The pathobiology of neoplasia Normal cells Malignant
More informationFAM83H and casein kinase I regulate the organization of. the keratin cytoskeleton and formation of desmosomes
FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes Takahisa Kuga, Mitsuho Sasaki, Toshinari Mikami, Yasuo Miake, Jun Adachi, Maiko Shimizu, Youhei
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationMolecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
More informationDr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo
Integration of Cells into Tissues Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Hospital Lahore 1. How
More informationManagement of Incurable Prostate Cancer in 2014
Management of Incurable Prostate Cancer in 2014 Julie N. Graff, MD, MCR Portland VA Medical Center Assistant Professor of Medicine Knight Cancer Institute, OHSU 2014: Cancer Estimates Stage at Diagnosis
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationSignal Transduction Pathway Smorgasbord
Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.
More informationInflammatory Cells and Metastasis
Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University
More informationsupplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
More informationDETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER
665 J App Pharm 03(04): 655-669; October, 2012 Andreas et al., 2012 Short Communication DETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER E.Andreas 1,2,3, Ali Mujahid 1,3, Attia Youssef 1,
More informationSrc-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
More informationElderly men with prostate cancer + ADT
Elderly men with prostate cancer + ADT Background and Rationale ADT and Osteoporosis Proportion of Patients With Fractures 1-5 Yrs After Cancer Diagnosis 21 18 +6.8%; P
More informationChapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary
More informationTumor Microenvironment and Immune Suppression
Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation
More informationTissues Review 4 type
Tissues Review 4 type Tissues Definition: a group of closely associated cells that perform related functions and are similar in structure Between cells: nonliving extracellular material Four basic types
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC
Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationDoes EMT Contribute to Radiation Resistance in Human Breast Cancer?
AD Award Number: W81XWH-10-1-0592 TITLE: Does EMT Contribute to Radiation Resistance in Human Breast Cancer? PRINCIPAL INVESTIGATOR: Anupama Munshi, Ph.D CONTRACTING ORGANIZATION: University of Oklahoma
More informationHereditary Prostate Cancer: From Gene Discovery to Clinical Implementation
Hereditary Prostate Cancer: From Gene Discovery to Clinical Implementation Kathleen A. Cooney, MD MACP Duke University School of Medicine Duke Cancer Institute (No disclosures to report) Overview Prostate
More informationMicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
More informationTop 10 Contributions on Biomedical Sciences: 2nd Edition. St Vincent s Hospital, The University of Melbourne, Australia 2
Chapter 06 Cancer Progression: The Impact of Cytoskeletal Molecules Sam L Francis 1 and Juliana Antonipillai 2 * 1 St Vincent s Hospital, The University of Melbourne, Australia 2 School of Health and Biomedical
More informationAditi Gupta 1, Wei Cao 2 and Meenakshi A Chellaiah 1*
Gupta et al. Molecular Cancer 2012, 11:66 RESEARCH Open Access Integrin αvβ3 and CD44 pathways in metastatic prostate cancer cells support osteoclastogenesis via a Runx2/Smad 5/receptor activator of NF-κB
More informationMolecular and genetic analysis of stromal fibroblasts in prostate cancer
Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,
More informationPIP 2 + PIP 2. MCB3m CS5 Membrane cytoskeletal Interactions S.K.Maciver Feb, 2001
MB3m S5 Membrane cytoskeletal Interactions S.K.Maciver Feb, 2001 Membrane ytoskeleton Interactions S5 The cytoskeleton, especially the actin cytoskeleton interacts with cell membranes. The cell cortex
More informationAP: CELL CYCLE REGULATION
AP: CELL CYCLE REGULATION CELL CYCLE 2 crucial factors for normal growth: Timing and rate of cell division Cell division frequency depends on cell type: skin cells: frequently Liver cells: can divide when
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
More informationCancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013
Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40
More informationIJC International Journal of Cancer
IJC International Journal of Cancer Steps in prostate cancer progression that lead to bone metastasis Jung-Kang Jin 1,2, Farshid Dayyani 1 and Gary E. Gallick 1,2 1 Department of Genitourinary Medical
More information2. Epithelial Tissues Dr. Manal Othman
Biology-232 GENERAL HISTOLOGY 2. Epithelial Tissues Dr. Manal Othman Anatomy Department CMMS, AGU HISTOLOGY: w Study of the structure and function of tissues and organs at the microscopic levels. w Tissues
More informationCONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033
AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California
More informationProstate cancer (PCa) is a malignant tumor common
UROLOGICAL ONCOLOGY Evaluation of Vitronectin Expression in Prostate Cancer and the Clinical Significance of the Association of Vitronectin Expression with Prostate Specific Antigen in Detecting Prostate
More informationWhat is on the Horizon in Drug Therapy for OAB?
What is on the Horizon in Drug Therapy for OAB? K-E Andersson, MD, PhD Wake Forest Institute for Regenerative Medicine Wake Forest University School of Medicine Winston Salem, North Carolina Disclosures
More informationTITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K
AD Award Number: W81XWH-07-1-0028 TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K PRINCIPAL INVESTIGATOR: Jian Zhang, M.D., Ph.D. CONTRACTING ORGANIZATION: University
More information