Generation of Function Based Biomarkers in Prostate Cancer. K.C. Balaji, MD Wake Forest University School of Medicine, Winston Salem, NC

Size: px
Start display at page:

Download "Generation of Function Based Biomarkers in Prostate Cancer. K.C. Balaji, MD Wake Forest University School of Medicine, Winston Salem, NC"

Transcription

1 Generation of Function Based Biomarkers in Prostate Cancer K.C. Balaji, MD Wake Forest University School of Medicine, Winston Salem, NC

2 Substance used as an indicator of a biological state Can be used to monitor a normal physiologic state, a pathologic process, a pharmacologic response to therapeutic intervention, or a toxic exposure Examples: antibodies, radioactive isotopes, specific DNA sequences, PSA

3 Phases of Biomarker Development

4 Prostate Specific Antigen (PSA) as Prostate Fig. Specific 1 PSA clinical course Antigen and biomarker uses. (PSA) as a Biomarker in Prostate Cancer Published by AAAS Prensner J R et al. Sci Transl Med 2012;4:127rv3-127rv3

5 CA: A Cancer Journal for Clinicians Volume 62, Issue 1, pages 10-29, 4 JAN 2012 DOI: /caac United States Cancer statistics, 2012

6 Cumulative Hazard of Death from Prostate Cancer among Men 55 to 69 Years of Age. Schröder FH et al. N Engl J Med 2012;366:

7 Number of Diagnoses of All Prostate Cancers (Panel A) and Number of Prostate-Cancer Deaths (Panel B). Andriole GL et al. N Engl J Med 2009;360:

8 Why is PSA Screening for Prostate Cancer Controversial? For starters.psa is NOT a rationale based biomarker

9 Prostate Specific Antigen (hk3) PSA made by prostate tissue benign and malignant tissue Sink effect performance to monitor malignant progression improves when prostate tissue is minimal Serine protease of the human kallikrein family Liquefies the coagulum by acting on semenogellin I & II and Fibronectin Produced as a precursor molecule- the pro-psa

10 HYPOTHESIS Function based biomarkers may demonstrate improved clinical performance characteristics

11 Cancer Phenotype Benign Cells Migration Invasion Proliferation Cancer Cells

12 Cancer Biology - Hallmarks of Cancer Hanahan D, Weinberg RA. 2011

13 OPPORTUNITIES IN PROSTATE OPPORTUNITIES Future challenges and unmet needs in prostate IN cancer PROSTATE biomarker research. CANCER Prensner J R et al. Sci Transl Med 2012;4:127rv3-127rv3 Published by AAAS

14 Metastatic Cascade

15 Castration Resistant Prostate Cancer (CRPC) Schulman et al., European Urology, Vol 58, 1, pages e1 e18, July 2010

16 Differential gene expression The model LNCaP cells Derived from human prostate cancer lymph nodal metastasis Androgen dependent Produce PSA C4-2 cells Derived from LNCaP cells grown in presence of bone stromal cells Low steady state of androgen receptor Androgen independent Highly metastatic and produces osteoblastic lesions / produce PSA Wu et al., Int J Ca, 57, , 1994

17 Differential gene expression Experimental design LNCaP trna C4-2 trna mrna mrna MICROARRAY

18 Protein Kinase D1 (PKD1) is Down Regulated in Advanced Prostate Cancer 1: RPA Data LNCaP C4-2 4: PKD1 - down regulated in advanced human prostate cancer 2: Western Blotting 3: Kinase activity Varambally et al. Cancer Cell 2005 PKD1 is downregulated in breast cancer Eiseler et al. Breast Cancer Res, 2009 and in gastric cancer Kim et al. Carcinogenesis. 2008

19 Protein Kinase D1 (PKD1) Phosphatidylserine, Ca 2+, Diacylglycerol/phorbol ester, ACTIVATORS: - Regulatory peptides (neurotensin, bombesin) - Lysophosphatidic acid, - Thrombin that act through Gq, G12, Gi, and Rho, - Growth factors, such as PDGF and IGF - B/T cell antigen engagement, - Oxidative stress DAG + PKC Tissues and Cells: - Fibroblasts - Intestinal and kidney epithelial cells - Smooth muscle cells - Cardiac myocytes - Neuronal cells - Osteoblasts - B and T lymphocytes, - Mast cells and platelets, - Several human cancers

20 Localization of PKD1 in LNCaP cells 7 DIC PKD1 A MERGE B C LNCaP cells were stained with antibody specific for PKD1 (A) is DIC image (B) is showing immunolocalization of PKD1. (C) is merge of image (A) and (B) showing perinuclear and junctional staining ( Jaggi et al., 2003).

21 Epithelial cells microvilli tight junction adherens junction band of actin filaments desmosome keratin filaments gap junction hemi-desmosome basal lamina Molecular Biology of the Cell 3rd Edition, Figure 19-18

22 Cadherin Catenin Protein Complex p120 ctn Cadherin ZO-1 β-catenin/ plakoglobin α-catenin vinculin α-actinin Actin filaments Wheelock et al. Current Topics in Membranes (1996)

23 LNCaP PKD1 interacts and phosphorylates E-cadherin

24 PKD-1 and E-Cadherin regulate PC cells proliferation and soft agar colony formation

25 PKD-1 and E-Cadherin regulate PC cells proliferation and soft agar colony formation Corroboration with molecular markers

26 β-catenin mediates the PKD1 and E-cadherin functions in PC cells

27 Cadherin Catenin Protein Complex p120 ctn Cadherin ZO-1 β-catenin/ plakoglobin α-catenin vinculin α-actinin Actin filaments Wheelock et al. Current Topics in Membranes (1996)

28 PKD1 promotes β-catenin membrane trafficking

29 PKD1 is associated with membrane trafficking of β-catenin

30 C4-2 C4-2/PKD1 C4-2 C4-2/PKD1 PKD1 phosphorylates β-catenin at Thr120 active PKD dead PKD autoradio graph Staining Raamfp etldegmqip stqfdaahpt nvqr C4-2/PKD1 3T3 - + Bryostatin WT pt120 β-catenin total β-catenin ps916 PKD1 total PKD1 C4-2/PKD1 T102I /T112R /T120I T120I β-catenin α-catenin pt120 H102 pt pt normal peptide phosphopeptide Total β catenine (α HA tag) β-cat H102 Ab p230 β-cat pt120 Ab p230

31 Active Beta-catenin (unphosphorylated S37/T41) in the Nucleus Maher et al., PLoS One. 2010; 5(4): e10184

32 PKD1 represses generation of ABC

33 Table 1. Analysis of pt120 antibody staining in prostate cancer TransGolgi network staining Two-sample t test (P value) n positive (%) negative (%) Normal vs. tumor Gleason 3-6 vs Normal (72.7%) 6 (27.3%) Total tumor (7.5%) 185 (92.5%) P<0.01 Gleason (14.8%) 23 (85.2%) (6.3%) 162 (93.7%) P<0.05 Table 2. Comparison of H102 and pt120 staining patterns Normal tissue membranous β-catenin 9 8 (88.9%) Total H102 staining pt120 staining TGN β-catenin 9 8 (88.9%) Tumor tissue increased expression (32.1%) 9 (16.1%) decreased expression 56 5 (8.9%) 5 (8.9%) membranous (77.8%) 8 (14.3%) cytoplasma/nuclear (22.2%) 6 (10.7%)

34 E-cadherin and Beta-catenin Expression are Down Regulated in High Risk Prostate Cancer (6F9 monoclonal anti-beta catenin COOH terminal antibody) E-cadh Beta-cat PIN Nuc-Beta Cat

35 TGN staining of pt120 Beta- catenin antibody

36 OPPORTUNITIES Phospho-specific specific Beta-catenin characterize functional changes in cells Understanding post-translational translational modifications and implications on biological functions can facilitate development of rationale based biomarkers HYPOTHESIS: : Generation of function based biomarkers will improve performance characteristics of biomarkers in clinical setting

37 Acknowledgements Mentors, Staff and Colleagues University of Nebraska Medical Center, Omaha, NE University of Massachusetts Medical School, Worcester, MA Wake Forest University School of Medicine, Winston Salem, NC Funding: DoD, VA, Prostate Cancer Foundation Univ of Neb Med Ctr, UMass Med Sch, Wake Forest Univ Sch of Med Cancer Center, WFU Institute of Regen Med

38 References 1. Cheng Du, Chuanyou Zhang, Zhuo Li, Md. Helal Uddin Biswas and K.C. Balaji: β-catenin Phosphorylated at Threonine 120 Antagonizes Generation of Active β-catenin by Spatial Localization at Trans-Golgi Network. PLoS One. 2012;7(4):e Epub 2012 Apr Cheng Du, Chuanyou Zhang, Sazzad Hassan, Md Helal Uddin Biswas and K.C. Balaji: Protein Kinase D1 Suppresses Epithelial to Mesenchymal Transition through Phosphorylation horylation of Snail. Cancer Research; 2010 Oct 15;70(20): Epub 2010 Oct Md Helal Uddin Biswas,, Cheng Du, Chuanyou Zhang, Juerg Straubhaar,, Lucia R. Languino and K.C. Balaji: Protein Kinase D1 Inhibits Cell Proliferation through Matrix M Metalloproteinases (MMP) -22 and -9 Secretion in Prostate Cancer. Cancer Research, 2010 Mar 1;70(5): Epub 2010 Feb Sazzad Hassan, Md. Helal Uddin Biswas and K.C. Balaji: Heat Shock Protein 27 Mediates Repression of Androgen Receptor Function by Protein Kinase D1 in Prostate Cancer C Cells: Oncogene Dec 10;28(49): PMID: Cheng Du, Meena Jaggi, Chuanyou Zhang and K.C. Balaji; Protein Kinase D1 (PKD1) Mediated Phosphorylation and Subcellular Localization of β-catenin: Cancer Res 2009; 69: (3).February 1, Du, C., et al., Protein kinase D1-mediated phosphorylation and subcellular localization of beta-catenin. Cancer Res, (3): p Jaggi,, M., et al., Bryostatin 1 modulates beta-catenin subcellular localization and transcription activity through protein kinase D1 activation. Mol Cancer Ther,, (9): p Mak,, P., et al., Protein kinase D1 (PKD1) influences androgen receptor (AR) function in prostate cancer cells. Biochem Biophys Res Commun,, (4): p Syed,, V., et al., Beta-catenin mediates alteration in cell proliferation, motility and invasion of prostate cancer cells by differential expression of E-cadherin E and protein kinase D1. J Cell Biochem,, (1): p Jaggi,, M., et al., Protein kinase D1: a protein of emerging translational interest. Front Biosci,, : p Jaggi,, M., et al., E-cadherin phosphorylation by protein kinase D1/protein kinase C{mu} } is associated with altered cellular aggregation and motility in prostate cancer. Cancer Res, (2): p Rao,, P.S., et al., Metallothionein 2A interacts with the kinase domain of PKCmu in prostate cancer. Biochem Biophys Res Commun,, (3): p Jaggi,, M., et al., Protein kinase C mu is down-regulated in androgen-independent prostate cancer. Biochem Biophys Res Commun,, (2): p

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-05-1-0045 TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer PRINCIPAL INVESTIGATOR: Kethandapatti Balaji, M.D. CONTRACTING ORGANIZATION:

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

AD (Leave blank) TITLE: Modulation of Beta-catenin activity with PKD1 in Prostate Cancer

AD (Leave blank) TITLE: Modulation of Beta-catenin activity with PKD1 in Prostate Cancer AD (Leave blank) Award Number: W81XWH-08-1-0232 TITLE: Modulation of Beta-catenin activity with PKD1 in Prostate Cancer PRINCIPAL INVESTIGATOR: Meena Jaggi, Ph.D. CONTRACTING ORGANIZATION: Sanford Research

More information

Beta-catenin phosphorylated at threonine 120 antagonizes generation of active beta-catenin by spatial localization in trans-golgi network

Beta-catenin phosphorylated at threonine 120 antagonizes generation of active beta-catenin by spatial localization in trans-golgi network University of Massachusetts Medical School escholarship@umms Open Access Articles Open Access Publications by UMMS Authors 4-12-2012 Beta-catenin phosphorylated at threonine 120 antagonizes generation

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α

Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,

More information

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine

More information

Cell Polarity and Cancer

Cell Polarity and Cancer Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

More information

Cancer Biology Course. Invasion and Metastasis

Cancer Biology Course. Invasion and Metastasis Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

Phospho-AKT Sampler Kit

Phospho-AKT Sampler Kit Phospho-AKT Sampler Kit E 0 5 1 0 0 3 Kits Includes Cat. Quantity Application Reactivity Source Akt (Ab-473) Antibody E021054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit Akt (Phospho-Ser473) Antibody

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older

More information

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University

More information

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/Beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer

VIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad

More information

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D. Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications

More information

Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region

Alan G. Casson FRCSC Professor of Surgery & VP Integrated Health Services University of Saskatchewan & Saskatoon Health Region Identification and Characterization of Stem-like Cells in Human Esophageal Adenocarcinoma and Normal Epithelial Cell Lines No disclosures / conflict of interest Alan G. Casson FRCSC Professor of Surgery

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

THE HALLMARKS OF CANCER

THE HALLMARKS OF CANCER THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated

More information

Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01

Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Cell Biology (BIOL 4374 and BCHS 4313) Third Exam 4/24/01 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. For multiple choice questions,

More information

The Hallmarks of Cancer

The Hallmarks of Cancer The Hallmarks of Cancer Theresa L. Hodin, Ph.D. Clinical Research Services Theresa.Hodin@RoswellPark.org Hippocrates Cancer surgery, circa 1689 Cancer Surgery Today 1971: Nixon declares War on Cancer

More information

Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics

Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Title: The Use of Prostate-Specific Antigen in Prostate Cancer Diagnostics Introduction: Prostate-specific antigen (PSA) is a serine protease produced in the prostate and secreted into ejaculate and blood.

More information

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,

More information

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department

More information

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES.

CELL BIOLOGY - CLUTCH CH CELL JUNCTIONS AND TISSUES. !! www.clutchprep.com CONCEPT: CELL-CELL ADHESION Cells must be able to bind and interact with nearby cells in order to have functional and strong tissues Cells can in two main ways - Homophilic interactions

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult

More information

Animal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari

Animal Tissue Culture SQG 3242 Biology of Cultured Cells. Dr. Siti Pauliena Mohd Bohari Animal Tissue Culture SQG 3242 Biology of Cultured Cells Dr. Siti Pauliena Mohd Bohari The Culture Environment Changes of Cell s microenvironment needed that favor the spreading, migration, and proliferation

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Pathologic Stage. Lymph node Stage

Pathologic Stage. Lymph node Stage ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)

More information

Targeting the cgmp Pathway to Treat Colorectal Cancer

Targeting the cgmp Pathway to Treat Colorectal Cancer Thomas Jefferson University Jefferson Digital Commons Department of Pharmacology and Experimental Therapeutics Faculty Papers Department of Pharmacology and Experimental Therapeutics 29 Targeting the cgmp

More information

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium. Rosita Winkler Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

More information

Tumor Associated Macrophages as a Novel Target for Cancer Therapy

Tumor Associated Macrophages as a Novel Target for Cancer Therapy Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations

More information

Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach

Impact of NM23-M1 knock-out on metastatic potential of hepatocellular carcinoma: a transgenic approach Impact of NM23-M1 "knock-out" on metastatic potential of hepatocellular carcinoma: a transgenic approach NM23-M1 "knock- out" mice (without NDPK A) Experimental models of hepatocarcinogenesis Chemical

More information

Intercellular indirect communication

Intercellular indirect communication Intercellular indirect communication transmission of chemical signals: sending cell signal transmitting tissue hormone medium receiving cell hormone intercellular fluid blood neurocrine neurotransmitter

More information

number Done by Corrected by Doctor Maha Shomaf

number Done by Corrected by Doctor Maha Shomaf number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:

More information

supplementary information

supplementary information DOI: 10.1038/ncb2133 Figure S1 Actomyosin organisation in human squamous cell carcinoma. (a) Three examples of actomyosin organisation around the edges of squamous cell carcinoma biopsies are shown. Myosin

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#5:(October-18-2010) Cancer and Signals Outline 1 2 Outline 1 2 Cancer is a disease of malfunctioning cells. Cell Lineage: Adult

More information

EMT: Epithelial Mesenchimal Transition

EMT: Epithelial Mesenchimal Transition EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer

TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer AD Award Number: W81XWH-6-1-64 TITLE: The Role of HOX Proteins in Androgen-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Sunshine Daddario, B.A. CONTRACTING ORGANIZATION: University of Colorado Health

More information

TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer

TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer AD Award Number: W81XWH-05-1-0045 TITLE: MT 2A Phosphorylation by PKC Mu/PKD Influences Chemosensitivity to Cisplatin in Prostate Cancer PRINCIPAL INVESTIGATOR: Balaji C. Kethandapatti, M.D., FRCS Meena

More information

Supplementary Material

Supplementary Material Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-12-1-0212 TITLE: Wnt/beta-Catenin, Foxa2, and CXCR4 Axis Controls Prostate Cancer Progression PRINCIPAL INVESTIGATOR: Xiuping Yu CONTRACTING ORGANIZATION: Vanderbilt University

More information

Advanced Cell Biology. Lecture 36

Advanced Cell Biology. Lecture 36 Advanced Cell Biology. Lecture 36 Alexey Shipunov Minot State University May 3, 2013 Shipunov (MSU) Advanced Cell Biology. Lecture 36 May 3, 2013 1 / 43 Outline Questions and answers Cellular communities

More information

Growth and Differentiation Phosphorylation Sampler Kit

Growth and Differentiation Phosphorylation Sampler Kit Growth and Differentiation Phosphorylation Sampler Kit E 0 5 1 0 1 4 Kits Includes Cat. Quantity Application Reactivity Source Akt (Phospho-Ser473) E011054-1 50μg/50μl IHC, WB Human, Mouse, Rat Rabbit

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Unit I Problem 9 Histology: Basic Tissues of The Body

Unit I Problem 9 Histology: Basic Tissues of The Body Unit I Problem 9 Histology: Basic Tissues of The Body - What is the difference between cytology and histology? Cytology: it is the study of the structure and functions of cells and their contents. Histology:

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

FGL2 A new biomarker for cancer in a simple blood test

FGL2 A new biomarker for cancer in a simple blood test FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-14-1-0505 TITLE: Targeting the Neural Microenvironment in Prostate Cancer PRINCIPAL INVESTIGATOR: Michael Ittmann MD PhD CONTRACTING ORGANIZATION: BAYLOR COLLEGE OF MEDICINE HOUSTON,

More information

Simplify the relations between genes and diseases into typed binary relations. PubMed BioText GoPubMed

Simplify the relations between genes and diseases into typed binary relations. PubMed BioText GoPubMed Simplify the relations between genes and diseases into typed binary relations PubMed BioText GoPubMed biological events An example sentence Gene Expression and Cancer We conclude that MMP-7 over-expression

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland Award Number: W81XWH-141-0154 TITLE: A Novel Therapeutic Modality for Advanced-Stage Prostate Cancer Treatment PRINCIPAL INVESTIGATOR: Subhash C. Chauhan CONTRACTING ORGANIZATION: University of Tennessee

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

TITLE: Breast Tumor-Generated Type 1 Collagen Breakdown Fragments Act as Matrikines to Drive Osteolysis

TITLE: Breast Tumor-Generated Type 1 Collagen Breakdown Fragments Act as Matrikines to Drive Osteolysis AD Award Number: W81XWH-08-1-0639 TITLE: Breast Tumor-Generated Type 1 Collagen Breakdown Fragments Act as Matrikines to Drive Osteolysis PRINCIPAL INVESTIGATOR: Ching Hua William Wu PhD. CONTRACTING ORGANIZATION:

More information

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression

Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Claudin-4 Expression in Triple Negative Breast Cancer: Correlation with Androgen Receptors and Ki-67 Expression Mona A. Abd-Elazeem, Marwa A. Abd- Elazeem Pathology department, Faculty of Medicine, Tanta

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Protein Biomarker Biomarker Discover y y in Organ Organ Transplantation A A Proteomics Proteomics Approach Tara r Sig del, Sig PhD 9/26/2011

Protein Biomarker Biomarker Discover y y in Organ Organ Transplantation A A Proteomics Proteomics Approach Tara r Sig del, Sig PhD 9/26/2011 Protein Biomarker Discovery in Organ Transplantation A Proteomics Approach Tara Sigdel, PhD 9/26/2011 Presented at the 2011 Stanford Mass Spectrometry Users Meeting For personal use only. Please do not

More information

The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway in Prostate Cancer

The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway in Prostate Cancer Grand Valley State University ScholarWorks@GVSU Masters Theses Graduate Research and Creative Practice 4-27-2017 The Role of Metastasis Suppressor CD82 in the Deactivation of the c-met Signaling Pathway

More information

CONTRACTING ORGANIZATION: Vanderbilt University Medical Center Nashville, TN

CONTRACTING ORGANIZATION: Vanderbilt University Medical Center Nashville, TN AD Award Number: W81XWH-04-1-0867 TITLE: A Myc-Driven in Vivo Model of Human Prostate Cancer PRINCIPAL INVESTIGATOR: Simon W. Hayward, Ph.D. CONTRACTING ORGANIZATION: Vanderbilt University Medical Center

More information

PATHOBIOLOGY OF NEOPLASIA

PATHOBIOLOGY OF NEOPLASIA PATHOBIOLOGY OF NEOPLASIA Department of Pathology Gadjah Mada University School of Medicine dr. Harijadi Blok Biomedis, 6 Maret 2009 [12] 3/17/2009 1 The pathobiology of neoplasia Normal cells Malignant

More information

FAM83H and casein kinase I regulate the organization of. the keratin cytoskeleton and formation of desmosomes

FAM83H and casein kinase I regulate the organization of. the keratin cytoskeleton and formation of desmosomes FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes Takahisa Kuga, Mitsuho Sasaki, Toshinari Mikami, Yasuo Miake, Jun Adachi, Maiko Shimizu, Youhei

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Molecular biology :- Cancer genetics lecture 11

Molecular biology :- Cancer genetics lecture 11 Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to

More information

Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo

Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Integration of Cells into Tissues Dr Mahmood S Choudhery, PhD, Postdoc (USA) Assistant Professor Tissue Engineering and Regenerative Medicine King Edward Medical University/Mayo Hospital Lahore 1. How

More information

Management of Incurable Prostate Cancer in 2014

Management of Incurable Prostate Cancer in 2014 Management of Incurable Prostate Cancer in 2014 Julie N. Graff, MD, MCR Portland VA Medical Center Assistant Professor of Medicine Knight Cancer Institute, OHSU 2014: Cancer Estimates Stage at Diagnosis

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

silent epidemic,. (WHO),

silent epidemic,. (WHO), Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining

More information

Signal Transduction Pathway Smorgasbord

Signal Transduction Pathway Smorgasbord Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

DETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER

DETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER 665 J App Pharm 03(04): 655-669; October, 2012 Andreas et al., 2012 Short Communication DETERMINATION OF K-RAS MUTATION IN COLORECTAL AND LUNG CANCER E.Andreas 1,2,3, Ali Mujahid 1,3, Attia Youssef 1,

More information

Src-INACTIVE / Src-INACTIVE

Src-INACTIVE / Src-INACTIVE Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each

More information

Elderly men with prostate cancer + ADT

Elderly men with prostate cancer + ADT Elderly men with prostate cancer + ADT Background and Rationale ADT and Osteoporosis Proportion of Patients With Fractures 1-5 Yrs After Cancer Diagnosis 21 18 +6.8%; P

More information

Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.

Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary

More information

Tumor Microenvironment and Immune Suppression

Tumor Microenvironment and Immune Suppression Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation

More information

Tissues Review 4 type

Tissues Review 4 type Tissues Review 4 type Tissues Definition: a group of closely associated cells that perform related functions and are similar in structure Between cells: nonliving extracellular material Four basic types

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

Does EMT Contribute to Radiation Resistance in Human Breast Cancer?

Does EMT Contribute to Radiation Resistance in Human Breast Cancer? AD Award Number: W81XWH-10-1-0592 TITLE: Does EMT Contribute to Radiation Resistance in Human Breast Cancer? PRINCIPAL INVESTIGATOR: Anupama Munshi, Ph.D CONTRACTING ORGANIZATION: University of Oklahoma

More information

Hereditary Prostate Cancer: From Gene Discovery to Clinical Implementation

Hereditary Prostate Cancer: From Gene Discovery to Clinical Implementation Hereditary Prostate Cancer: From Gene Discovery to Clinical Implementation Kathleen A. Cooney, MD MACP Duke University School of Medicine Duke Cancer Institute (No disclosures to report) Overview Prostate

More information

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL

MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes

More information

Top 10 Contributions on Biomedical Sciences: 2nd Edition. St Vincent s Hospital, The University of Melbourne, Australia 2

Top 10 Contributions on Biomedical Sciences: 2nd Edition. St Vincent s Hospital, The University of Melbourne, Australia 2 Chapter 06 Cancer Progression: The Impact of Cytoskeletal Molecules Sam L Francis 1 and Juliana Antonipillai 2 * 1 St Vincent s Hospital, The University of Melbourne, Australia 2 School of Health and Biomedical

More information

Aditi Gupta 1, Wei Cao 2 and Meenakshi A Chellaiah 1*

Aditi Gupta 1, Wei Cao 2 and Meenakshi A Chellaiah 1* Gupta et al. Molecular Cancer 2012, 11:66 RESEARCH Open Access Integrin αvβ3 and CD44 pathways in metastatic prostate cancer cells support osteoclastogenesis via a Runx2/Smad 5/receptor activator of NF-κB

More information

Molecular and genetic analysis of stromal fibroblasts in prostate cancer

Molecular and genetic analysis of stromal fibroblasts in prostate cancer Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,

More information

PIP 2 + PIP 2. MCB3m CS5 Membrane cytoskeletal Interactions S.K.Maciver Feb, 2001

PIP 2 + PIP 2. MCB3m CS5 Membrane cytoskeletal Interactions S.K.Maciver Feb, 2001 MB3m S5 Membrane cytoskeletal Interactions S.K.Maciver Feb, 2001 Membrane ytoskeleton Interactions S5 The cytoskeleton, especially the actin cytoskeleton interacts with cell membranes. The cell cortex

More information

AP: CELL CYCLE REGULATION

AP: CELL CYCLE REGULATION AP: CELL CYCLE REGULATION CELL CYCLE 2 crucial factors for normal growth: Timing and rate of cell division Cell division frequency depends on cell type: skin cells: frequently Liver cells: can divide when

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013 Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40

More information

IJC International Journal of Cancer

IJC International Journal of Cancer IJC International Journal of Cancer Steps in prostate cancer progression that lead to bone metastasis Jung-Kang Jin 1,2, Farshid Dayyani 1 and Gary E. Gallick 1,2 1 Department of Genitourinary Medical

More information

2. Epithelial Tissues Dr. Manal Othman

2. Epithelial Tissues Dr. Manal Othman Biology-232 GENERAL HISTOLOGY 2. Epithelial Tissues Dr. Manal Othman Anatomy Department CMMS, AGU HISTOLOGY: w Study of the structure and function of tissues and organs at the microscopic levels. w Tissues

More information

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033

CONTRACTING ORGANIZATION: University of Southern California Los Angeles, CA 90033 AD Award Number: W81XWH-07-01-0264 TITLE: Function of Klotho and is MicroRNA in Prostate Cancer and Aging PRINCIPAL INVESTIGATOR: Shao-Yao Ying, Ph.D. CONTRACTING ORGANIZATION: University of Southern California

More information

Prostate cancer (PCa) is a malignant tumor common

Prostate cancer (PCa) is a malignant tumor common UROLOGICAL ONCOLOGY Evaluation of Vitronectin Expression in Prostate Cancer and the Clinical Significance of the Association of Vitronectin Expression with Prostate Specific Antigen in Detecting Prostate

More information

What is on the Horizon in Drug Therapy for OAB?

What is on the Horizon in Drug Therapy for OAB? What is on the Horizon in Drug Therapy for OAB? K-E Andersson, MD, PhD Wake Forest Institute for Regenerative Medicine Wake Forest University School of Medicine Winston Salem, North Carolina Disclosures

More information

TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K

TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K AD Award Number: W81XWH-07-1-0028 TITLE: Inhibition of Prostate Cancer Skeletal Metastases by Targeting Cathepsin K PRINCIPAL INVESTIGATOR: Jian Zhang, M.D., Ph.D. CONTRACTING ORGANIZATION: University

More information