Marc Ladanyi Memorial Sloan-Kettering Cancer Center New York, NY, USA

Transcription

1 Genomic Approaches to Translocation Sarcomas Marc Ladanyi Memorial Sloan-Kettering Cancer Center New York, NY, USA

2 Molecular pathology of sarcomas: two major classes 1. Sarcomas with specific reciprocal translocations and relatively simple karyotypes 2. Sarcomas with complex unbalanced karyotypes and no specific translocations

3 Molecular pathology of sarcomas: two major classes Karyotypes Translocations Telomere maintenance mechanisms P53 pathway alterations Incidence in P53-mutant or knockout mice Incidence in bilateral retinoblastoma and Li-Fraumeni syndrome Mouse models Global gene expression profiles Sarcomas with specific translocations Usually simple Reciprocal & specific, producing fusion genes Telomerase common, ALT mechanism rare Relatively rare, but strong prognostic impact Not observed Rare Very difficult Robust clustering Sarcomas without specific translocations Usually complex Non-reciprocal & nonspecific, causing gene copy number changes ALT mechanism more common than telomerase More frequent, but limited or no prognostic impact Common Common Less difficult Looser clustering

4 Sarcoma Genome Project Samuel Singer Chris Sander Marc Ladanyi Cristina Antonescu Robert Maki MSKCC BROAD Matt Meyerson MSKCC & MIT-BROAD Jordi Barretina Heidi Greulich Stacey Gabriel Wendy Winckler Samples RNA and DNA extraction Gene selection 250K Affy SNP arrays for copy number and LOH analysis U133A Affy expression arrays MicroRNA profiling Computational analysis Sequencing of 225 genes and 450 microrna genes Sequenom validation of candidate mutations Targeted functional validation

5 Samples run on Affy 250K SNP arrays (as of October 2007) Subtype Karyotype Total Dedifferentiated liposarcoma Myxoid/round cell liposarcoma complex, 12q rings + giant markers simple, t(12;16) Pleomorphic liposarcoma MFH Gastrointestinal stromal tumor Synovial sarcoma Leiomyosarcoma TOTAL complex complex simple, monosomy 14 simple, t(x;18) complex matched normals (205) Paired Affy U133A expression data for 141 samples

6 Sarcoma Genome Project: Global view of copy number data Dedifferentiated Liposarcoma Pleomorphic Liposarcoma Many genomic copy number changes strong effect on gene expression profiles MFH GIST Round cell Liposarcoma Synovial Sarcoma Few genomic copy number changes weak effect on gene expression profiles Affy 250K SNP array data, MSKCC analysis

7 Genomic Approaches to Sarcomas Complex karyotype sarcomas will require integration of genomic copy number data with expression profiling data Expression profiles contain many passenger genes from regions of gains or losses Translocation sarcomas: expression profiling data alone more likely to be informative Reflect lineage + effect of aberrant transcription factor Probably less biological noise than expression profiles of complex karyotype sarcomas

8 Genomic Approaches to Translocation Sarcomas Agenda Expression profiling: mining for diagnostic and therapeutic targets ChIP-on-chip: integration with expression profiling data to identify target genes of chimeric transcription factors in translocation sarcomas Cancer genomics: new approaches to high throughput unbiased discovery of translocations

9 Most fusion genes resulting from sarcoma translocations encode aberrant transcription factors Sarcoma type Ewing sarcoma Clear cell sarcoma Myxoid liposarcoma Alveolar rhabdomyosarcoma DSRCT Extraskeletal myxoid chondrosarcoma Synovial sarcoma Endometrial stromal sarcoma Alveolar soft part sarcoma Low grade fibromyxoid sarcoma Pericytoma Angiomatoid fibrous histiocytoma Translocation t(11;22) t(21;22) t(12;22) t(2;22) t(12;16) t(2;13) t(1;13) t(11;22) t(9;22) t(9;17) t(x;18) t(7;17) t(x;17) t(7;16) t(7;12) t(12;22) t(2;22) Fusion gene EWS-FLI1 EWS-ERG EWS-ATF1 EWS-CREB1 FUS-CHOP PAX3-FKHR PAX7-FKHR EWS-WT1 EWS-NR4A3 EWS-TAF2N SYT-SSX1,2 JAZF1-JJAZ1 ASPL-TFE3 FUS-BBF2H7 ACTB-GLI EWS-ATF1 EWS-CREB1

10 Expression profiling dataset on sarcomas with chimeric transcription factors Chip: Affymetrix U133A Data processing: RMA method Clustering: Pearson correlation Data used: all probe sets n=137 tumors from MSKCC and U.Penn. (F. Barr) + 4 xenografts + 12 cell lines = 153 total samples Alveolar Rhabdomyosarcoma (ARMS) Desmoplastic Small Round Cell Tumor (DSRCT) Synovial Sarcoma (SS) PAX3-FKHR 7 PAX7-FKHR 32 EWS-WT1 25 SYT-SSX1 21 SYT-SSX2 Ewing Sarcoma/PNET (ES) EWS-FLI1 type 1 11 EWS-FLI1 type 2 5 EWS-ERG ASPS ES SS DSRCT ARMS Alveolar Soft Part Sarcoma (ASPS) ASPL-TFE3 type 1 3 ASPL-TFE3 type 2 Samples Genes significantly over- or underexpressed* Subset with 2 fold overexpression* SS ARMS DSRCT ASPS ES/PNET * all significant at Bonferroni p<0.01 relative to 4 other sarcoma types M. Laé, T. Saito, et al., Ladanyi Lab

11 Mining expression profiles of translocation sarcomas for diagnostic markers ApoD in DFSP (van de Rijn group, 2004) TLE1 in synovial sarcoma (Terry et al., 2007)

12 Mining expression profiles of translocation sarcomas for diagnostic markers ApoD in DFSP (van de Rijn group) TLE1 in synovial sarcoma TFAP2-β in ARMS vs ERMS Wachtel et al. study OLIG2 KCNN3 MSKCC study ELA1 ARMS >> ERMS genes: overlap between 3 microarray studies NELL1 NHLH1 ADRA2C ALK NRN1 KIAA0746 C16orf45 PIPOX TFAP2B PODXL FOXF1 KIAA0523 DKFZp547P042 DKFZp762M127 CNR1 ELA1 ASS PGBD5 ABAT Wachtel et al. JCO 2006 GARNL4 JAKMIP2 TSC22D2 Davicioni et al. study TNRC9 DCX SYN2

13 Mining expression profiles of translocation sarcomas for therapeutic targets Kinase genes Family of genes involved in signaling; rich in drug targets Approach: Identified 739 probe sets on U133A chip corresponding to 432 genes with kinase domains based on searches of the Affymetrix annotation database, published data and genome databases 83% of the 518 known protein kinase genes Performed unsupervised clustering and supervised comparisons focused on these 739 probe sets

14 Unsupervised clustering based on kinase genes Translocation sarcomas express distinctive repertoires of kinases ES ARMS DSRCT SS ASPS 739 probe sets on U133A chip representing 432 kinase genes

15 Supervised comparisons based on kinase genes Translocation sarcomas express distinctive repertoires of kinases Ewing Sarcoma/PNET Differentially overexpressed kinases Kinase Gene PRKCB1 DAPK1 KIT JAK1 VRK1 EPHA4 Fold T test p-value 2.1E E E E E E-10 Alveolar Rhabdomyosarcoma Differentially overexpressed kinases Kinase Gene TTN FGFR4 MET ERBB3 DAPK1 Fold T test p-value 5.0E E E E E-08 Synovial Sarcoma Differentially overexpressed kinases Kinase Gene PDGFRA FGFR3 NTRK2 FGFR1 Fold T test p-value 6.9E E E E-24 Baird et al., 2005 (Meltzer group)

16 Differentially expressed kinases in translocation sarcomas Basis: Lineage-associated (e.g. like KIT in GIST) Oncogenic role (e.g. like KIT in GIST; like EGFR in EGFR-mutant lung adenoca) Transcriptional targets of chimeric transcription factor Pathogenic activation: Aberrant overexpression due to transcriptional upregulation Amplification (unlikely) Mutation

17 Sequencing of kinases showing relative overexpression in specific translocation sarcomas Ewing Sarcoma/PNET Differentially overexpressed kinases Kinase Gene PRKCB1 DAPK1 KIT JAK1 VRK1 EPHA4 Fold T test p-value 2.1E E E E E E-10 Alveolar Rhabdomyosarcoma Differentially overexpressed kinases Kinase Gene TTN FGFR4 MET ERBB3 DAPK1 Fold T test p-value 5.0E E E E E-08 Synovial Sarcoma Differentially overexpressed kinases Kinase Gene PDGFRA FGFR3 NTRK2 FGFR1 Fold T test p-value 6.9E E E E-24 Mutation screens -> essentially negative PRKCB1: 0/28 ES/PNET JAK1: 0/31 ES/PNET EPHA4: 1/68 ES/PNET PDGFRA: 0/27 SS (1 reported) FGFR3: 0/30 SS Etc Neal Shukla, M.D.

18 Differentially expressed kinases in translocation sarcomas Basis: Lineage-associated (e.g. like KIT in GIST) Oncogenic role (e.g. like KIT in GIST; like EGFR in EGFR-mut lung CA) Transcriptional targets of chimeric transcription factor Pathogenic activation: Aberrant overexpression due to transcriptional upregulation Amplification (unlikely) Mutation

19 MET is a highly differentially overexpressed kinase in ASPS Kinase Fold T-test p-value PIM E-10 MAPK E-09 MET E-09 H E-09 MAPKAPK E-08 PRKAG E-08 MKNK E-08 GPRK E-08 LYN E-08 PACSIN E-07 FLT E-07 MAPKAP E-06 Masumi Tsuda, Ph.D. Comparison of 16 ASPS samples vs 123 samples of 4 other sarcomas

20 ASPL-TFE3 fusion gene in Alveolar Soft Part Sarcoma der(17)t(x;17)(p11;q25) ASPL-TFE3 fusion arising from t(x;17)(q25.3; p11.2) soft tissue Rare soft tissue sarcoma First described in 1952 (here) F:M = 3:2, age range: highly chemotherapy and radiation therapy resistant site: within or next to skeletal muscle typical presentation: thigh mass Alveolar Soft Part Sarcoma (ASPS)

21 ASPL-TFE3 fusion gene Chimeric Transcription Factor ASPL - 17q25 - ubiquitously expressed cytoplasmic protein involved in processing of glucose transporters TFE3 - Xp bhlh-lz family transcription factor highly related to MITF and TFEB - contains DNA binding domain and NLS - Consensus sequence CANNTG ASPL TFE3 ASPL-TFE3 type1 ASPL-TFE3 type ASPL-TFE3 - replaces the N-terminal portion of TFE3 by the fused ASPL sequences - retains DNA binding domain and NLS, functions as transcription factor - Type 2 retains activating domain as well - more active than TFE3 in model assays UBX AD bhlh -LZ NLS bhlh -LZ NLS bhlh AD -LZ NLS

22 ASPL-TFE3: a gene fusion found in both a sarcoma and a carcinoma Cellular background Kidney Soft tissue ASPL-TFE3 Renal Carcinoma Alveolar Soft Part Sarcoma Only existing human cell line with endogenous ASPL-TFE3 translocation is from an ASPL-TFE3 renal carcinoma; there is no ASPS cell line available.

23 TFE3 gene fusions in human tumors Fusion Tumor Age Translocation ASPL-TFE3 ASPS 5-40 der(17)t(x;17)(p11;q25) ASPL-TFE3 Renal CA 2-68 t(x;17)(p11;q25) PRCC-TFE3 Renal CA 2-70 t(x;1)(p11.2;q12) PSF-TFE3 Renal CA 5-68 t(x;1)(p11.2;p34) NonO-TFE3 Renal CA 39 inv(x)(p11.2;q12) CLTC-TFE3 Renal CA 14 t(x;17)(p11;q23) Alpha-TFEB Renal CA t(6;11)(p21;q13) Translocation carcinomas of the kidney

24 ASPL-TFE3 activates exogenous MET promoter construct Masumi Tsuda, Ph.D P<0.01 Fold activation basic P<0.01 Met-pro MOCK TFE3 ASPL-TFE3 type1 ASPL-TFE3 type2 Reporter co-transfection and transactivation assay

25 ASPL-TFE3 is present at the MET promoter Chromatin Immunoprecipitation assay (293 cells with inducible ASPL-TFE3) input MOCK IgG anti-myc ASPL-TFE3 type1 input IgG anti-myc ASPL-TFE3 type2 input IgG anti-myc nega. con. posi. con. 100 bp 100 bp Tet 0 h Tet 46 h bp -1340bp -200bp CANNTG (consensus binding sequences for native TFE3 and ASPL-TFE3) Transcription Start Site

26 ASPL-TFE3 activates endogenous MET promoter Normalized MET expression MOCK ASPS1 ASPS Time after induction (hrs) 64 K MOCK 293 cells with ASPL-TFE3 type cells with ASPL-TFE3 type 2 Tet (h) type2 type1 IB: anti-myc (ASPL-TFE3 inducible 293 cells with T-Rex system)

27 Oncogenic TFE3 fusion proteins activate MET signaling by transcriptional upregulation ASPL-TFE3 stimulates MET kinase activity and downstream signaling Cytoplasm U0126 PD98059 MEK1/2 p p MAPK/Erk1/2 p p p c-raf? p Akt p RAS Nucleus p ASPL-TFE3 HGF MET Membrane Crk p p Gab1 Autophosphorylation p PI3-k p PHA (Pfizer) LY Met Met Met p p MYC p p Stat3 MET Transcription genes cell growth adhesion motility invasion ASPS and renal carcinomas with TFE3 fusions Tsuda M, Davis IJ, Argani P, Shukla N, McGill GG, Nagai M, Saito T, Laé M, Fisher DE, Ladanyi M. Cancer Res 67: , 2007.

28 Effects of MET inhibitor PHA on cell viability IB: Met IB: actin % viability FU-UR1 RH30 Other sarcomas A673 PHA Fuji HS-SY-II PHA ASPL-TFE3 RCC line (no ASPS line available) FU-UR1 RH30 A673 HS-SY-II Fuji (µm) PD98059 (MEK inhib.) (µm) LY (PI3K inhib) (µm)

29 ASPS Renal tumors ASPL-TFE3 PRCC-TFE3 #1 #2 #2-2 #9 #12 #15 #18 #18-2 #14 #17 #20 #31 #31-2 #21 #28 #28 # K 140 K 69 K Met IP: Met, IB: p-met (Y1234/1235) HGF ASPS ASPL-TFE3 RCC Frequent coexpression of MET and HGF and expression of phospho-met in tumors with TFE3 fusions MET HGF

30 Oncogenic activation of MET signaling Kinase domain missense mutations (activating) Familial and sporadic (15%) papillary renal cell carcinomas rare in other cancers MET fusion protein (constitutively activated) TPR-MET (only in carcinogen-treated cell line MNNG-HOS) Autocrine signaling MET and HGF co-expression MET amplification Gastric cancer (10-20%) EGFR-mut lung adenocarcinomas resistant to EGFR TKIs Aberrant transcriptional upregulation of MET by amplified MITF in some melanomas (MET is a direct target of MITF) by TFE3 fusion proteins in ASPS and renal carcinomas with TFE3 fusions

31 Target Genes of Chimeric Transcription Factors (CTFs) in Sarcomas Translocation sarcomas are usually highly dependent on their specific CTF Deregulation of gene expression by these CTFs is a major part of the biology of these sarcomas Transcription factors = poor therapeutic targets Need to identify critical downstream transcriptional targets for which drugs exist or are in development Slow progress in identifying genuine biologically critical CTF target genes Approach: obtain a more comprehensive view of genuine in vivo direct targets of CTFs through the integration of ChIP-on-chip data with: expression profiling data from tumors expression profiling data from homologous or heterologous cell lines in which CTF levels are modulated

32 Genomic Approaches to Translocation Sarcomas Agenda Expression profiling: mining for diagnostic and therapeutic targets ChIP-on-chip: integration with expression profiling data to identify target genes of chimeric transcription factors in translocation sarcomas Cancer genomics: new approaches to high throughput unbiased discovery of translocations

33 ChiP on CHIP Chromatin immunoprecipitation combined with DNA promoter chip hybridization for genome-wide analysis of transcription factor localization Cells expressing transcription factor of interest Crosslink, Sonicate Antibody to transcription factor of interest Ligation-mediated PCR LM-PCR Size of DNA fragments after LM-PCR: bp Cy3 label Cy5 label Hybridize to Microarray

34 Enrichment of bound DNA vs. total DNA by chromatin IP

35 Agilent Human Promoter Microarray 2 x 244K arrays Promoters of ~19,143 genes 25 probes/promoter Probes ~ 60nt oligomers Spaced every ~ 200 bp Location of Probes within Promoter Region 5500 bp upstream from transcriptional start site 2500 bp downstream from transcriptional start site Genome version: UCSC May 2004 Build 34

36 Validation of cell lines and antibodies used for ChIP-on-chip EWS-FLI1 Cell line: TC-71 (Ewing s sarcoma with EWS-FLI1) No native FLI1 by western Antibody: FLI1 C-terminal Positive control ChIP targets: TGFBR2, ID2 ASPL-TFE3 Cell line: FU-UR-1 (renal carcinoma with ASPL-TFE3) No native TFE3 by western and RT-PCR Antibody: TFE3 C-terminal Positive control ChIP targets: MET, CYP17A1 Zhen Lu, Ph.D. Rachel Kobos, M.D.

37 ChIP on CHIP results for ASPL-TFE3 in FU-UR-1 cells Triplicate ChIP Triplicate array hybridizations Data analyzed by TileMap - Significant genes = Tstat > genes (11.5%) significant for ASPL-TFE3 Enriched by IP Significantly enriched by IP

38 ChIP on CHIP results for EWS-FLI1 in TC71 cells Triplicate ChIP Triplicate array hybridizations Data analyzed by TileMap - Significant genes = Tstat > genes (13.7%) significant for EWS-FLI1 Enriched by IP Significantly enriched by IP

39 Reproducibility of ChIP-Chip Results: Binding of MET promoter by ASPL-TFE3

40 Previously known target of EWS-FLI1 TGFBR2

41 Previously known target of EWS-FLI1 TGFBR2 gaactcctgagtggtgtgggagggcggtgaggggcagctgaaagtcggccaaagctctcg gaggggctggtctaggaaacatgattggcagctacgagagagctaggggctggacgtcga GGAGAGGGAGAAGGCTCTCGGGCGGAGAGAGGTCCTGCCCAGCTGTTG GCGAGGAGTTTCCTGTTTCCCCCGCAGCGCTGAGTTGAAGTTGAGTGA GTCACTCGCGCGCACGGAGCGACGACACCCCCGCGCGTGCACCCGCTC GGGACAGGAGCCGGACTCCTGTGCAGCTTCCCTCGGCCGCCGGGGGCC TCCCCGCGCCTCGCCGGCCTCCAGGCCCCCTCCTGGCTGGCGAGCGGG CGCCACATCTGGCCCGCACATCTGCGCTGCCGGCCCGGCGCGGGGTCC GGAGAGGGCGCG Significant Probes ChIP primers used in Fukuma et al ChIP primers used in Siligan et al 2005.

42 Previously known target of ASPL-TFE3 MET

43 Previously known target of ASPL-TFE3 MET gggggccgatttccctctgggtggtgccagtccccacctcagcggtcctcggaacccgcg gactaggggacggacagcacgcgaggcagacagacacgtgctggggcgggcaggcgagcg cctcagtctggtcgcctggcggtgcctccggccccaacgcgcccgggccgccgcgggccg cgcgcgccgatgcccggctgagtcactggcagggcagcgcgcgtgtgggaaggggcggag ggagtgcggccggcgggcgggcggggcgctgggctcagcccggccgcaggtgacccggag GCCCTCGCCGCCCGCGGCGCCCCGAGCGCTTTGTGAGCAGATGCGGAGCC GAGTGGAGGGCGCGAGCCAGATGCGGGGCGACAGCTGACTTGCTGAGAGG AGGCGGGGAGGCGCGGAGCGCGCGTGTGGTCCTTGCGCCGCTGACTTCTC CACTGGTTCCTGGGCACCGAAAGgtaaaattgcagcccctttcagatccagtacccaatc Cctcgcctcaggggttctgctttctttgttcccctaagagacctgactgctgttccagggggcaaaacc Acgtaggtgggctagagtttaggggcttcggaaactgaagagacgtggccacggcgaggacgaaa ctagaatggggcttgtctttttagggggttgcttctgatggccacctgtatgacttaggagggagaggg gcgctgggacagtgggtgatgtgtgactgttacggcccagcaagttttaaagctgggatc tgactcagcccttacaaaagggatccggtcatcctcgtcccaccgtgatgcagctggcaa Significant Probes ChIP primers used in Tsuda et al 2007.

44 Example of Gene of Interest for ASPL-TFE3 PIM1 kinase

45 PIM1 is a highly differentially overexpressed kinase in ASPS Kinase Fold T-test p-value PIM E-10 MAPK E-09 MET E-09 H E-09 MAPKAPK E-08 PRKAG E-08 MKNK E-08 GPRK E-08 LYN E-08 PACSIN E-07 FLT E-07 MAPKAP E-06 - PIM1 inhibitors exist - Implicated in other cancers Comparison of 16 ASPS samples vs 123 samples of 4 other sarcomas

46 Example of Gene of Interest for EWS-FLI1 TERT - EWS-FLI1 previously reported to upregulate TERT (Takahashi, CR 2003) - Ulaner et al, 2004: TERT+/TRAP+ in - 21/30 Ewing sarcomas - 9/10 Ewing cell lines

47 Relationship of ChIP-on-chip bound genes to differentially expressed genes in tumor expression profiles Unsupervised clustering of 137 sarcoma samples based on genes bound in the ChIP-chip analysis

48 Unsupervised clustering of 137 sarcoma samples based on 2193 genes bound by ASPL-TFE3 in the ChIP-chip analysis

49 Unsupervised clustering of 137 sarcoma samples based on 2617 genes bound by EWS-FLI1 in the ChIP-chip analysis

50 Relationship of ChIP-on-chip bound genes to differentially expressed genes in tumor expression profiles Unsupervised clustering of 137 sarcoma samples based on genes bound in the ChIP-chip analysis Comparison of ChIP-chip bound genes to genes significantly differentially expressed in tumor expression profiles Subset comparisons (stringently defined subsets of over- or under-expressed genes)

51 Expression profiling dataset on sarcomas with chimeric transcription factors Chip: Affymetrix U133A Data processing: RMA method Clustering: Pearson correlation Data used: all probe sets n=137 tumors from MSKCC and U.Penn. (F. Barr) + 4 xenografts + 12 cell lines = 153 total samples Alveolar Rhabdomyosarcoma (ARMS) Desmoplastic Small Round Cell Tumor (DSRCT) Synovial Sarcoma (SS) PAX3-FKHR 7 PAX7-FKHR 32 EWS-WT1 25 SYT-SSX1 21 SYT-SSX2 Ewing Sarcoma/PNET (ES) EWS-FLI1 type 1 11 EWS-FLI1 type 2 5 EWS-ERG ASPS ES SS DSRCT ARMS Alveolar Soft Part Sarcoma (ASPS) ASPL-TFE3 type 1 3 ASPL-TFE3 type 2 Samples Genes significantly over- or underexpressed* Subset with 2 fold overexpression* SS ARMS DSRCT ASPS ES/PNET * all significant at Bonferroni p<0.01 relative to 4 other sarcoma types M. Laé, T. Saito, et al., Ladanyi Lab

52 Relationship of ChIP-on-chip bound genes to differentially expressed genes in tumor expression profiles ASPS / ASPL-TFE3 2X overexpressed genes P<10-31 Bound Not Bound Not overexpressed Overexpressed Ewing s / EWS-FLI1 2X overexpressed genes P=0.25 Bound Not Bound Not overexpressed Overexpressed

53 Relationship of ChIP-on-chip bound genes to differentially expressed genes in tumor expression profiles ASPS / ASPL-TFE3 2X overexpressed genes P<10-31 Bound Not overexpressed Overexpressed Genes of interest: MET, CYP17A1, UPP1, PIM1, IGF2R, MAFF Not Bound Ewing s / EWS-FLI1 2X overexpressed genes P=0.25 Bound Not overexpressed Overexpressed Genes of interest: NR0B1, NKX2.2, ID2, CCND1, GAS1 Not Bound

54 Relationship of ChIP-on-chip bound genes to differentially expressed genes in tumor expression profiles ASPS / ASPL-TFE3 Top X underexpressed genes, Sorted by p-value P=0.32 Bound Not Bound Not underexpressed Underexpressed Ewing s / EWS-FLI1 Top X underexpressed genes, sorted by p-value Not underexpressed Underexpressed Bound Not Bound P<10-3 Genes of interest: FZD10, SIX2, FOXF1, NCAM1

55 Relationship of EWS-FLI1 ChIP-on-chip bound genes to genes whose expression is significantly altered upon knockdown of EWS-FLI1 in a Ewing sarcoma cell line Published expression profile: Steve Lessnick et al., Expression profiling of EWS/FLI identifies NKX2.2 as a critical target gene in Ewing's sarcoma. Cancer Cell 2006 Ewing s sarcoma cell line A673 with EWS-FLI1 shrna knockdown, U133A arrays 32 genes upregulated by EWS-FLI1 148 genes downregulated by EWS-FLI1 Upregulated Not P=0.37 Upregulated P<10-3 Not downregulated Downregulated Bound Bound Not Bound Not Bound

56 Relationship of EWS-FLI1 ChIP-on-chip bound genes to genes whose expression is significantly altered upon knockdown of EWS-FLI1 in a Ewing sarcoma cell line Published expression profile: Steve Lessnick et al., Expression profiling of EWS/FLI identifies NKX2.2 as a critical target gene in Ewing's sarcoma. Cancer Cell 2006 Ewing s sarcoma cell line A673 with EWS-FLI1 shrna knockdown, U133A arrays 32 genes upregulated by EWS-FLI1 148 genes downregulated by EWS-FLI1 Upregulated Not P=0.37 Upregulated P<10-3 Not downregulated Downregulated Bound Bound Not Bound Not Bound Genes of interest: NR0B1, NKX2.2, GAS1, RET Genes of interest: IGFBP3, IGFBP7, KLF6

57 Cross-reference genes bound by EWS-FLI1 with 7 sources of expression profiles of EWS-FLI1-upregulated genes Sarcoma Profiling 227 genes Ladanyi Unpublished EWS-FLI1 KD in TC71, EWS genes Kinsey M et al, EWS-FLI1 KD in A673 cells 32 genes Smith R et al, genes Transfected EWS-FLI1 in Human Fibroblasts 92 genes Lessnick SL et al, 2002 SRBCT Profiling 33 genes Staege MS et al, ChIP chip data 2617 genes bound by EWS-FLI1 Transfected EWS-FLI1into ERMS cells 87 genes Hu-Lieskovan S et al Sarcoma Profiling 261 genes Baird K et al, EWS-FLI1 bound genes found to be up in >1 expression profile ATP1A1 ATP2A2 CARHSP1 CCND1 DAPK1 EFNB1 EGR2 EPB41 FADS1 FANCA FNBP1 FVT1 GAS1 ID2 IMPA2 LEPROTL1 SH2B3 MYO10 NR0B1 PFKP PPFIA1 RAP1GAP RDX RUNX3 SQLE SRPK2 UAP1 ZDHHC3

58 Cross-reference genes bound by EWS-FLI1 with 7 sources of expression profiles of EWS-FLI1-upregulated genes Sarcoma Profiling 227 genes Ladanyi Unpublished EWS-FLI1 KD in TC71, EWS genes Kinsey M et al, EWS-FLI1 KD in A673 cells 32 genes Smith R et al, genes Transfected EWS-FLI1 in Human Fibroblasts 92 genes Lessnick SL et al, 2002 SRBCT Profiling 33 genes Staege MS et al, ChIP chip data 2617 genes bound by EWS-FLI1 Transfected EWS-FLI1into ERMS cells 87 genes Hu-Lieskovan S et al Sarcoma Profiling 261 genes Baird K et al, Future Experiments Systematic knockdown of genes upregulated by EWS- FLI1 using sirna or shrna libraries Chemical inhibition of selected targets (RTKs)

59 Genomic Approaches to Translocation Sarcomas Agenda Expression profiling: mining for diagnostic and therapeutic targets ChIP-on-chip: integration with expression profiling data to identify target genes of chimeric transcription factors in translocation sarcomas Cancer genomics: new approaches to high throughput unbiased discovery of translocations

60 Translocations in human cancers >75% of genes somatically altered in human tumors are translocated Heightened interest following discovery of gene fusions in common carcinomas (TMPRSS2-ERG in prostate CA; EML4-ALK in lung CA) High throughput unbiased screening methods becoming available

61 New approaches to high throughput unbiased discovery of translocations and intragenic rearrangements Genomic DNA BAC end-sequence profiling Massively parallel single-molecule sequencing of paired end tags mrna-based Search for chimeric transcripts in EST libraries Massively parallel single-molecule cdna sequencing Microarray-based

62 Translocations can be associated with genomic copy number changes A B.... A Examples: gain of Ph chromosome in blastic CML, PAX7-FKHR gains in ARMS

63 Array-based strategies for unbiased detection of gene fusions acgh approach (part of MSKCC TCGA contribution) dense cancer gene coverage optimally suited for the detection of gene fusions associated with genomic gains or losses (Cameron Brennan, MSKCC) design: exon-level coverage of gene classes involved in gene fusions: transcription factors, kinases, etc detects: gene fusions occurring through interstitial deletions non-reciprocal translocations reciprocal translocations followed by loss or duplication of one of the derivatives

64 Array-based strategies for unbiased detection of gene fusions acgh approach (part of MSKCC TCGA contribution): dense cancer gene coverage optimally suited for the detection of gene fusions associated with genomic gains or losses Exon expression array approach based on intragenic change points in expression levels due to 3 exons driven by promoter of 5 fusion partner gene exon target of array probe Human Genome U133 Plus 2.0 Array Human Exon 1.0 ST Array

65 Gene A Promoter A mrna cdna Exon array probes Fusion Gene B-A Weak promoter Low Transcript levels Fusion Gene A-B Strong promoter High Promoter Breakpoint Fusion gene A-B A mrna Reciprocal fusion transcript Fusion gene B-A Gene B cdna Promoter B mrna cdna Exon array probes Exon array probes Exon array Relative Expression level 0 Gene B Fusion gene A-B + Fusion gene B-A Change point in expression level Breakpoint Tumor with fusion gene A-B Normalized to samples without translocation

66 Test set for detection of fusion transcripts using Affy Exon array data Tumor Synovial sarcoma Ewing s sarcoma Toru Motoi, M.D.,Ph.D. Desmoplastic small round cell sarcoma Alveolar rhabdomyosarcoma Alveolar soft part sarcoma Clear cell sarcoma Extraskeletal myxoid chondrosarcoma Infantile fibrosarcoma Myxoid liposarcoma CML AML Prostate cancer Total Fusion gene SYT-SSX1 SYT-SSX2 EWS-FLI1 type1 EWS-FLI1 type2 EWS-FLI EWS-FLI EWS-ERG EWS-WT1 PAX3-FKHR ASPL-TFE3 Type1 EWS-ATF1 EWS-NR4A3 ETV6-NTRK3 TLS-CHOP BCR-ABL p210 BCR-ABL p190 PML-RARa TMPRSS2-ERG Number of samples Tissue Cell line Total

67 Use of Affymetrix Exon Arrays to detect gene fusions Discontinuity of expression levels of WT1 exons in JN-DSRCT1 cell with EWS-WT1 fusion 5 3

68 Use of Affymetrix Exon Arrays to detect gene fusions Discontinuity of expression levels of SSX1 exons in HS-SY-II cell line with SYT-SSX1 fusion 5 3

69 Use of Affymetrix Exon Arrays to detect gene fusions in primary tumor samples Discontinuity of expression levels of WT1 exons in a clinical DSRCT sample Discontinuity of expression levels of SSX1 exons in clinical synovial sarcoma sample with SYT-SSX1

70 Development of a computational algorithm to score genes with discontinuity of expression levels between 5 and 3 exons Nick Socci & Adam Olshen, MSKCC SSX1 in Syn Sarc clinical sample SSX1 in Syn Sarc cell line WT1 in DSRCT cell line Fusion Score

71 Genomic Approaches to Translocation Sarcomas Agenda Expression profiling: mining for diagnostic and therapeutic targets ChIP-on-chip: integration with expression profiling data to identify target genes of chimeric transcription factors in translocation sarcomas Cancer genomics: new approaches to high throughput unbiased discovery of translocations and intragenic rearrangements