SUPPLEMENTARY INFORMATION

Size: px
Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Transcription

1 doi: 1.138/nature8645 Physical coverage (x haploid genomes) Neither end mapped One end mapped Chimaeras Correct Reads (million ns) HCC1187 HCC1395 HCC1599 HCC1937 HCC1954 HCC2157 HCC2218 HCC38 HCC1143 Physical coverage (x haploid genomes) Neither end mapped One end mapped Chimaeras Correct Reads (millions s) PD3664a PD3666a PD3668a PD367a PD3672a PD3688a PD369a PD3695a PD3665a PD3667a PD3669a PD3671a PD3687a PD3689a PD3693a Supplementary Figure 1 Haploid physical coverage of breast cancer samples. Physical coverage indicates the number of DNA fragments of which both ends have been sequenced that on average overlie any position in the genome. 1

2 doi: 1.138/nature8645 HCC2157 HCC1395 HCC1954 HCC1187 HCC1937 HCC1143 HCC2218 PD3667a PD3671a PD3689a PD3664a PD3668a PD3672a PD369a PD3669a PD3687a PD3665a PD3693a SI Guide Supplementary Figure 1 Haploid physical coverage of breast cancer samples. Physical coverage indicates the number of DNA fragments of which both ends have been sequenced HCC1599 HCC38 overlie any position PD3666a that on average in the genome. PD367a PD3688a PD3695a Supplementary Figure 2 Genome wide circos plots of somatic rearrangements in all 24 breast cancers in the study. Supplementary Figure 3 NFIA-EHF, an expressed, in frame fusion gene caused by an interchromosomal rearrangement in breast cancer cell line HCC1937. (a) Across not in normal DNA; (b) RT-PCR of RNA between NFIA exon 2 and EHF exon 5 to confirm the presence of a chimeric expressed transcript; (c) Representative picture of dual colour FISH confirming a translocation in HCC1937. Red probe corresponds to BAC RP11364M11, chromosome 1: 61,64,196-61,228,554. Green probe corresponds to BAC RP11277N8, chromosome 11: 34,772,14-34,965,946. (d) Schematic diagram of the protein domains fused in the predicted NFIA/EHF fusion protein. Domains from NFIA are blue, domains from EHF are red (e) Sequence from RT-PCR product shown in (b) confirming NFIA exon 2 fused to EHF exon 5. Supplementary Figure 4 SLC26A6-PRKAR2A, an expressed, in-frame fusion gene generated by a tandem duplication in the breast cancer cell line HCC38. (a) Across not in normal DNA; (b) RT-PCR of RNA between SLC26A6 exon 17 and PRKAR2A exon 4 to confirm the presence of a chimeric expressed transcript; (c) Dual colour FISH confirming the 3p21.31 tandem duplication in HCC38. Green-labelled BAC RP11-148G2 is within the 2

3 doi: 1.138/nature8645 a bps T N d NFIA (exons 1-2) EHF (exons 5-9) Genomic PCR b bps 3 2 T N CTF/NF1 MH 1 DNA ETS DNA RT-PCR e c Dual colour FISH exon 2 NFIA exon 5 EHF Supplementary Figure 3 NFIA-EHF, an expressed, in frame fusion gene caused by an interchromosomal rearrangement in breast cancer cell line HCC1937. (a) Across not in normal DNA; (b) RT-PCR of RNA between NFIA exon 2 and EHF exon 5 to confirm the presence of a chimeric expressed transcript; (c) Representative picture of dual colour FISH confirming a translocation in HCC1937. Red probe corresponds to BAC RP11-364M11, chromosome 1: 61,64,196-61,228,554. Green probe corresponds to BAC RP11-277N8, chromosome 11: 34,772,14-34,965,946. (d) Schematic diagram of the protein domains fused in the predicted NFIA/EHF fusion protein. Domains from NFIA are blue, domains from EHF are red (e) Sequence from RT-PCR product shown in (b) confirming NFIA exon 2 fused to EHF exon 5. 3

4 No of rearrangements doi: 1.138/nature No of rearran ngements HCC2157 No of rearrange ements HCC1937 HCC HCC1395 HCC1187 HCC1143 HCC HCC SI Guide PD3664a PD3664 PD3665a PD3665 PD3666a PD Supplementary Figure 1 Haploid physical coverage of breast cancer samples. 5 Physical 5 5 coverage indicates the number of DNA fragments of which both ends have been sequenced that on average overlie any position in the genome. PD3667a PD3668a PD3669a PD367a Supplementary 1 Figure 3 NFIA-EHF, an expressed, in frame fusion gene caused 1 by an No of rearrange ements 15 Supplementary Figure 2 Genome wide circos plots of somatic rearrangements in all breast cancers in the study No of rearranggements No of rearrangements HCC interchromosomal5rearrangement in breast cancer cell line HCC1937. (a) 5 5 Across not in normal DNA; (b) RT-PCR of RNA between NFIA exon 2 and EHF exon 5 to confirm PD3671a PD3672a PD3687a PD3688a the presence of a chimeric expressed transcript; (c) Representative picture of dual colour 2 FISH confirming a translocation in HCC Red probe corresponds to 2 BAC RP : 61,64,196-61,228, Green probe corresponds to15 364M11, chromosome BAC RP11277N8, chromosome 11: 34,772,14-34,965,946. the protein 1 1 (d) Schematic diagram of1 domains fused in the predicted NFIA/EHF fusion protein. Domains from NFIA are blue, domains from EHF are red (e) Sequence from RT-PCR product shown in (b) confirming NFIA exon 2 fused to EHF exon 5. PD3689a PD369a PD3693a PD3695a PD3689 PD369 PD3693 PD3695 Supplementary Figure 4 SLC26A6-PRKAR2A, an expressed, in-frame fusion gene generated by a tandem duplication in the breast cancer cell line HCC38. (a) Across not in normal DNA; (b) RT-PCR of RNA between SLC26A6 exon 17 and PRKAR2A exon 4 to confirm the presence of a chimeric expressed transcript; (c) Dual colour FISH confirming the 3p21.31 tandem duplication in HCC38. Green-labelled BAC RP11-148G2 is within the 4

5 doi: 1.138/nature8645 not in normal DNA; (b) RT-PCR of RNA between SLC26A6 exon 17 and PRKAR2A exon 4 to confirm the presence of a chimeric expressed transcript; (c) Dual colour FISH confirming the 3p21.31 tandem duplication in HCC38. Green-labelled BAC RP11-148G2 is within the tandem duplication. Red-labelled BAC RP11-527M1 is located ~3 Mb telomeric of the tandem duplication. (d) Schematic diagram of the protein domains in the predicted SLC26A6-PRKAR2A fusion protein. Domains from SLC26A6 are blue, domains from PRKAR2A are red. (e) Sequence from RT-PCR product shown in (b) confirming SLC26A6 exon 17 fused to PRKAR2A exon 4. 5

6 doi: 1.138/nature8645 a bps T N d SLC26A6 (exons 1-17) PRKAR2A (exons 4-11) b bps Genomic PCR T N Sulphate Transporter cnmp camp/cgmp Kinase cnmp RT PCR e c Dual colour FISH of 3p21.31 tandem duplication exon 17 exon 4 SLC26A6 PRKAR2A Supplementary Figure 5 Prevalence of architectures of rearrangements in all 24 breast cancers in the study: Deletion (dark blue), tandem duplication (red), inverted orientation (green), interchromosomal (light blue), breakpoint(s) within an amplicon (orange). 6

7 doi: 1.138/nature8645 No of rearrangements No of rearrangements No of rearrangements No of rearrangements No of rearrangements No of rearrangements > > > >5 HCC2157 HCC1954 HCC1937 HCC > > > >5 HCC1395 HCC1187 HCC1143 HCC > > > >5 HCC2218 PD3664a PD3665a PD3666a > > > >5 PD3667a PD3668a PD3669a PD367a > > > >5 PD3671a PD3672a PD3687a PD3688a > > > >5 PD3689a PD369a PD3693a PD3695a Supplementary Figure 6 Number of nucleotides of overlapping microhomology at rearrangement junctions in the 24 breast cancers. 7

8 doi: 1.138/nature Number of rearrangements >2 Non-templated sequence (bps) Supplementary Figure 7 Nucleotides of non-templated DNA sequence at rearrangement breakpoints in the 24 breast cancers. 8

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Supplementary results

Supplementary results doi:1.138/nature946 Supplementary results Effects of rearrangements on protein coding genes Genomic instability drives cancer development through effects on genes, such as copy number changes, internal

More information

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.

of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase

More information

Role of FISH in Hematological Cancers

Role of FISH in Hematological Cancers Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk

More information

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the

Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant

More information

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Supplementary Information

Supplementary Information Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes.

Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. Supplementary Figure 1 Relationship between genomic features and distributions of RS1 and RS3 rearrangements in breast cancer genomes. (a,b) Values of coefficients associated with genomic features, separately

More information

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010

Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination. May 4, 2010 Canadian College of Medical Geneticists (CCMG) Cytogenetics Examination May 4, 2010 Examination Length = 3 hours Total Marks = 100 (7 questions) Total Pages = 8 (including cover sheet and 2 pages of prints)

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

SALSA MLPA probemix P315-B1 EGFR

SALSA MLPA probemix P315-B1 EGFR SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun

More information

TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations.

TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations. Supplementary Figure 1 TCF3 breakpoints of TCF3-PBX1 (patients 1a 5a) and TCF3-HLF (patients 6a 9a and11a) translocations. The CpG motifs closest to the breakpoints are highlighted in red boxes and the

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

Chromosome Structure & Recombination

Chromosome Structure & Recombination Chromosome Structure & Recombination (CHAPTER 8- Brooker Text) April 4 & 9, 2007 BIO 184 Dr. Tom Peavy Genetic variation refers to differences between members of the same species or those of different

More information

MRC-Holland MLPA. Description version 08; 30 March 2015

MRC-Holland MLPA. Description version 08; 30 March 2015 SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.

More information

Prevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women

Prevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women Prevalence of HPV-16 genomic variant carrying a 63-bp duplicated sequence within the E1 gene in Slovenian women K E Y WORDS HPV-16, cervical cancer, E6-T350G variant A BSTRACT High-risk HPV, particularly

More information

CNV Detection and Interpretation in Genomic Data

CNV Detection and Interpretation in Genomic Data CNV Detection and Interpretation in Genomic Data Benjamin W. Darbro, M.D., Ph.D. Assistant Professor of Pediatrics Director of the Shivanand R. Patil Cytogenetics and Molecular Laboratory Overview What

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency

More information

MRC-Holland MLPA. Description version 12; 13 January 2017

MRC-Holland MLPA. Description version 12; 13 January 2017 SALSA MLPA probemix P219-B3 PAX6 Lot B3-0915: Compared to version B2 (lot B2-1111) two reference probes have been replaced and one additional reference probe has been added. In addition, one flanking probe

More information

Structural Variation and Medical Genomics

Structural Variation and Medical Genomics Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,

More information

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted. mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised

More information

Conditional and reversible disruption of essential herpesvirus protein functions

Conditional and reversible disruption of essential herpesvirus protein functions nature methods Conditional and reversible disruption of essential herpesvirus protein functions Mandy Glaß, Andreas Busche, Karen Wagner, Martin Messerle & Eva Maria Borst Supplementary figures and text:

More information

MRC-Holland MLPA. Description version 14; 28 September 2016

MRC-Holland MLPA. Description version 14; 28 September 2016 SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH- TITLE: PRINCIPAL INVESTIGATOR: CONTRACTING ORGANIZATION: REPORT DATE: TYPE OF REPORT: Annual PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

More information

Variations in Chromosome Structure & Function. Ch. 8

Variations in Chromosome Structure & Function. Ch. 8 Variations in Chromosome Structure & Function Ch. 8 1 INTRODUCTION! Genetic variation refers to differences between members of the same species or those of different species Allelic variations are due

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

High Throughput Sequence (HTS) data analysis. Lei Zhou

High Throughput Sequence (HTS) data analysis. Lei Zhou High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic

More information

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013 Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie

More information

MRC-Holland MLPA. Description version 07; 26 November 2015

MRC-Holland MLPA. Description version 07; 26 November 2015 SALSA MLPA probemix P266-B1 CLCNKB Lot B1-0415, B1-0911. As compared to version A1 (lot A1-0908), one target probe for CLCNKB (exon 11) has been replaced. In addition, one reference probe has been replaced

More information

Supplementary Information. Supplementary Figures

Supplementary Information. Supplementary Figures Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor

More information

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G.

CNV detection. Introduction and detection in NGS data. G. Demidov 1,2. NGSchool2016. Centre for Genomic Regulation. CNV detection. G. Introduction and detection in NGS data 1,2 1 Genomic and Epigenomic Variation in Disease group, Centre for Genomic Regulation 2 Universitat Pompeu Fabra NGSchool2016 methods: methods Outline methods: methods

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA

ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA ONE STEP MULTIPLEX RT-PCR FOR BCRlABL GENE IN MALAY PATIENTS DIAGNOSED AS LEUKAEMIA 1Rosline H, 1Majdan R, 1Wan Zaidah A, 1Rapiaah M, 1Selamah G, 2A A Baba, 3D M Donald 1Department of Haematology, 2Department

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns

Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns Applications of Chromosomal Microarray Analysis (CMA) in pre- and postnatal Diagnostic: advantages, limitations and concerns جواد کریمزاد حق PhD of Medical Genetics آزمايشگاه پاتوبيولوژي و ژنتيك پارسه

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes

Origin of oncogenes? Oncogenes and Proto-oncogenes. Jekyll and Hyde. Oncogene hypothesis. Retroviral oncogenes and cell proto-oncogenes Oncogenes and Proto-oncogenes Jekyll and Hyde A double edged sword Origin of oncogenes? Oncogene hypothesis Retroviral oncogenes and cell proto-oncogenes (v-onc) (c-onc) The role of c-onc in cancer How

More information

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis

Nucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor

More information

Chromosomal Aberrations

Chromosomal Aberrations Chromosomal Aberrations Chromosomal Aberrations Abnormalities of chromosomes may be either numerical or structural and may involve one or more autosomes, sex chromosomes, or both simultaneously. Numerical

More information

Molecular Diagnosis. Nucleic acid based testing in Oncology

Molecular Diagnosis. Nucleic acid based testing in Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,

More information

MRC-Holland MLPA. Description version 06; 23 December 2016

MRC-Holland MLPA. Description version 06; 23 December 2016 SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated

More information

Nature Medicine: doi: /nm.4322

Nature Medicine: doi: /nm.4322 1 2 3 4 5 6 7 8 9 10 11 Supplementary Figure 1. Predicted RNA structure of 3 UTR and sequence alignment of deleted nucleotides. (a) Predicted RNA secondary structure of ZIKV 3 UTR. The stem-loop structure

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis.

Nature Genetics: doi: /ng Supplementary Figure 1. Details of sequencing analysis. Supplementary Figure 1 Details of sequencing analysis. (a) Flow chart showing which patients fall into each category and were used for analysis. (b) Graph showing the average and median coverage for all

More information

GENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute

GENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22. Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

IHCP bulletin INDIANA HEALTH COVERAGE PROGRAMS BT MARCH 13, 2012

IHCP bulletin INDIANA HEALTH COVERAGE PROGRAMS BT MARCH 13, 2012 IHCP bulletin INDIANA HEALTH COVERAGE PROGRAMS BT201208 MARCH 13, 2012 Updates to the 2012 Healthcare Common Coding System This bulletin updates information published by the Indiana Health Coverage Programs

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases. Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

More information

2017 Diagnostic Slide Session Case 3

2017 Diagnostic Slide Session Case 3 2017 Diagnostic Slide Session Case 3 Andrew Gao, MD Lili-Naz Hazrati, MD, PhD Cynthia Hawkins, MD, PhD Hospital for Sick Children and University of Toronto, Toronto, Canada Disclosures: none Clinical History

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

Supplementary Figure 1. Spectrum and signatures of substitutions.

Supplementary Figure 1. Spectrum and signatures of substitutions. Supplementary Figure 1. Spectrum and signatures of substitutions. a. Heatmaps of trinucleotide context of substitutions. Each square represents a substitution in a specific trinucleotide context, normalised

More information

BIOL2005 WORKSHEET 2008

BIOL2005 WORKSHEET 2008 BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your

More information

Rapid genomic screening of embryos using nanopore sequencing

Rapid genomic screening of embryos using nanopore sequencing Rapid genomic screening of embryos using nanopore sequencing Daniel J Turner, PhD Senior Director of Applications Oxford Nanopore Technologies Forman EJ & Scott RT Jr Contemporary OB/GYN () 2014 Euploid

More information

Supplemental Figure S1A Notch1

Supplemental Figure S1A Notch1 Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

SALSA MLPA KIT P060-B2 SMA

SALSA MLPA KIT P060-B2 SMA SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the

More information

Molecular Markers in Acute Leukemia. Dr Muhd Zanapiah Zakaria Hospital Ampang

Molecular Markers in Acute Leukemia. Dr Muhd Zanapiah Zakaria Hospital Ampang Molecular Markers in Acute Leukemia Dr Muhd Zanapiah Zakaria Hospital Ampang Molecular Markers Useful at diagnosis Classify groups and prognosis Development of more specific therapies Application of risk-adjusted

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

CHAPTER 17 CHROMOSOME REARRANGEMENTS

CHAPTER 17 CHROMOSOME REARRANGEMENTS CHROMOSOME REARRANGEMENTS CHAPTER 17 Figure 1. Comparing an ideogram of the human chromosome 2 to the equivalent chromosomes in chimpanzees, we notice that the human chromosome 2 likely came from a fusion

More information

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge

The mutations that drive cancer. Paul Edwards. Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge The mutations that drive cancer Paul Edwards Department of Pathology and Cancer Research UK Cambridge Institute, University of Cambridge Previously on Cancer... hereditary predisposition Normal Cell Slightly

More information

Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18

Understanding genetics, mutation and other details. Stanley F. Nelson, MD 6/29/18 Understanding genetics, mutation and other details Stanley F. Nelson, MD 6/29/18 1 6 11 16 21 Duchenne muscular dystrophy 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 600 500 400 300 200 100 0 Duchenne/Becker

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

MRC-Holland MLPA. Description version 30; 06 June 2017

MRC-Holland MLPA. Description version 30; 06 June 2017 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0517, C1-0114. As compared to the previous B2 version (lot B2-0813, B2-0912), 11 target probes are replaced or added, and 10 new reference probes are

More information

Problem Set 5 KEY

Problem Set 5 KEY 2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development

More information

Chromosome Abnormalities

Chromosome Abnormalities Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present

More information

Supplementary Figure 1 Overall study design

Supplementary Figure 1 Overall study design Supplementary Figure 1 Overall study design We obtained 19 tumour specimens from 14 men with prostate cancer who harboured pathogenic germline BRCA2-mutations. Germline DNA was available for five patients

More information

Chronic myeloid leukemia (CML)

Chronic myeloid leukemia (CML) Bioscientia Int. Support Services Dept. Konrad-Adenauer-Strasse 17 55218 Ingelheim Germany Phone 49(0)6132-781-203 49(0)6132-781-224 49(0)6132-781-165 Fax 49(0)6132-781-236 int.support@bioscientia.com

More information

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes

More information

MRC-Holland MLPA. Description version 19;

MRC-Holland MLPA. Description version 19; SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

More information

MRC-Holland MLPA. Description version 29; 31 July 2015

MRC-Holland MLPA. Description version 29; 31 July 2015 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082

More information

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines.

Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. Supplementary Figure 1: Tissue of Origin analysis on 152 cell lines. (a) Heatmap representation of the 30 Tissue scores for the 152 cell lines. The scores summarize the global expression of the tissue

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity

Antibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of

More information

Test Name Results Units Bio. Ref. Interval. Positive

Test Name Results Units Bio. Ref. Interval. Positive LL - LL-ROHINI (NATIONAL REFERENCE 135091534 Age 36 Years Gender Female 1/9/2017 120000AM 1/9/2017 105316AM 2/9/2017 104147AM Ref By Final LEUKEMIA GENETIC ROFILE ANY SIX MARKERS, CR QUALITATIVE AML ETO

More information

Supplementary Fig. S1. Schematic diagram of minigenome segments.

Supplementary Fig. S1. Schematic diagram of minigenome segments. open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc. Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

More information

MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival

MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival in partnership with MYC Translocations In Multiple Myeloma Involve Recruitment Of Enhancer Elements Resulting In Over- Expression and Decreased Overall Survival Brian A Walker Centre for Myeloma Research,

More information

Quality in Control. ROS1 Analyte Control. Product Codes: HCL022, HCL023 and HCL024

Quality in Control. ROS1 Analyte Control. Product Codes: HCL022, HCL023 and HCL024 Quality in Control ROS1 Analyte Control Product Codes: HCL022, HCL023 and HCL024 Contents What is ROS1? 2 The Role of ROS1 in Cancer 3 ROS1 Assessment 3 ROS1 Analyte Control Product Details 4 ROS1 Analyte

More information

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix.

New: P077 BRCA2. This new probemix can be used to confirm results obtained with P045 BRCA2 probemix. SALSA MLPA KIT P045-B2 BRCA2/CHEK2 Lot 0410, 0609. As compared to version B1, four reference probes have been replaced and extra control fragments at 100 and 105 nt (X/Y specific) have been included. New:

More information

How do living things Sexually Reproduce?

How do living things Sexually Reproduce? How do living things Sexually Reproduce? Besides animals, what other things reproduce sexually? Think of a family that has both biological parents and has 2 or more children #1 Consider what the parents

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome

More information

Structural Chromosome Aberrations

Structural Chromosome Aberrations Structural Chromosome Aberrations 2 Structural chromosome aberrations or chromosome mutations represent apart from aneuploidies the most frequent pathologic findings in applied chromosome diagnostics.

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information