Overview of Current Tools and Approaches Used to Demonstrate Epigenetic Effects

Size: px
Start display at page:

Download "Overview of Current Tools and Approaches Used to Demonstrate Epigenetic Effects"

Transcription

1 Use of Emerging Science and Technologies to Explore Epigenetic Mechanisms Underlying the Developmental Basis for Disease NAS, Washington DC, July 2009 Overview of Current Tools and Approaches Used to Demonstrate Epigenetic Effects John M. Greally MB PhD Center for Epigenomics Division of Computational Genetics, Department of Genetics Division of Hematology, Department of Medicine Albert Einstein College of Medicine, Bronx, NY

2 Tools and approaches to study epigenomic dysregulation Challenges in studying epigenomic dysregulation in human disease Many regulators of epigenomic (and transcriptional) organisation to study Current technologies available to study the epigenome What we find when we study human disease Study design issues, ideal technologies

3 Which regulator of epigenomic organisation to study Challenges in studying epigenomic dysregulation in human disease Many regulators of epigenomic (and transcriptional) organisation to study Current technologies available to study the epigenome What we find when we study human disease Study design issues, ideal technologies

4 Which regulator of epigenomic organisation to study Molecular mediators of epigenetic and transcriptional regulation Histones and variants

5 Which regulator of epigenomic organisation to study Molecular mediators of epigenetic and transcriptional regulation Nucleosomal positioning, nucleosome-free/dnase HS regions

6 Which regulator of epigenomic organisation to study Molecular mediators of epigenetic and transcriptional regulation Histone post-translational modifications

7 Which regulator of epigenomic organisation to study Molecular mediators of epigenetic and transcriptional regulation Regulatory or transcriptional enzyme complexes Chromatin looping

8 Which regulator of epigenomic organisation to study Molecular mediators of epigenetic and transcriptional regulation DNA properties Cytosine methylation (hydroxymethylation) Physical properties of DNA DNA sequence variability

9 Which regulator of epigenomic organisation to study Transcriptional relationships

10 Which assay to use Challenges in studying epigenomic dysregulation in human disease Many regulators of epigenomic (and transcriptional) organisation to study Current technologies available to study the epigenome What we find when we study human disease Study design issues, ideal technologies

11 Epigenomic assays Chromatin immunoprecipitation (ChIP) assays

12 Epigenomic assays Chromatin immunoprecipitation (ChIP) assays

13 Epigenomic assays Other nucleosome positioning assays: nucleosome-free regions

14 Epigenomic assays Other nucleosome positioning assays: nucleosome-free regions

15 Epigenomic assays Transcriptional assays Microarray or massively-parallel sequencing Choice of RNA preparations: Total RNA mrna nuclear RNA, primary transcript small RNAs Massively-parallel sequencing strategies Quantitative (relative expression levels) Qualitative (alternative splicing) Directional

16 Epigenomic assays Cytosine methylation assays

17 Epigenomic assays Epigenomic assay comparisons Assay Sample preparation issues Cell numbers required ChIP Nucleosome positioning Transcription Needs immediate sample processing Needs immediate sample processing Sample should be immediately flash-frozen or processed (10 5 -) 10 7 < (10 5 -) 10 7 < (10 4 -) 10 6 Cytosine methylation Sample should be frozen < (10 4 -) 10 6

18 Epigenomic assays Epigenomic assay comparisons Assay Quantitative capability of genome-scale assay Resolution of genomescale assay ChIP Poor Hundreds of basepairs Nucleosome positioning Poor Hundreds of basepairs Transcription Good Exon-specific Cytosine methylation Fair One to hundreds of basepairs

19 Epigenomic assays Epigenomic assay comparisons When studying human clinical samples, current genome-wide approaches almost exclusively focus on cytosine methylation and transcriptional

20 Epigenomic assays Signal/noise issues: massively-parallel sequencing beats microarrays ENCODE Technology Development NIH (NHGRI) R01 HG Co-investigators Brad Bernstein (MGH/Broad), Andi Gnirke (Broad)

21 Epigenomic assays Signal/noise issues: cytosine methylation assays CG dinucleotide density dependence

22 Epigenomic assays Cytosine methylation assays Distribution of CG dinucleotides in human genome 23 million CGs per haploid male genome CpG islands 7% Generally unmethylated Repetitive DNA 51% Generally methylated Other DNA 41%? Most current assays directed at CpG islands/promoters Readily interpretable Just looking for acquisition of methylation as abnormal outcome

23 Epigenomic assays Cytosine methylation assays No single assay does it all Genome-wide Nucleotide resolution Quantitative High sample throughput Cost efficient Three types of assays have emerged DISCOVERY Genome-wide, lower resolution COMPREHENSIVE Quantitative, nucleotide resolution POPULATION High sample throughput

24 Epigenomic assays A choice of assays available DISCOVERY Restriction enzyme-based (HELP, mcrbc) Affinity-based (medip, MIRA) Large proportion of genome, low resolution, small sample number Massively-parallel sequencing (MPS) COMPREHENSIVE Cloning and sequencing Pyrosequencing (Biotage) MassArray (Sequenom) Nucleotide resolution, very limited proportion of genome, moderate sample number Massively-parallel sequencing -- SeqCap bisulphite POPULATION MethylLight, Methylation-Specific Primer (MSP), Infinium (Illumina) Studies ~1 CG dinucleotide at a time, large sample numbers

25 Epigenomic assays A choice of assays available DISCOVERY Restriction enzyme-based (HELP, mcrbc) Affinity-based (medip, MIRA) Large proportion of genome, low resolution, small sample number Massively-parallel sequencing (MPS) COMPREHENSIVE Cloning and sequencing Pyrosequencing (Biotage) MassArray (Sequenom) Nucleotide resolution, very limited proportion of genome, moderate sample number Massively-parallel sequencing -- SeqCap bisulphite POPULATION MethylLight, Methylation-Specific Primer (MSP), Infinium (Illumina) Studies ~1 CG dinucleotide at a time, large sample numbers

26 Epigenomic assays Discovery platforms and methylation states Methylation at a CG dinucleotide predictive of nearby CGs The 1.32 million locus human microarray HELP platform flags two-thirds of CGs in genome Eckhardt F, Lewin J, Cortese R, Rakyan VK, Attwood J, Burger M, Burton J, Cox TV, Davies R, Down TA, Haefliger C, Horton R, Howe K, Jackson DK, Kunde J, Koenig C, Liddle J, Niblett D, Otto T, Pettett R, Seemann S, Thompson C, West T, Rogers J, Olek A, Berlin K, Beck S. DNA methylation profiling of human chromosomes 6, 20 and 22. Nat Genet Dec;38(12):

27 Epigenomic assays HELP assay (version 1) Khulan B., Thompson R.F., Ye K., Fazzari M.J., Suzuki M., Stasiek E., Figueroa M.E., Glass J.L., Chen Q., Montagna C., Hatchwell E., Selzer R.R., Richmond T.A., Green R.D., Melnick A., Greally J.M. Comparative isoschizomer profiling of cytosine methylation: The HELP assay. Genome Research 2006 Aug;16(8):

28 Epigenomic assays Supporting analytical tools essential Hypomethylated Methylated

29 Epigenomic assays High-resolution HELP (version 2) Improved representations Multiple species Human > 1.32 million loci Mouse > 1.01 million loci Rat > 1.10 million loci Cow > 1.10 million loci

30 Epigenomic assays New applications: nanohelp Amit Verma lab (Einstein) 5,000 cell genome equivalents

31 Epigenomic assays New assays: HELP-tagging (version 4) Used Illumina platform for these data

32 Epigenomic assays HELP-tagging

33 Epigenomic assays HELP-tagging

34 Epigenomic assays HELP-tagging Similar assay to MSCC Relatively quantitative

35 Which assay to use Challenges in studying epigenomic dysregulation in human disease Many regulators of epigenomic (and transcriptional) organisation to study Current technologies available to study the epigenome What we find when we study human disease Study design issues, ideal technologies

36 Genomic distribution of epigenomic dysregulation Disease studies Epigenome-wide association studies (EWAS) Diseases: Cancers (oesophageal, breast) [human] Intrauterine growth restriction [rat] High-resolution microarray-based HELP assays Bisulphite MassArray validation

37 Epigenomic dysregulation in human disease Epigenomic dysregulation in cancer Amit Verma, Einstein

38 Genomic distribution of epigenomic dysregulation Human breast adenocarcinoma Pilot study: selected 10 pairs of tumour and grossly-normal adjacent tissue HELP assays performed on all Focus on genomics of changes Where in the genome are the most informative changes? Current beliefs suggest CpG islands should acquire methylation, transposable elements should lose methylation.

39 Genomic distribution of epigenomic dysregulation Human breast adenocarcinoma Overall results Top 1% of loci Changes from methylated to hypomethylated Changes from hypomethylated to methylated Repetitive element 72% 38% Intergenic DNA 24% 33% CG density 2.8% CG cluster 1.6% CpG island 24% CG cluster 12% CpG island Gene structure 0.6% promoter 5.3% gene body 7% promoter 26% gene body

40 Genomic distribution of epigenomic dysregulation Human breast adenocarcinoma Relative to genes Most of the consistent changes seen in these tumours are not located within promoters.

41 Genomic distribution of epigenomic dysregulation Human breast adenocarcinoma CG density The CG depleted regions of the genome are more informative than the CG rich

42 Genomic distribution of epigenomic dysregulation Human breast adenocarcinoma While data confirm prior observations of dysregulation of the cancer epigenome... Loss of methylation of transposable elements Acquisition of methylation by CG-dense sequences...the genome-wide approach makes new observations Intergenic regions often dysregulated CG clusters a better annotation than CpG islands when looking for targets of dysregulation The CG-depleted majority of the genome contains most of the informative changes

43 Genomic distribution of epigenomic dysregulation Rat intrauterine growth restriction (IUGR) Risk of adult type 2 diabetes mellitus in later life Does the epigenome mediate the cellular memory of prenatal event?

44 Genomic distribution of epigenomic dysregulation Rat intrauterine growth restriction (IUGR)

45 Epigenomic dysregulation in human disease Rat intrauterine growth restriction (IUGR) HELP tracks at Gch1 show non-promoter changes

46 Epigenomic dysregulation in human disease Rat intrauterine growth restriction (IUGR) Validated a conserved intergenic locus 45 kb upstream of Gch1

47 Epigenomic dysregulation in human disease Rat intrauterine growth restriction (IUGR) Bisulphite MassArray analysis of conserved 45 kb upstream element Significant changes of magnitude 20-30%

48 Epigenomic dysregulation in human disease Rat intrauterine growth restriction (IUGR) Bisulphite MassArray analysis of conserved 45 kb upstream element Significant changes of magnitude 20-30% Non-promoter cytosine methylation changes associated with local gene expression changes

49 Epigenomic dysregulation in human disease How to interpret small differences in epigenetic regulatory patterns In non-cancer conditions, degrees of difference are small and at restricted numbers of loci

50 Epigenomic dysregulation in human disease How to interpret small differences in epigenetic regulatory patterns Tissue-specific differences of comparable magnitude

51 Epigenomic dysregulation in human disease How to interpret small differences in epigenetic regulatory patterns If fixed, must be occurring in cellular subpopulations

52 Epigenomic dysregulation in human disease How to interpret small differences in epigenetic regulatory patterns If not fixed, may be oscillating in all cells

53 Epigenomic dysregulation in human disease How to interpret small differences in epigenetic regulatory patterns May be affecting functionally-specialised subpopulations of cells

54 Study design in epigenome-wide association studies Challenges in studying epigenomic dysregulation in human disease Many regulators of epigenomic (and transcriptional) organisation to study Current technologies available to study the epigenome What we find when we study human disease Study design issues, ideal technologies

55 Study design in epigenomics projects Epigenomics and human disease Technologies have to have two characteristics Quantitative Genome-wide Cohorts studied Well-characterised Adequate sample size for power Cell samples Pure (>90%) Well-characterised Two stage design Genome-wide, identify candidates Single-locus, quantitative

56 Study design in epigenome-wide association studies ChIP-based and nucleosomal positioning assays Probably insufficiently quantitative to detect moderate changes Shahin Rafii, Weill-Cornell Aaron Goldberg, David Allis, Rockefeller

57 Study design in epigenome-wide association studies HELP-tagging Similar assay to MSCC Relatively quantitative 100/80%80/60%60/40%40/20%20/0%

58 Study design in epigenome-wide association studies SNPs Especially a problem in cytosine methylation studies Deamination of methylated CG dinucleotides Need to sequence native as well as bisulphite-converted sequence Confound MassArray and restriction enzyme-based assays ACATCCACGTmeCGAC TT Bisulphite conversion AUATUUAUGT mecgau TT PCR ATATTTATGTCGATT T

59 Study design in epigenome-wide association studies Power calculations Number of subjects needed to identify real differences in cytosine methylation Using Church's regression equation (methylation = *counts), we may simulate individual counts based on control samples having 60% methylation and cases having 80% methylation using a poisson distribution with a count of 3.6 and 1.76 respectively. Power is defined as the Pr(Reject the null of no difference in counts between cases and controls) under differential methylation (80 vs. 60 percent). A p value cutoff of 0.05 represents the conventional threshold, without adjustment for multiple testing. A p value cutoff of 5e 8 represents a conservative (Bonferroni like) adjustment assuming 1 million independent tests are performed. Based on the simulated data described above, sample sizes of per group are necessary to have Melissa Fazzari sufficient (Einstein) power given the subtle differences in methylation hypothesized as well as the large number of tests performed.

60 Studying epigenomic dysregulation in human disease Epigenomic dysregulation studies at Einstein Center for Epigenomics Cancer epigenomics Neuroepigenomics Epigenomics of infectious disease Epigenomics of ageing

61 Acknowledgements Lab personnel Masako Suzuki Niru Narayanan Reid Thompson Edyta Stasiek Marién Pascual Not pictured: Niki Athanasiadou Maria-Paz Ramos Kevin Lau Former lab personnel Mayumi Oda Khulan Batbayar Jacob Glass Priti Tewari Einstein Center for Epigenomics investigators R. Suzanne Zukin Kami Kim Eric E. Bouhassira Simon Spivack Amit Verma Nir Barzilai Francine Einstein Einstein Epigenomics Shared Facility Shahina Maqbool Raul Olea Gael Westby Einstein Computational Epigenomics group Andy McLellan A.J. Jing Rob Dubin Collaborators Cornell University Ari Melnick Grenoble Saadi Khochbin Roche NimbleGen Systems Inc. Jeff Jeddeloh National University of Ireland, Galway Aaron Golden University of Tokyo Kunio Shiota MGH/Broad Brad Bernstein Andi Gnirke Einstein Computational and Statistical Epigenomics Group Melissa J. Fazzari Deyou Zheng Grant support NIH (NCI) R21 CA NIH (NICHD) R01 HD NIH (NHGRI) R01 HG High Q Foundation

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Epigenetics and Chromatin Remodeling

Epigenetics and Chromatin Remodeling Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Accessing and Using ENCODE Data Dr. Peggy J. Farnham

Accessing and Using ENCODE Data Dr. Peggy J. Farnham 1 William M Keck Professor of Biochemistry Keck School of Medicine University of Southern California How many human genes are encoded in our 3x10 9 bp? C. elegans (worm) 959 cells and 1x10 8 bp 20,000

More information

Trace Metals and Placental Methylation

Trace Metals and Placental Methylation Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular

More information

The Epigenome Tools 2: ChIP-Seq and Data Analysis

The Epigenome Tools 2: ChIP-Seq and Data Analysis The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,

More information

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc

Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes

More information

Integrated genomic analysis of human osteosarcomas

Integrated genomic analysis of human osteosarcomas Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian

More information

Epigenetics: A historical overview Dr. Robin Holliday

Epigenetics: A historical overview Dr. Robin Holliday Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.

More information

Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum

Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Mary Beth Terry, Jasmine A. McDonald, Hui Chen Wu, Sybil Eng and Regina M. Santella Abstract Epigenetic biomarkers,

More information

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap

More information

Epigenetics: Basic Principals and role in health and disease

Epigenetics: Basic Principals and role in health and disease Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics

More information

The silence of the genes: clinical applications of (colorectal) cancer epigenetics

The silence of the genes: clinical applications of (colorectal) cancer epigenetics The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical

More information

Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.

Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati Background Breast cancer (BCa) The second most common cancer among women in

More information

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice

An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of

More information

Environmental programming of respiratory allergy in childhood: the applicability of saliva

Environmental programming of respiratory allergy in childhood: the applicability of saliva Environmental programming of respiratory allergy in childhood: the applicability of saliva 10/12/2013 to study the effect of environmental exposures on DNA methylation Dr. Sabine A.S. Langie Flemish Institute

More information

Chromatin-Based Regulation of Gene Expression

Chromatin-Based Regulation of Gene Expression Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators

More information

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes

More information

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery

Screening for novel oncology biomarker panels using both DNA and protein microarrays. John Anson, PhD VP Biomarker Discovery Screening for novel oncology biomarker panels using both DNA and protein microarrays John Anson, PhD VP Biomarker Discovery Outline of presentation Introduction to OGT and our approach to biomarker studies

More information

Analysis of shotgun bisulfite sequencing of cancer samples

Analysis of shotgun bisulfite sequencing of cancer samples Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The

More information

What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine?

What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? by Robert John Hollows This project is submitted in partial fulfilment of the requirements

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA

More information

Epigenetic processes are fundamental to development because they permit a

Epigenetic processes are fundamental to development because they permit a Early Life Nutrition and Epigenetic Markers Mark Hanson, PhD Epigenetic processes are fundamental to development because they permit a range of phenotypes to be formed from a genotype. Across many phyla

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

2009 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.

2009 LANDES BIOSCIENCE. DO NOT DISTRIBUTE. [Epigenetics 4:2, 1-6; 16 February 2009]; 2009 Landes Bioscience Research Paper Determining the conservation of DNA methylation in Arabidopsis This manuscript has been published online, prior to printing.once

More information

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN

Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Epigenetic Principles and Mechanisms Underlying Nervous System Function in Health and Disease Mark F. Mehler MD, FAAN Institute for Brain Disorders and Neural Regeneration F.M. Kirby Program in Neural

More information

Histones modifications and variants

Histones modifications and variants Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome

More information

Molecular Biology (BIOL 4320) Exam #2 April 22, 2002

Molecular Biology (BIOL 4320) Exam #2 April 22, 2002 Molecular Biology (BIOL 4320) Exam #2 April 22, 2002 Name SS# This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses after the question number. Good

More information

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics

Epigenetics 101. Kevin Sweet, MS, CGC Division of Human Genetics Epigenetics 101 Kevin Sweet, MS, CGC Division of Human Genetics Learning Objectives 1. Evaluate the genetic code and the role epigenetic modification plays in common complex disease 2. Evaluate the effects

More information

Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma.

Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma. Epigenetic Markers for Transplacental Exposure to Airborne Polycyclic Aromatic Hydrocarbons (PAHs( PAHs) ) and Childhood Asthma Winnie Wan-yee Tang, Ph.D Department of Environmental Health University of

More information

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6 Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early

More information

ChIP-seq data analysis

ChIP-seq data analysis ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional

More information

Back to the Basics: Methyl-Seq 101

Back to the Basics: Methyl-Seq 101 Back to the Basics: Methyl-Seq 101 Presented By: Alex Siebold, Ph.D. October 9, 2013 Field Applications Scientist Agilent Technologies Life Sciences & Diagnostics Group Life Sciences & Diagnostics Group

More information

High-throughput transcriptome sequencing

High-throughput transcriptome sequencing High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Repressive Transcription

Repressive Transcription Repressive Transcription The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation As Published Publisher Guenther, M. G., and R. A.

More information

Phylogenomics. Antonis Rokas Department of Biological Sciences Vanderbilt University.

Phylogenomics. Antonis Rokas Department of Biological Sciences Vanderbilt University. Phylogenomics Antonis Rokas Department of Biological Sciences Vanderbilt University http://as.vanderbilt.edu/rokaslab High-Throughput DNA Sequencing Technologies 454 / Roche 450 bp 1.5 Gbp / day Illumina

More information

Assignment 5: Integrative epigenomics analysis

Assignment 5: Integrative epigenomics analysis Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What

More information

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos

Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Aliccia Bollig-Fischer, PhD Department of Oncology, Wayne State University Associate Director Genomics Core Molecular Therapeutics Program Karmanos Cancer Institute Development of a multiplexed assay to

More information

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ

More information

Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16

Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes

More information

Peak-calling for ChIP-seq and ATAC-seq

Peak-calling for ChIP-seq and ATAC-seq Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq

More information

Eukaryotic Gene Regulation

Eukaryotic Gene Regulation Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,

More information

Measuring DNA Methylation with the MinION

Measuring DNA Methylation with the MinION Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University Epigenetics: Modern Modern Definition of epigenetics involves heritable changes other

More information

Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012

Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder Labs August 30, 2012 Elucidating Transcriptional Regulation at Multiple Scales Using High-Throughput Sequencing, Data Integration, and Computational Methods Raymond Auerbach PhD Candidate, Yale University Gerstein and Snyder

More information

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD

RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration

More information

Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers

Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers

More information

Are you the way you are because of the

Are you the way you are because of the EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders

More information

Epigenetics in evolution and disease

Epigenetics in evolution and disease Epigenetics in evolution and disease Manel Esteller We are not our genes. Genes are just part of the story. We cannot fully blame our genome for our behaviour and susceptibility to disease. In Lehninger

More information

Gene Expression DNA RNA. Protein. Metabolites, stress, environment

Gene Expression DNA RNA. Protein. Metabolites, stress, environment Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory

More information

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1

Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture

More information

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club

Biomarker development in the era of precision medicine. Bei Li, Interdisciplinary Technical Journal Club Biomarker development in the era of precision medicine Bei Li, 23.08.2016 Interdisciplinary Technical Journal Club The top ten highest-grossing drugs in the United States help between 1 in 25 and 1 in

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality. Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with

More information

Epigenetics and Environmental Health A Step-by-Step Tutorial

Epigenetics and Environmental Health A Step-by-Step Tutorial Powerful ideas for a healthier world Epigenetics and Environmental Health A Step-by-Step Tutorial Andrea Baccarelli, MD, PhD, MPH Laboratory of Environmental Epigenetics Objective of my presentation To

More information

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.

Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data

More information

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016

Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016 Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important

More information

TITLE: Unique Genomic Alterations in Prostate Cancers in African American Men

TITLE: Unique Genomic Alterations in Prostate Cancers in African American Men AD Award Number: W81XWH-12-1-0046 TITLE: Unique Genomic Alterations in Prostate Cancers in African American Men PRINCIPAL INVESTIGATOR: Michael Ittmann, M.D., Ph.D. CONTRACTING ORGANIZATION: Baylor College

More information

Lecture 27. Epigenetic regulation of gene expression during development

Lecture 27. Epigenetic regulation of gene expression during development Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation

More information

Studying Alternative Splicing

Studying Alternative Splicing Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology

More information

DNA methylation: a potential clinical biomarker for the detection of human cancers

DNA methylation: a potential clinical biomarker for the detection of human cancers DNA methylation: a potential clinical biomarker for the detection of human cancers Name: Tong Samuel Supervisor: Zigui CHEN Date: 1 st December 2016 Department: Microbiology Source: cited from Jakubowski,

More information

Genetic Counselling in relation to genetic testing

Genetic Counselling in relation to genetic testing Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major

More information

September 20, Submitted electronically to: Cc: To Whom It May Concern:

September 20, Submitted electronically to: Cc: To Whom It May Concern: History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).

More information

Global Epigenetic and Transcriptional Trends among Two Rice Subspecies and Their Reciprocal Hybrids W

Global Epigenetic and Transcriptional Trends among Two Rice Subspecies and Their Reciprocal Hybrids W The Plant Cell, Vol. 22: 17 33, January 2010, www.plantcell.org ã 2010 American Society of Plant Biologists RESEARCH ARTICLES Global Epigenetic and Transcriptional Trends among Two Rice Subspecies and

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

QIAGEN Driving Innovation in Epigenetics

QIAGEN Driving Innovation in Epigenetics QIAGEN Driving Innovation in Epigenetics EpiTect and PyroMark A novel Relation setting Standards for the reliable Detection and accurate Quantification of DNA-Methylation May 2009 Gerald Schock, Ph.D.

More information

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells

STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells CAMDA 2009 October 5, 2009 STAT1 regulates microrna transcription in interferon γ stimulated HeLa cells Guohua Wang 1, Yadong Wang 1, Denan Zhang 1, Mingxiang Teng 1,2, Lang Li 2, and Yunlong Liu 2 Harbin

More information

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region

Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,

More information

Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs

Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs Roos et al. Clinical Epigenetics (2016) 8:7 DOI 10.1186/s13148-016-0172-y RESEARCH Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs Open Access Leonie

More information

Registration Continental Breakfast. Histone Modifications and Cancer- Part 1

Registration Continental Breakfast. Histone Modifications and Cancer- Part 1 Miami Epigenetics & Cancer Symposium Sunday, November 27 Tuesday, November 29, 2016 Ritz-Carlton, Miami Beach Conference Room: Collins for the Office SPEAKERS PROGRAM Sunday, November 27, 2016 Speakers

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

Eukaryotic transcription (III)

Eukaryotic transcription (III) Eukaryotic transcription (III) 1. Chromosome and chromatin structure Chromatin, chromatid, and chromosome chromatin Genomes exist as chromatins before or after cell division (interphase) but as chromatids

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Milk micro-rna information and lactation

Milk micro-rna information and lactation Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development?

More information

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS

R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Mechanisms of alternative splicing regulation

Mechanisms of alternative splicing regulation Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for

More information

Epigenomics. Ivana de la Serna Block Health Science

Epigenomics. Ivana de la Serna Block Health Science Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications

More information

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To

More information

Integrated analysis of sequencing data

Integrated analysis of sequencing data Integrated analysis of sequencing data How to combine *-seq data M. Defrance, M. Thomas-Chollier, C. Herrmann, D. Puthier, J. van Helden *ChIP-seq, RNA-seq, MeDIP-seq, Transcription factor binding ChIP-seq

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells. Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

More information

Cover Page. The handle holds various files of this Leiden University dissertation

Cover Page. The handle   holds various files of this Leiden University dissertation Cover Page The handle http://hdl.handle.net/1887/30776 holds various files of this Leiden University dissertation Author: Talens, Rudolf P. Title: Studies into epigenetic variation and its contribution

More information

Variation in 5-hydroxymethylcytosine across human cortex and cerebellum

Variation in 5-hydroxymethylcytosine across human cortex and cerebellum Cover art produced by Helen Spiers (www.helenspiers.com) Variation in 5-hydroxymethylcytosine across human cortex and cerebellum Lunnon et al. Lunnon et al. Genome Biology (2016) 17:27 DOI 10.1186/s13059-016-0871-x

More information

FONS Nové sekvenační technologie vklinickédiagnostice?

FONS Nové sekvenační technologie vklinickédiagnostice? FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables

More information