Gene expression profiling in single cells

Size: px
Start display at page:

Download "Gene expression profiling in single cells"

Transcription

1 Gene expression profiling in single cells Anders Ståhlberg Department of Chemistry & Biosciences / Molecular Biotechnology Chalmers University of Technology

2 Outline Technical considerations Gene expression profiling Outline

3 Why single cells? Background

4 Workflow single cell analysis Ce llcollection c olle c tion methods Cell Lysis Patch clamp capillaries Heat Lysis 80 d e g re e s 5 m in Reverse transcription RT e nzym e Flow cytometry RTp rim e rs Detergents (Igepal, Reproducibility RNa se inhib ito r Triton...) Laser dissection RT Buffe r Sufficient cdna yield Physical disruption RT Background RNA Pre-amplification d e g re e s Data analysis QPCR d e g re e s appropiate statistics number of cells Da ta a na lysis Linear amplification at Real-time PCR mrna level > 3h Gene specific assays amplification at Exponential C DNA cdna PCR inhibition level Limited amount PCR m a ste r m ix of with p rim ematerial rs for biological ta rg e t g e ne s Suitable controls Gene Gene expression expression profiling profiling in in single single cells cells Technical Technical considerations considerations

5 Gene expression in single cells Gene expression Cell number

6 mrna distribution Cell count Cell count Relative transcript levels Relative transcript levels Linear scale Lognormal scale

7 The median cell Geometric mean Arithmetic mean Cell count Relative transcript levels Lognormal scale

8 Effect of glucose Ins1 Ins2 20 mm Arithmetic Geometric ActB Ins Ins mm Abcc Kcnj

9 Models of gene expression Without e nha nc e r With e nh a nc e r Gene Gene E ( N N mrna mrna ) total = N mrna = = 6 Cell Rhe o sta tic m o d e ( N mrna N) total mrna = = 0 + N0 mrna = = Cell 6 Bina ry m o d e

10 Distribution skewness Skewness = Skewness = Skewness = 0 Skewness = 0.06 Skewness =

11 Gene regulation at single cell level Arithmetic Geometric ActB Ins Ins Abcc Kcnj

12 Gene regulation -case I Gene 1 Gene 1 Intermediete Low expression Gene 2 expression Gene 2 High expression

13 Gene regulation -case II Gene 1 Gene 1 Intermediete Low expression Gene 2 expression Gene 2 High expression

14 Gene regulation in individual cells ActB Ins1 Ins2 Sur1 Kcnj11 ActB 1 Ins Ins Sur Kcnj

15 Gene regulation - Ins1 & Ins2 Ins1 Ins1 Intermediete Low expression Ins2 expression Ins2 High expression

16 Gene regulation - Ins1 & ActB / Ins2 & ActB Ins1/2 Ins1/2 Intermediete Low expression ActB expression ActB High expression

17 Conclusions The combination of patch-clamp capillaries and reverse transcription realtime PCR is suitable for gene expression studies in individual cells Gene expression is lognormally distributed at a single cell level Gene regulation at single cell level do not necessary correlate at cell population level Bengtsson M. et al. Genome Research, in press Conclusions

18 Acknowledgments Martin Bengtsson Mikael Kubista Patrik Rorsman TATAA Biocenter

Gene expression profiling in single cells from the pancreatic islets of Langerhans reveals lognormal distribution of mrna levels

Gene expression profiling in single cells from the pancreatic islets of Langerhans reveals lognormal distribution of mrna levels Letter Gene expression profiling in single cells from the pancreatic islets of Langerhans reveals lognormal distribution of mrna levels Martin Bengtsson, 1,2,4 Anders Ståhlberg, 2 Patrik Rorsman, 1,3 and

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,

More information

Quantification of gene expression in single cells

Quantification of gene expression in single cells Quantification of gene expression in single cells Bengtsson, Martin 2007 Link to publication Citation for published version (APA): Bengtsson, M. (2007). Quantification of gene expression in single cells.

More information

RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections

RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections RT-qPCR analysis of laser capture micro-dissected material from CD31 stained FFPE tissue sections Julian Schuster, Beatrix Bahle, Andrea Herold, Sabine Lohmann Roche Innovation Center Penzberg, Germany

More information

RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER

RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER Technology Transfer in Diagnostic Pathology. 6th Central European Regional Meeting. Cytopathology. Balatonfüred, Hungary, April 7-9, 2011. RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER Philippe

More information

STOCS-H Scottish TOC Study HPV test comparison

STOCS-H Scottish TOC Study HPV test comparison STOCS-H Scottish TOC Study HPV test comparison What is entailed? Trial of new HPV tests on residual sample after HC2 result obtained, reported and acted on Complements English Sentinel Sites HPV Multi-test

More information

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

More information

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)

Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences

More information

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.

Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Supplementary Figure 1 Raf-1 inhibition does not affect TLR4-induced type I IFN responses. Real-time PCR analyses of IFNB, ISG15, TRIM5, TRIM22 and APOBEC3G mrna in modcs 6 h after stimulation with TLR4

More information

Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays

Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays Ambient Temperature Stabilization of RNA derived from Jurkat, HeLa and HUVEC Cell Lines for Use in RT-qPCR Assays C. Litterst 1, H. Martinez, B. Iverson and R. Nuňez 1 Bio-Rad Laboratories, Life Science

More information

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was

Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin

More information

Complete Blockage of HBV Virus Replication and Inhibition of cccdna Formation by Core Protein Allosteric Modifiers

Complete Blockage of HBV Virus Replication and Inhibition of cccdna Formation by Core Protein Allosteric Modifiers Complete Blockage of HBV Virus Replication and Inhibition of Formation by Core Protein Allosteric Modifiers G. Renuka Kumar, Yuhua Zong, Alex Mercier, Pao-Chen Li, Cathal Mahon, Emily Connelly, Katherine

More information

Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests

Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research

More information

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML

Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Molecular Detection of BCR/ABL1 for the Diagnosis and Monitoring of CML Imran Mirza, MD, MS, FRCPC Pathology & Laboratory Medicine Institute Sheikh Khalifa Medical City, Abu Dhabi, UAE. imirza@skmc.ae

More information

RNA preparation from extracted paraffin cores:

RNA preparation from extracted paraffin cores: Supplementary methods, Nielsen et al., A comparison of PAM50 intrinsic subtyping with immunohistochemistry and clinical prognostic factors in tamoxifen-treated estrogen receptor positive breast cancer.

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Human influenza A virus subtype (H3)

Human influenza A virus subtype (H3) PCRmax Ltd TM qpcr test Human influenza A virus subtype (H3) Haemoglutinin H3 gene 150 tests For general laboratory and research use only 1 Introduction to Human influenza A virus subtype (H3) Influenza,

More information

For focused group profiling of human HIV infection and host response genes expression

For focused group profiling of human HIV infection and host response genes expression ExProfile TM Human HIV Infection and Host Response Related Gene qpcr Array For focused group profiling of human HIV infection and host response genes expression Cat. No. QG023-A (1 x 96-well plate, Format

More information

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs). MATERIALS AND METHODS Study population Blood samples were obtained from 15 patients with AS fulfilling the modified New York criteria, 6 RA patients and 10 age- and gender-matched healthy controls (HCs).

More information

ExpressArt FFPE Clear RNAready kit

ExpressArt FFPE Clear RNAready kit Features and Example Results General problems with FFPE samples Formalin-fixation of tissues results in severe RNA fragmentation, as well as in RNA RNA, RNA-DNA and RNA protein cross-linking, which impairs

More information

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan

Guangdong Medical University, Zhanjiang, China; 5 Guangxi Medical University, Nanning, China; 6 Department of Pathology, University of Michigan Overexpression of FAM83H-AS1 indicates poor patient survival and knockdown impairs cell proliferation and invasion via MET/EGFR signaling in lung cancer Jie Zhang 1,2, Shumei Feng 3, Wenmei Su 4, Shengbin

More information

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing

QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy

More information

Protocol: specimen preparation (brain dissection and region extraction) for using RT-qPCR to examine gene expression in brain regions of a fish

Protocol: specimen preparation (brain dissection and region extraction) for using RT-qPCR to examine gene expression in brain regions of a fish HOST LAB: DR. LAUREN O'CONNELL, CENTER FOR SYSTEMS BIOLOGY, HARVARD UNIVERSITY Protocol: specimen preparation (brain dissection and region extraction) for using RT-qPCR to examine gene expression in brain

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent

More information

Swine H1N1 Influenza Human Pandemic Strain

Swine H1N1 Influenza Human Pandemic Strain PCRmax Ltd TM qpcr test Swine H1N1 Influenza Human Pandemic Strain M1 - global Influenza A & N1- specific for Swine H1N1 Influenza Human Pandemic Strain 150 tests For general laboratory and research use

More information

Avian influenza A virus subtype (H7)

Avian influenza A virus subtype (H7) TM Primerdesign Ltd Avian influenza A virus subtype (H7) Haemoglutinin H7 gene genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype

More information

Human influenza A virus subtype (H1)

Human influenza A virus subtype (H1) PCRmax Ltd TM qpcr test Human influenza A virus subtype (H1) Haemoglutinin H1 gene 150 tests For general laboratory and research use only 1 Introduction to Human influenza A virus subtype (H1) Influenza,

More information

ncounter TM Analysis System

ncounter TM Analysis System ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

qpcr-array Analysis Service

qpcr-array Analysis Service qpcr-array Analysis Service Customer Name Institute Telephone Address E-mail PO Number Service Code Report Date Service Laboratory Department Phalanx Biotech Group, Inc 6 Floor, No.6, Technology Road 5,

More information

Use of Viral Load Testing in Managing CMV Infections in SOTR

Use of Viral Load Testing in Managing CMV Infections in SOTR Use of Viral Load Testing in Managing CMV Infections in SOTR Angela M. Caliendo, MD, PhD, FIDSA Professor and Vice Chair, Medicine Alpert Medical School of Brown University Providence, RI Disclosures Scientific

More information

Validation of mirnas as Gastric Cancer Biomarkers in Serum and Effect of Chemotherapy on mirna Expression in a Gastric Cancer Cell-Line

Validation of mirnas as Gastric Cancer Biomarkers in Serum and Effect of Chemotherapy on mirna Expression in a Gastric Cancer Cell-Line Validation of mirnas as Gastric Cancer Biomarkers in Serum and Effect of Chemotherapy on mirna Expression in a Gastric Cancer Cell-Line Yeoh Hsin Yee Clarice Raffles Girls School (Secondary) Singapore

More information

Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4)

Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4) Identification and characterization of multiple splice variants of Cdc2-like kinase 4 (Clk4) Vahagn Stepanyan Department of Biological Sciences, Fordham University Abstract: Alternative splicing is an

More information

Swine H1N1 Influenza Human Pandemic Strain

Swine H1N1 Influenza Human Pandemic Strain TM Primerdesign Ltd Swine H1N1 Influenza Human Pandemic Strain M1 - global Influenza A & N1- specific for Swine H1N1 Influenza Human Pandemic Strain genesig Advanced Kit 150 tests For general laboratory

More information

SALSA MLPA KIT P060-B2 SMA

SALSA MLPA KIT P060-B2 SMA SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the

More information

Validation of Housekeeping Genes for Gene Expression Analysis in Glioblastoma Using Quantitative Real-Time Polymerase Chain Reaction

Validation of Housekeeping Genes for Gene Expression Analysis in Glioblastoma Using Quantitative Real-Time Polymerase Chain Reaction ORIGINAL ARTICLE Brain Tumor Res Treat 2015;3(1):24-29 / pissn 2288-2405 / eissn 2288-2413 http://dx.doi.org/10.14791/btrt.2015.3.1.24 Validation of Housekeeping Genes for Gene Expression Analysis in Glioblastoma

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information

More information

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended

More information

Profiles of gene expression & diagnosis/prognosis of cancer Lorena Roa de la Cruz

Profiles of gene expression & diagnosis/prognosis of cancer Lorena Roa de la Cruz Genomics Profiles of gene expression & diagnosis/prognosis of cancer Lorena Roa de la Cruz Gene expression profiling Measurement of the activity of thousands of genes at once Techniques used for gene expression

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven

Deploying the full transcriptome using RNA sequencing. Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Deploying the full transcriptome using RNA sequencing Jo Vandesompele, CSO and co-founder The Non-Coding Genome May 12, 2016, Leuven Roadmap Biogazelle the power of RNA reasons to study non-coding RNA

More information

From reference genes to global mean normalization

From reference genes to global mean normalization From reference genes to global mean normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle qpcr Symposium USA November 9, 2009 Millbrae, CA outline what is normalization

More information

MRC-Holland MLPA. Description version 19;

MRC-Holland MLPA. Description version 19; SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

More information

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang

Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with

More information

Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis

Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis 5/17/13 Refining Prognosis of Early Stage Lung Cancer by Molecular Features (Part 2): Early Steps in Molecularly Defined Prognosis Johannes Kratz, MD Post-doctoral Fellow, Thoracic Oncology Laboratory

More information

Extracellular Vesicle RNA isolation Kits

Extracellular Vesicle RNA isolation Kits Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can

More information

To this end, we performed immunofluorescent staining for GSCs (Fig.3). All the spheroidforming cells showed immunoreactivity for

To this end, we performed immunofluorescent staining for GSCs (Fig.3). All the spheroidforming cells showed immunoreactivity for H.Yoshioka et al. lished for isolation ofneural stem cells. Within 24-48 hours of primary culture, murine brain tumors yielded a minority fraction of cells that formed neurosphere-like clusters (tumor

More information

Deep-Sequencing of HIV-1

Deep-Sequencing of HIV-1 Deep-Sequencing of HIV-1 The quest for true variants Alexander Thielen, Martin Däumer 09.05.2015 Limitations of drug resistance testing by standard-sequencing Blood plasma RNA extraction RNA Reverse Transcription/

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000) CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar

More information

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.

Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+

More information

Human diagnostics. Better be Sure: Quantify HDV & HBV viral load. RoboGene product family

Human diagnostics. Better be Sure: Quantify HDV & HBV viral load. RoboGene product family Human diagnostics Better be Sure: Quantify HDV & HBV viral load. RoboGene product family 2 RoboGene Product Family Improved patient management: Standardized monitoring of HBV DNA and HDV RNA viral load.

More information

HIV-1 Viral Load Real Time (RG)

HIV-1 Viral Load Real Time (RG) -1 Viral Load Real Time (RG) Real Time RT-PCR type 1 RNA quantification assay MSP Reg. pending Valdense 3616. 11700. Montevideo. Uruguay. phone (598) 2 336 83 01. Fax (598) 2 336 71 60. Info@atgen.com.uy

More information

A novel and universal method for microrna RT-qPCR data normalization

A novel and universal method for microrna RT-qPCR data normalization A novel and universal method for microrna RT-qPCR data normalization Jo Vandesompele professor, Ghent University co-founder and CEO, Biogazelle 4 th International qpcr Symposium Weihenstephan, March 1,

More information

Swine H1N1 Influenza Human Pandemic Strain

Swine H1N1 Influenza Human Pandemic Strain Techne qpcr test Swine H1N1 Influenza Human Pandemic Strain M1 - global Influenza A & N1- specific for Swine H1N1 Influenza Human Pandemic Strain 150 tests For general laboratory and research use only

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

Product Overview CELL-FREE DNA BCT CELL-FREE RNA BCT CELL-FREE DNA URINE PRESERVE CYTO-CHEX BCT STRECK CELL PRESERVATIVE

Product Overview CELL-FREE DNA BCT CELL-FREE RNA BCT CELL-FREE DNA URINE PRESERVE CYTO-CHEX BCT STRECK CELL PRESERVATIVE FIXED ON INTEGRITY Product Overview CELL-FREE DNA BCT A blood collection tube for stabilization of cell-free plasma DNA, CTCs and cellular DNA. The preservative in Cell-Free DNA BCT stabilizes nucleated

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Potential Role of Human Endogenous Retrovirus K102 (HERV-K102) Particles in Resistance to HIV-1 Transmission

Potential Role of Human Endogenous Retrovirus K102 (HERV-K102) Particles in Resistance to HIV-1 Transmission Potential Role of Human Endogenous Retrovirus K102 (HERV-K102) Particles in Resistance to HIV-1 Transmission M. Laderoute, L. Larocque, A. Giulivi, K.R. Fowke, F.A. Plummer & F. Diaz-Mitoma As presented

More information

A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus

A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus Supplementary figures for: A putative MYB35 ortholog is a candidate for the sex-determining genes in Asparagus officinalis Daisuke Tsugama, Kohei Matsuyama, Mayui Ide, Masato Hayashi, Kaien Fujino, and

More information

Profili di espressione genica

Profili di espressione genica Profili di espressione genica Giampaolo Bianchini MD Ospedale San Raffaele, Milan - Italy Gene expression profiles Transcriptomics Gene DNA mrna mirnas Protein metilation Metabolite Genomics Transcriptomics

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT

WHO Prequalification of Diagnostics Programme PUBLIC REPORT WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: COBAS AmpliPrep/COBAS TaqMan HIV-1 Qualitative Test, version 2.0 (TaqMan 48) Number: PQDx 0221-046-00 Abstract COBAS AmpliPrep/COBAS

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT

WHO Prequalification of Diagnostics Programme PUBLIC REPORT WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: COBAS AmpliPrep/COBAS TaqMan HIV-1 Qualitative Test, version 2.0 (TaqMan 96) Number: PQDx 0200-046-00 Abstract COBAS AmpliPrep/COBAS

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

ExoQuick Exosome Isolation and RNA Purification Kits

ExoQuick Exosome Isolation and RNA Purification Kits ExoQuick Exosome Isolation and RNA Purification Kits Cat # EQ806A-1, EQ806TC-1, EQ808A-1 User Manual Storage: Please see individual components Version 2 8/14/2018 A limited-use label license covers this

More information

Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications

Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Circulating Cell-Free DNA Pre-analytics: Importance of ccfdna Stabilization and Extraction for Liquid Biopsy Applications Martin Schlumpberger, Ass.Director R&D, QIAGEN GmbH IQNpath 2017 - Circulating

More information

Study of gene expression with molecular biological methods during mammalian embryo preimplantation development. Árpád Baji Gál

Study of gene expression with molecular biological methods during mammalian embryo preimplantation development. Árpád Baji Gál Study of gene expression with molecular biological methods during mammalian embryo preimplantation development PhD theses Árpád Baji Gál Doctoral School in Biology, Head of the School: Prof. Anna Erdei

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx 0145-027-00 Abstract The Abbott RealTime HIV-1 (m2000sp) assay with product code 2G31 (which

More information

RNA/DNA Stabilization Reagent for Blood/Bone Marrow

RNA/DNA Stabilization Reagent for Blood/Bone Marrow For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. RNA/DNA Stabilization Reagent for Blood/Bone Marrow For simultaneous cell lysis and stabilization of nucleic acids

More information

Paper Reference. Paper Reference(s) 6101/01 Edexcel GCE Biology Biology (Human) Advanced Subsidiary Unit Test 1

Paper Reference. Paper Reference(s) 6101/01 Edexcel GCE Biology Biology (Human) Advanced Subsidiary Unit Test 1 Centre No. Candidate No. Paper Reference(s) 6101/01 Edexcel GCE Biology Biology (Human) Advanced Subsidiary Unit Test 1 Monday 4 June 2007 Morning Time: 1 hour Materials required for examination Ruler

More information

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

More information

C H A R A C T E R I Z A T I O N O F T H E N O V E L D O M A I N W I T H N O N A M E G E N E I N C O L O N C A N C E R

C H A R A C T E R I Z A T I O N O F T H E N O V E L D O M A I N W I T H N O N A M E G E N E I N C O L O N C A N C E R C H A R A C T E R I Z A T I O N O F T H E N O V E L D O M A I N W I T H N O N A M E G E N E I N C O L O N C A N C E R Charleen Rupnarain A dissertation submitted to the Faculty of Science, University of

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

A NOVEL METHOD OF M/Z DRIFT CORRECTION FOR OA-TOF MASS SPECTROMETERS BASED ON CONSTRUCTION OF LIBRARIES OF MATRIX COMPONENTS.

A NOVEL METHOD OF M/Z DRIFT CORRECTION FOR OA-TOF MASS SPECTROMETERS BASED ON CONSTRUCTION OF LIBRARIES OF MATRIX COMPONENTS. A NOVEL METHOD OF M/Z DRIFT CORRECTION FOR OA-TOF MASS SPECTROMETERS BASED ON CONSTRUCTION OF LIBRARIES OF MATRIX COMPONENTS. Martin R Green*, Keith Richardson, John Chipperfield, Nick Tomczyk, Martin

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: Abbott RealTime HIV-1 (m2000sp) Number: PQDx 0145-027-00 Abstract Abbott RealTime HIV-1 (m2000sp) assay with product code 2G31, which

More information

Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains

Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured

More information

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

More information

Supporting Information

Supporting Information Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification

More information

Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.

Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01. PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA

OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.

More information

Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only

Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus

More information

Rapid genomic screening of embryos using nanopore sequencing

Rapid genomic screening of embryos using nanopore sequencing Rapid genomic screening of embryos using nanopore sequencing Daniel J Turner, PhD Senior Director of Applications Oxford Nanopore Technologies Forman EJ & Scott RT Jr Contemporary OB/GYN () 2014 Euploid

More information

Avian Influenza A H5N8

Avian Influenza A H5N8 TM Primerdesign Ltd Avian Influenza A H5N8 Hemagglutinin (HA) gene & Neuraminidase (NA) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian Influenza

More information

Personalized Therapy for Prostate Cancer due to Genetic Testings

Personalized Therapy for Prostate Cancer due to Genetic Testings Personalized Therapy for Prostate Cancer due to Genetic Testings Stephen J. Freedland, MD Professor of Urology Director, Center for Integrated Research on Cancer and Lifestyle Cedars-Sinai Medical Center

More information