Supporting Information

University of Groningen

University of Groningen Role of Lipids in Spheroidal High Density Lipoproteins Vuorela, Timo; Catte, Andrea; Niemela, Perttu S.; Hall, Anette; Hyvonen, Marja T.; Marrink, Siewert; Karttunen, Mikko; Vattulainen,

Composition and lipid spatial distribution of High Density Lipoprotein. particles in subjects with low and high HDL-cholesterol

Composition and lipid spatial distribution of High Density Lipoprotein particles in subjects with low and high HDL-cholesterol Laxman Yetukuri, 1 Sanni Söderlund, 2 Artturi Koivuniemi, 3 Tuulikki Seppänen-Laakso,

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

DECLARATION OF CONFLICT OF INTEREST. None

DECLARATION OF CONFLICT OF INTEREST None Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J Meikle 1, Gerard Wong 1, Despina Tsorotes 1, Christopher K Barlow 1, Jacquelyn

Metabolic Syndrome Modulates Association between Endothelial Lipase and. Lipid/Lipoprotein Plasma Levels in Acute Heart Failure Patients

Metabolic Syndrome Modulates Association between Endothelial Lipase and Lipid/Lipoprotein Plasma Levels in Acute Heart Failure Patients Ines Potočnjak, Matias Trbušić, Sanda Dokoza Terešak, Bojana Radulović,

Metabolic defects underlying dyslipidemia in abdominal obesity

Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/

Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic

Supplementary Information The title of the manuscript Serum levels of galectin-1, galectin-3, and galectin-9 are associated with large artery atherosclerotic stroke Xin-Wei He 1, Wei-Ling Li 1, Cai Li

PCs Acyl chain double bonds. PEs

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2

The use of mass spectrometry in lipidomics. Outlines

The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid

Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health

Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed

Nature Genetics: doi: /ng.3561

Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

Chapter (5) Etiology of Low HDL- Cholesterol

Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the

Metabolomics and systems biology approaches to study health and disease. Matej Oreši

Metabolomics and systems biology approaches to study health and disease Matej Oreši 14.12.2011 1/19/2012 2 Biomarker concept in domain of human health [Wikipedia definition] A substance used as an indicator

Mass-Spectrometric Analysis of Lipids (Lipidomics)

Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

2.3 Carbon-Based Molecules. KEY CONCEPT Carbon-based molecules are the foundation of life.

KEY CONCEPT Carbon-based molecules are the foundation of life. Carbon atoms have unique bonding properties. Carbon forms covalent bonds with up to four other atoms, including other carbon atoms. Carbon-based

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease

Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,

Coarse-grained model for phospholipid/cholesterol bilayer employing inverse Monte Carlo with thermodynamic constraints

THE JOURNAL OF CHEMICAL PHYSICS 126, 075101 2007 Coarse-grained model for phospholipid/cholesterol bilayer employing inverse Monte Carlo with thermodynamic constraints Teemu Murtola Laboratory of Physics,

Principles of Shotgun Lipidomics

Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition

Supporting information

Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo

SUPPLEMENTARY DATA. Materials and Methods

SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters

Nutrition & Wellness for Life 2012 Chapter 6: Fats: A Concentrated Energy Source

Tools: Printer 8.5 x 11 paper Scissors Directions: 1. Print 2. Fold paper in half vertically 3. Cut along dashed lines Copyright Goodheart-Willcox Co., Inc. All rights reserved. Tissue in which the body

Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention

Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..

Free Volume Properties of Sphingomyelin, DMPC, DPPC, and PLPC Bilayers

PUBLISHED IN: JOURNAL OF COMPUTATIONAL AND THEORETICAL NANOSCIENCE, VOL. 2, PP. 40-43 (2005). Free Volume Properties of Sphingomyelin, DMPC, DPPC, and PLPC Bilayers M. Kupiainen, E. Falck, S. Ollila, P.

High density lipoprotein metabolism

High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease

ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol

Document Version Publisher s PDF, also known as Version of Record (includes final page, issue and volume numbers)

Coarse-grained model for phospholipid/cholesterol bilayer employing inverse Monte Carlo with thermodynamic constraints Murtola, T.; Falck, E.; Karttunen, M.E.J.; Vattulainen, I. Published in: Journal of

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms

Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±

7/11/17. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell

Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions

Supporting Information

Supporting Information Development of a High Coverage Pseudotargeted Lipidomics Method Based on Ultra-High Performance Liquid Chromatography-Mass Spectrometry Qiuhui Xuan 1,2#, Chunxiu Hu 1#, Di Yu 1,2,

Nutrition, Food, and Fitness. Chapter 6 Fats: A Concentrated Energy Source

Nutrition, Food, and Fitness Chapter 6 Fats: A Concentrated Energy Source Tools: Printer (color optional) 4 sheets of 8.5 x 11 paper Scissors Directions: 1. Print 2. Fold paper in half vertically 3. Cut

Annotation of potential isobaric and isomeric lipid species measured with the AbsoluteIDQ p180 Kit (and p150 Kit)

We provide the Phenotype to the Genotype! DocNr. 35017 V 2 2017-02 Annotation of potential isobaric and isomeric lipid species measured with the (and p150 Kit) Introduction Lipidomics, a branch of metabolomics

A: All atom molecular simulation systems

Cholesterol level affects surface charge of lipid membranes in physiological environment Aniket Magarkar a, Vivek Dhawan b, Paraskevi Kallinteri a, Tapani Viitala c, Mohammed Elmowafy c, Tomasz Róg d,

Biophysical Journal Volume 96 May

Biophysical Journal Volume 96 May 2009 4099 4108 4099 Atomistic Simulations of Phosphatidylcholines and Cholesteryl Esters in High-Density Lipoprotein-Sized Lipid Droplet and Trilayer: Clues to Cholesteryl

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

Table S1. Characteristics associated with frequency of nut consumption (full entire sample; Nn=4,416).

Table S1. Characteristics associated with frequency of nut (full entire sample; Nn=4,416). Daily nut Nn= 212 Weekly nut Nn= 487 Monthly nut Nn= 1,276 Infrequent or never nut Nn= 2,441 Sex; n (%) men 52

The Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk

The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine

Lipoproteins Metabolism

Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with

Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti

Atomistic MD simulation reveals the mechanism by which CETP penetrates into HDL enabling lipid transfer from HDL to CETP

Atomistic MD simulation reveals the mechanism by which CETP penetrates into HDL enabling lipid transfer from HDL to CETP Geraldine Cilpa-Karhu, 1, * Matti Jauhiainen, and Marja-Liisa Riekkola * Laboratory

Phospholipid characterization by a TQ-MS data based identification scheme

P-CN1716E Phospholipid characterization by a TQ-MS data based identification scheme ASMS 2017 MP-406 Tsuyoshi Nakanishi 1, Masaki Yamada 1, Ningombam Sanjib Meitei 2, 3 1 Shimadzu Corporation, Kyoto, Japan,

Pattern of lipid biomarkers and risk of cardiovascular disease

Pattern of lipid biomarkers and risk of cardiovascular disease Robert Clarke Clinical Trial Service Unit University of Oxford 9 January 2017 Biomarkers for dietary fats Blood lipids (LDL, HDL, triglycerides,

Lipids digestion and absorption, Biochemistry II

Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very

Review of guidelines for management of dyslipidemia in diabetic patients

2012 international Conference on Diabetes and metabolism (ICDM) Review of guidelines for management of dyslipidemia in diabetic patients Nan Hee Kim, MD, PhD Department of Internal Medicine, Korea University

Supplemental Information

Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

LC/MS/MS SOLUTIONS FOR LIPIDOMICS. Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS

LC/MS/MS SOLUTIONS FOR LIPIDOMICS Biomarker and Omics Solutions FOR DISCOVERY AND TARGETED LIPIDOMICS Lipids play a key role in many biological processes, such as the formation of cell membranes and signaling

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP

Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA

Dissertation VTT PUBLICATIONS 741. Laxmana Rao Yetukuri. Bioinformatics approaches for the analysis of lipidomics data

Dissertation VTT PUBLICATIONS 741 Laxmana Rao Yetukuri Bioinformatics approaches for the analysis of lipidomics data VTT PUBLICATIONS 741 Bioinformatics approaches for the analysis of lipidomics data

May 13, 2017 Data Back Ban of Artificial Trans Fats

EDUCATOR GUIDE May 13, 2017 Data Back Ban of Artificial Trans Fats Cross-Curricular Discussion After students have had a chance to review the article Data back ban of artificial trans fats, lead a classroom

Supplemental Table S2: Subgroup analysis for IL-6 with BMI in 3 groups

Supplemental Table S1: Unadjusted and Adjusted Hazard Ratios for Diabetes Associated with Baseline Factors Considered in Model 3 SMART Participants Only Unadjusted Adjusted* Baseline p-value p-value Covariate

Obesity Prevention and Control: Provider Education with Patient Intervention

Obesity Prevention and : Provider Education with Patient Summary Evidence Table and Population Cohen et al. (1991) 1987-1988 : RCT Location: Pittsburgh, PA Physician training session by a behavioral psychologist

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD

Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal

Investigating the effect of antiretroviral switch to tenofovir alafenamide on lipid profiles in people living with HIV within the UCD ID Cohort

Investigating the effect of antiretroviral switch to tenofovir alafenamide on lipid profiles in people living with HIV within the UCD ID Cohort A. Lacey 1, W. Tinago 1, E. Alvarez Barco 1, A.J. Macken

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction

Gender-Based and Age-Related Peculiarities of Lipid Metabolism in Chronic Heart Failure Secondary to Overweight and Obesity

71 P.P.Bidzilya Gender-Based and Age-Related Peculiarities of Lipid Metabolism in Chronic Heart Failure Secondary to Overweight and Obesity Zaporizhzhya State Medical University, Zaporizhzhya, Ukraine

Andrejs Kalvelis 1, MD, PhD, Inga Stukena 2, MD, Guntis Bahs 3 MD, PhD & Aivars Lejnieks 4, MD, PhD ABSTRACT INTRODUCTION. Riga Stradins University

CARDIOVASCULAR RISK FACTORS ORIGINAL ARTICLE Do We Correctly Assess the Risk of Cardiovascular Disease? Characteristics of Risk Factors for Cardiovascular Disease Depending on the Sex and Age of Patients

APPENDIX AVAILABLE ON THE HEI WEB SITE

APPENDIX AVAILABLE ON THE HEI WEB SITE Research Report 178 National Particle Component Toxicity (NPACT) Initiative Report on Cardiovascular Effects Sverre Vedal et al. Section 1: NPACT Epidemiologic Study

MALDI Activity 4 MALDI-TOF Mass Spectrometry: Data Analysis

MALDI Activity 4 MALDI-TOF Mass Spectrometry: Data Analysis Model 1: Introduction to Triacylglycerides (TAGs) In MALDI Activity 3 you learned how to open your raw mass spectrum data and use the MMass program

HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington

HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington Disclosures NIH AHA Insilicos Consultant Merck Research Support GSK Research Support Pfizer Research Support Corcept

Lipid annotation with MS2Analyzer. Yan Ma 10/24/2013

Lipid annotation with MS2Analyzer Yan Ma 10/24/2013 Checklist before you start You need to have: 1.A computer with Java environment and Office(2003 or higher) 2.MS/MS spectra in MGF files 3.Latest version

Obtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS

Obtaining Answers to Biological Questions Sample Prep to Data Analysis Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS OMICS Research Why Quantitative OMICS? 2 2015 AB Sciex SCIEX

SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients

SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk

The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing

SUPPLEMENTAL MATERIAL. Number of patients 14

SUPPLEMENTAL MATERIAL Supplemental Table 1 Number of patients 14 Age, years 54.9 ± 10.0 Female gender, n (%) 6 (42.9) Diabetes, n (%) 2 (14.3) History of hypertension, n (%) 5 (35.7) Ever smoker, n (%)

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

Supplementary Figures

Supplementary Figures Supplementary Figure 1. (a) Uncropped version of Fig. 2a. RM indicates that the translation was done in the absence of rough mcirosomes. (b) LepB construct containing the GGPG-L6RL6-

MASS SPECTROMETRY BASED METABOLOMICS. Pavel Aronov. ABRF2010 Metabolomics Research Group March 21, 2010

MASS SPECTROMETRY BASED METABOLOMICS Pavel Aronov ABRF2010 Metabolomics Research Group March 21, 2010 Types of Experiments in Metabolomics targeted non targeted Number of analyzed metabolites is limited

Expanded View Figures

Solip Park & Ben Lehner Epistasis is cancer type specific Molecular Systems Biology Expanded View Figures A B G C D E F H Figure EV1. Epistatic interactions detected in a pan-cancer analysis and saturation

SITA 100 mg (n = 378)

Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

Chapter VIII: Dr. Sameh Sarray Hlaoui

Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.

Supplementary Online Content

Supplementary Online Content Leibowitz M, Karpati T, Cohen-Stavi CJ, et al. Association between achieved low-density lipoprotein levels and major adverse cardiac events in patients with stable ischemic

Save My Exams! The Home of Revision For more awesome GCSE and A level resources, visit us at Lipids.

Lipids Mark Scheme Level Subject Exam Board Topic Sub-Topic Booklet International A Level Biology Edexcel Molecules, Transport and Health Lipids Mark Scheme Time Allowed: 63 minutes Score: /52 Percentage:

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses

The effect of plant sterols and different low doses of omega-3 fatty acids from fish oil on lipoprotein subclasses 18 June 2015 Doris Jacobs Unilever R&D Vlaardingen Background Elevated low-density lipoprotein-cholesterol

Supporting Information

Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 018 Supporting Information Modulating Interactions between Ligand-Coated Nanoparticles and Phase-Separated

Types of Statistics. Censored data. Files for today (June 27) Lecture and Homework INTRODUCTION TO BIOSTATISTICS. Today s Outline

INTRODUCTION TO BIOSTATISTICS FOR GRADUATE AND MEDICAL STUDENTS Files for today (June 27) Lecture and Homework Descriptive Statistics and Graphically Visualizing Data Lecture #2 (1 file) PPT presentation

Comprehensive Two-Dimensional HPLC and Informative Data Processing for Pharmaceuticals and Lipids

PO-CON1576E Comprehensive Two-Dimensional HPLC and Informative Data Processing for Pharmaceuticals and Lipids HPLC 2015 PSB-MULTI-06 Yoshiyuki WATABE, Tetsuo IIDA, Daisuke NAKAYAMA, Kanya TSUJII, Saki

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary

15.1 Lipids 15.2 Fatty Acids. Copyright 2009 by Pearson Education, Inc.

Chapter 15 Lipids 15.1 Lipids 15.2 Fatty Acids Copyright 2009 by Pearson Education, Inc. 1 Lipids Lipids are biomolecules that contain fatty acids or a steroid nucleus. soluble in organic solvents, but

9/11/18. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell

Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions

Plasma fibrinogen level, BMI and lipid profile in type 2 diabetes mellitus with hypertension

World Journal of Pharmaceutical Sciences ISSN (Print): 2321-3310; ISSN (Online): 2321-3086 Published by Atom and Cell Publishers All Rights Reserved Available online at: http://www.wjpsonline.org/ Original

Glossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"

Quantitative Methods in Computing Education Research (A brief overview tips and techniques)

Quantitative Methods in Computing Education Research (A brief overview tips and techniques) Dr Judy Sheard Senior Lecturer Co-Director, Computing Education Research Group Monash University judy.sheard@monash.edu

The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only.

The clinical trial information provided in this public disclosure synopsis is supplied for informational purposes only. Please note that the results reported in any single trial may not reflect the overall

Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein

INTRODUCTION. FI Tornio, Finland. 5 Abbreviations used: IDL, intermediate-density lipoprotein; NMR, nuclear

Effects of sea buckthorn and bilberry on serum metabolites differ according to baseline metabolic profiles in overweight women: a randomized crossover trial 1 4 Petra S Larmo, Antti J Kangas, Pasi Soininen,

A comparative study on the fasting and post prandial lipid levels as a cardiovascular risk factor in patients with type 2 diabetes mellitus

Original Research Article A comparative study on the fasting and post prandial lipid levels as a cardiovascular risk factor in patients with type 2 diabetes mellitus Deepa Kalikavil Puthenveedu 1, Sundaraj

Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random

S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:

Supplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification

Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics

Control 7 d cold 7 d CL

Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

Supplementary material

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Epithelial-to-mesenchymal transition involves triacylglycerol accumulation in DU145

BCH 447. Triglyceride Determination in Serum

BCH 447 Triglyceride Determination in Serum Introduction: Triglycerides are esters of fatty acids and are hydrolyzed by lipase to glycerol and free fatty acids. Triglyceride determinations when performed

3.1.3 Lipids. Source: AQA Spec

alevelbiology.co.uk SPECIFICATION Triglycerides and phospholipids are two groups of lipid. Triglycerides are formed by the condensation of one molecule of glycerol and three molecules of fatty acid. A

LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME

LEPTIN AS A NOVEL PREDICTOR OF DEPRESSION IN PATIENTS WITH THE METABOLIC SYNDROME Diana A. Chirinos, Ronald Goldberg, Elias Querales-Mago, Miriam Gutt, Judith R. McCalla, Marc Gellman and Neil Schneiderman

Fats, Cholesterol, and Hormones

Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols

Plasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam

Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain