SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients

Size: px
Start display at page:

Download "SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients"

Transcription

1 SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró a, Maisa García-Arguinzonis a, Gemma Vilahur a, Inka Miñambres b, Jose María Pou b, Juan Ybarra c, Lina Badimon a,d * From a Cardiovascular Research Center (CSIC-ICCC) and Biomedical Research Institute Sant Pau (IIB-Sant Pau); b Endocrinology Department, Hospital de la Santa Creu i Sant Pau; c Teknon Medical Center; d Cardiovascular Research Chair UAB; Barcelona, Spain. 7 Supplemental Figures and 1 Supplemental Table Correspondence to: Prof. Lina Badimon Cardiovascular Research Center, c/sant Antoni MªClaret 167, Barcelona, Spain. Phone: (34) Fax: (34) lbadimon@csic-iccc.org 1

2 LEGENDS TO SUPPLEMENTAL FIGURES Supplemental Figure 1. Representative serum 2-DE image Apo A-I spots profile in different ph and MW ranges (pi 4-7, 10% PAGE; and pi , 15% PAGE) and 3D image of the 5 detected forms of 28kDa. Supplemental Figure 2. Representative images of Apo A-I profile in VLDL samples (N=3/group) showing only the 28 kda form by 2-DE (pi range 4-7, 10% PAGE) and 1-DE followed by WB Apo A-I detection. Supplemental Figure 3. Representative 2-DE image (pi range 4-7, 10% PAGE) of LDL. The main detected proteins are Apo A-I and Apo E. Supplemental Figure 4. Bar diagrams showing differences in lipidomic profile in LDL fractions between DM (N=10) and non-dm-patients (N=8): (A) Free cholesterol and triglycerides in LDL assessed by TLC; (B) Cholesterol esters (CE), lysophosphatidylcholine (LPC), lysophosphatidylethanolamine (LPE), lysophosphatidylserine (LPS), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), and sphingomyelin (SM) analyzed by LC-MS. *p<0.05 Supplemental Figure 5. Representative 2-DE image (pi range 4-7, 10% PAGE) of Apo A-I in HDL subclasses. Apo A-I Δ(1-38) is not detected in HDL2 nor in HDL3. Supplemental Figure 6. (A) Representative 2-DE image (pi range 4-7, 10% PAGE) of Apo A-I in rat serum showing both Apo A-I forms of 28 and 26 kda. (B) Box-plot diagram of the intensity of the 26 kda Apo A-I form in hepatic tissue of control and diabetic rats (N=3/group; *p<0.05). (C) Human and rat Apo A-I aminoacid sequences showing in silico cathepsin D cleavage site. 2

3 Supplemental Figure 7. (A) 1-DE profile of cathepsin D digestion of purified Apo A-I. Hemoglobin was used as a possitive control for cathepsin D activity. (B) Box-plot diagram of cathepsin D activity in hepatic tissue of control (N=8) and diabetic rats (N=7; *p<0.05). (C) Representative 2-DE, followed by Apo A-I WB, image (pi range 4-7, 10% PAGE) of Apo A-I in rat liver extracts showing both Apo A-I forms of 28 and 26 kda. (D) Box-plot diagram showing the intensity of the 26 kda Apo A-I form in hepatic tissue of control (N=4) and diabetic rats (N=4; *p<0.05). 3

4 SUPPLEMENTAL TABLE 1: Peak list obtained in the simulated tryptic digestion of Apo A-I using Sequence Editor tool of BioTools (Bruker Daltonics, BioTools 3.02) Nº Range Mono Partials Sequence 44 [ ] QKVEPLR 49 [ ] AELQEGAR 55 [ ] LHELQEK 29 [75-82] DLEEVKAK 77 [ ] LAARLEALK 1 [1-9] ATVYVDVLK 65 [ ] ARAHVDALR 91 [ ] AKPALEDLR 58 [ ] LSPLGEEMR 50 [ ] AELQEGARQK 53 [ ] QKLHELQEK 80 [ ] LEALKELGGAR 88 [ ] ATEHLSTLSEK 94 [ ] QGLLPVLESFK 34 [83-92] VQPYLDDFQK 75 [ ] QRLAARLEALK 63 [ ] DRARAHVBALR 40 [94-102] WQEEMELYR 70 [ ] THLAPYSDELR 59 [ ] LSPLGEEMRDR 23 [64-74] ETEGLRQEMSK 26 [70-80] QEMSKDLEEVK 35 [83-93] VQPYLDDFQKK 97 [ ] VSFLSALEEYTK 7 [14-26] DYVSQFEGSALGK 38 [93-102] KWQEEMELYR 83 [ ] ENGGARLAEYHAK 2 [1-13] ATVYVDVLKDSGR 32 [81-92] AKVQPYLDDFQK 47 [ ] VEPLRAELQEGAR 98 [ ] VSFLSALEEYTKK 60 [ ] LSPLGEEMRDRAR 27 [70-82] QEMSKDLEEVKAK 41 [94-104] WQEEMELYRQK 78 [ ] LAARLEALKENGGAR 33 [81-93] AKVQPYLDDFQKK 71 [ ] THLAPYSDELRQR 13 [32-45] LLDNVDSVTSTFSK 39 [93-104] KVQEEMELYRQK 45 [ ] QKVEPLRAELQEGAR 48 [ ] VEPLRAELQEGARQK 5 [10-26] DSGRDYVSQFEGSALGK 4

5 Nº Range Mono Partials Sequence 14 [32-47] LLDNWDSVTSTFSKLR 56 [ ] LHELQELSPLGEEMR 19 [48-63] EQLGPVTQEFWDNLEK 81 [ ] LEALKENGGARLAEYHAK 99 [ ] VSFLSALEEYTKKLNTQ 8 [14-31] DYVSQFEGSALGKQLNLK 72 [ ] THLAPYSDELRQRLAAR 51 [ ] AELQEGARQKLHELQEK 24 [64-80] ETEGLRQEMSKDLEEVK 86 [ ] LAEYHAKATEHLSTLSEK 68 [ ] AHVDALRTHLAPYSDELR 42 [94-109] WQEEMELYRQKVEPLR 30 [75-92] DLEEVKAKVQPYLDDFQK 54 [ ] QKLHELQEKLSPLGEEMR 57 [ ] LHELQEKLSPLGEEMRDR 17 [46-63] LREQLGPVTQEFWDNLEK 11 [27-45] QLNLKLLDNWDSVTSTFSK 89 [ ] ATEHLSTLSEKAKPALEDLR 92 [ ] AKPALEDLRQGLLPVLESFK 66 [ ] ARAHVDALRTHLAPYSDELR 69 [ ] AHVDALRTHLAPYSDELRQR 6 [10-31] DSGRDYVSQFEGSALGKQLNLK 12 [27-47] QLNLKLLDNWDSVTSTFSKLR 95 [ ] QGLLPVLESFKVSFLSALEEYTK 84 [ ] ENGGARLAEYHAKATEHLSTLSEK 20 [48-69] EQLGPVTQEFWDNLEKETEGLR 36 [83-102] VQPYLDDFQKKWQEEMELYR 96 [ ] QGLLPVLESFKVSFLSALEEYTKK 3 [1-26] ATVYVDVLKDSGRDYVSQFEGSALGK 18 [46-69] LREQLGPVTQEFWDNLEKETEGLR 5

6 6

7 7

8 8

9 9

10 10

11 11

12 12

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS

Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions

More information

Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1

Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1 Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species

More information

PCs Acyl chain double bonds. PEs

PCs Acyl chain double bonds. PEs Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2

More information

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC

Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC

More information

High density lipoprotein metabolism

High density lipoprotein metabolism High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC

More information

LC/MS Method for Comprehensive Analysis of Plasma Lipids

LC/MS Method for Comprehensive Analysis of Plasma Lipids Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,

More information

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts

Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction

More information

MOLECULAR PATHOLOGY OF ATHEROSCLEROSIS

MOLECULAR PATHOLOGY OF ATHEROSCLEROSIS MOLECULAR PATHOLOGY OF ATHEROSCLEROSIS Dubrovnik 2013 Lina Badimon Barcelona Cardiovascular Research Center (CSIC-ICCC) IIB-Sant Pau, Hospital de la Santa Creu i Sant Pau ATHEROSCLEROSIS ATHEROTHROMBOSIS

More information

(1) Cardiovascular Research Center (CSIC-ICCC), IIB-Sant Pau (2) Cardiovascular Research

(1) Cardiovascular Research Center (CSIC-ICCC), IIB-Sant Pau (2) Cardiovascular Research Lipidomic changes of LDL in overweight and moderately hypercholesterolemic subjects taking phytosterol and omega-3 supplemented milk. Running title: Phytosterols and omega-3 effects on plasma LDL-lipid

More information

Lipids Analysis. Lipids

Lipids Analysis. Lipids Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans

More information

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL

Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:

More information

Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health

Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive

More information

Mass Spectrometry based metabolomics

Mass Spectrometry based metabolomics Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (

More information

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823

More information

Lipoproteins Metabolism

Lipoproteins Metabolism Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical

More information

SUPPORTING INFORMATION. Nontargeted quantitation of lipid classes using hydrophilic interaction liquid

SUPPORTING INFORMATION. Nontargeted quantitation of lipid classes using hydrophilic interaction liquid SUPPORTING INFORMATION Nontargeted quantitation of lipid classes using hydrophilic interaction liquid chromatography - electrospray ionization mass spectrometry with single internal standard and response

More information

Glycerolipid Analysis. LC/MS/MS Analytical Services

Glycerolipid Analysis. LC/MS/MS Analytical Services Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric

More information

Nature Genetics: doi: /ng.3561

Nature Genetics: doi: /ng.3561 Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8

More information

Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention

Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..

More information

DECLARATION OF CONFLICT OF INTEREST. None

DECLARATION OF CONFLICT OF INTEREST. None DECLARATION OF CONFLICT OF INTEREST None Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J Meikle 1, Gerard Wong 1, Despina Tsorotes 1, Christopher K Barlow 1, Jacquelyn

More information

Article Phytosterols and Omega 3 Supplementation Exert Novel Regulatory Effects on Metabolic and Inflammatory Pathways: A Proteomic Study

Article Phytosterols and Omega 3 Supplementation Exert Novel Regulatory Effects on Metabolic and Inflammatory Pathways: A Proteomic Study Article Phytosterols and Omega 3 Supplementation Exert Novel Regulatory Effects on Metabolic and Inflammatory Pathways: A Proteomic Study Carmen Lambert 1, Judit Cubedo 1,2,, Teresa Padró 1,2, Joan Sánchez-Hernández

More information

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins

Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number

More information

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer

Overview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel

More information

Supporting Information

Supporting Information Composition and lipid spatial distribution of High Density Lipoprotein particles in subjects with Laxman Yetukuri, 1 Sanni Söderlund, 2 Artturi Koivuniemi, 3 Tuulikki Seppänen-Laakso, 1 Perttu S. Niemelä,

More information

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.

Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations. Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary

More information

Phospholipid Analysis. P NMR Analytical Services

Phospholipid Analysis. P NMR Analytical Services Phospholipid Analysis 31 P NMR Analytical Services Quantitative Phospholipid Analysis of Soy Lecithin and Krill Lecithin by 31 P NMR Katherine L Lanier; Jeff D Moore; Dale Smith; Shengrong Li; Ben Davis;

More information

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)

More information

Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI

Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Biochemical Analysis (Lipid Panel) Analyte Total Cholesterol Reference Range Patient A < 200 241 LDL-C /= 40 38 Triglycerides

More information

Supplemental Material. Results

Supplemental Material. Results Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was

More information

Studies on the effect of dietary fish oil on the physical and chemical properties of low density lipoproteins in cynomolgus monkeys

Studies on the effect of dietary fish oil on the physical and chemical properties of low density lipoproteins in cynomolgus monkeys Studies on the effect of dietary fish oil on the physical and chemical properties of low density lipoproteins in cynomolgus monkeys John S. Parks' and Abraham K. Gebre Department of Comparative Medicine,

More information

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry

Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different

More information

Chapter (5) Etiology of Low HDL- Cholesterol

Chapter (5) Etiology of Low HDL- Cholesterol Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the

More information

Soluble LRP1 is an independent biomarker of epicardial fat volume in patients with type 1 diabetes mellitus

Soluble LRP1 is an independent biomarker of epicardial fat volume in patients with type 1 diabetes mellitus www.nature.com/scientificreports Received: 16 August 2017 Accepted: 28 December 2017 Published: xx xx xxxx OPEN Soluble LRP1 is an independent biomarker of epicardial fat volume in patients with type 1

More information

Lipid Imaging Mass Spectrometry.

Lipid Imaging Mass Spectrometry. Lipid Imaging Mass Spectrometry. NH 2 P H H H H P H H P H N N Advanced Graduate Course in Metabolomics 3-11-2015 Janusz Kabarowski, Dept. of Microbiology, UAB. Matrix-Assisted Laser Desorption/Ionization

More information

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?

1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien

More information

A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids

A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids Jeremy Netto, 1 Stephen Wong, 1 Federico Torta, 2 Pradeep Narayanaswamy, 2

More information

Supplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification

Supplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics

More information

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins

Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean

More information

The use of mass spectrometry in lipidomics. Outlines

The use of mass spectrometry in lipidomics. Outlines The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid

More information

Effect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I

Effect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I Effect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I Yoshifumi Kurosaki 1), Hitoshi Ikeya 2), Hisao Haniu 3) and Zensuke Ogawa 1) It is reported that self-associated

More information

Defective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome

Defective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome Defective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome Fabiana Rached, *, Raul D. Santos, Laurent Camont, * Marcio H. Miname, Marie

More information

Supporting information

Supporting information Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo

More information

Opinion on the safety assessment of phospholipds obtained from egg yolk as food produced using a new process

Opinion on the safety assessment of phospholipds obtained from egg yolk as food produced using a new process EUROPEAN COMMISSION DIRECTORATE-GENERAL XXIV CONSUMER POLICY AND CONSUMER HEALTH PROTECTION Directorate B - Scientific opinions on health matters Unit B3 - Management of scientific committees II SCIENTIFIC

More information

INNOVATION THAT REALLY MATTERS. Prof. Lina Badimon. Institut Català de Ciències Cardiovasculars (ICCC), Barcelona

INNOVATION THAT REALLY MATTERS. Prof. Lina Badimon. Institut Català de Ciències Cardiovasculars (ICCC), Barcelona INNOVATION THAT REALLY MATTERS Prof. Lina Badimon, Barcelona THE INSTITUTION THE INSTITUTION THE ICCC CATALAN INSTITUTE FOR CARDIOVASCULAR SCIENCE (ICCC) Objectives LEADING AN STRATEGIC PLANNING IN CVR

More information

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?

Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown

More information

Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer

Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer B American Society for Mass Spectrometry, 2014 J. Am. Soc. Mass Spectrom. (2015) 26:133Y148 DOI: 10.1007/s13361-014-1013-x RESEARCH ARTICLE Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid

More information

Hypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002

Hypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002 Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low

More information

Hypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC

Hypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC Hypertriglyceridemia: Why, When, and How to Treat Gregory Cohn, MD, FNLA, FASPC DISCLOSURES Consultant to Akcea Therapeutics (in the past 12 months). OUTLINE I. Lipoproteins II. Non-HDL-C III. Causes and

More information

Supplemental Table 1. List of primers used for real time PCR.

Supplemental Table 1. List of primers used for real time PCR. Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse

More information

Metabolism and Atherogenic Properties of LDL

Metabolism and Atherogenic Properties of LDL Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal

More information

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk

The New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing

More information

Emerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids

Emerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids Emerging science on omega-3: A lipidomic view of omega-3 in health and disease Peter Meikle 04 May 2017 Health benefits of omega 3 fatty acids Can lower plasma triacylglycerol can reduce the risk of metabolic

More information

Chapter VIII: Dr. Sameh Sarray Hlaoui

Chapter VIII: Dr. Sameh Sarray Hlaoui Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.

More information

By: Dr Hadi Mozafari 1

By: Dr Hadi Mozafari 1 Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms

More information

Test Definition: FNMR2 NMR LipoProfile w/ir Markers

Test Definition: FNMR2 NMR LipoProfile w/ir Markers Reporting Title: Performing Location: Labcorp Burlington Specimen Requirements: Submit only one of the following specimens: Serum Draw blood in a plain red-top tube(s). (Serum gel tube is not acceptable.)

More information

Pathophysiology of Lipid Disorders

Pathophysiology of Lipid Disorders Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history

More information

Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both

Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both Lluís Masana Vascular Medicine and Metabolism Unit. Sant Joan University Hospital. IISPV. CIBERDEM Rovira i Virgili

More information

Dysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE

Dysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE Dysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE PIs and Members of HDL Project Wei Gao, M.D., Ph.D. Professor and Chair Cardiology Third Hospital, PUHSC Yong Huo, M.D., Ph.D.

More information

Programa Cooperación Farma-Biotech Jornada II: Oncología

Programa Cooperación Farma-Biotech Jornada II: Oncología Programa Cooperación Farma-Biotech Jornada II: Oncología Minerval : Treatment of glioma and other types of cancer Vicenç Tur. CEO, Co-founder Barcelona, 13 de abril de 2011 Programa Cooperación Farma-Biotech

More information

NOVEL BIOMARKERS IN RISK ASSESSMENT AND MANAGEMENT OF CARDIOVASCULAR DISEASE

NOVEL BIOMARKERS IN RISK ASSESSMENT AND MANAGEMENT OF CARDIOVASCULAR DISEASE CARDIOVASCULAR DISEASE Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and drugs

More information

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT

Fig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)

More information

SUPPORTING INFORMATION FOR:

SUPPORTING INFORMATION FOR: SUPPORTING INFORMATION FOR: Metabolomics and lipidomics profiling of a combined mitochondrial plus endoplasmic reticulum fraction of human fibroblasts: a robust tool for clinical studies Charlotte Veyrat-Durebex

More information

Obtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS

Obtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS Obtaining Answers to Biological Questions Sample Prep to Data Analysis Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS OMICS Research Why Quantitative OMICS? 2 2015 AB Sciex SCIEX

More information

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients

Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier

More information

Subj ect Index. For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes)

Subj ect Index. For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes) Subj ect Index For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes) A absorption, intestinal 48-63, 66,77,78 ACAT-enzyme 187,188,192,197, 198,203 acetate 66,67,152,158,160,173 acetone-butanol

More information

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved

Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved 1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich

More information

Defining Severe Familial Hypercholesterolemia. Raul D. Santos MD, PhD Brazil

Defining Severe Familial Hypercholesterolemia. Raul D. Santos MD, PhD Brazil Defining Severe Familial Hypercholesterolemia Raul D. Santos MD, PhD Brazil 1 Disclosure Honoraria received for consulting, speaker and or researcher activities : Astra Zeneca, Akcea, Amgen, Biolab, Esperion,

More information

Control 7 d cold 7 d CL

Control 7 d cold 7 d CL Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with

More information

SOCIETA ITALIANA DI NUTRIZIONE UMANA Milano novembre Geltrude Mingrone. Istituto di Clinica Medica Università Cattolica S.

SOCIETA ITALIANA DI NUTRIZIONE UMANA Milano novembre Geltrude Mingrone. Istituto di Clinica Medica Università Cattolica S. SOCIETA ITALIANA DI NUTRIZIONE UMANA Milano 29-30 novembre 2007 Geltrude Mingrone Istituto di Clinica Medica Università Cattolica S. Cuore Roma Treatment Goals for Type II Achieve normal or near-normal

More information

Glossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"

More information

Metabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD

Metabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD Metabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy

More information

REVIEW-THEMED ISSUE Systems biology approaches to understand the effects of nutrition and promote health

REVIEW-THEMED ISSUE Systems biology approaches to understand the effects of nutrition and promote health British Journal of Clinical Pharmacology Br J Clin Pharmacol (2017) 83 38 45 38 REVIEW-THEMED ISSUE Systems biology approaches to understand the effects of nutrition and promote health Correspondence Professor

More information

Plasma lipid transfer proteins

Plasma lipid transfer proteins Plasma lipid transfer proteins Alan R. Tall Department of Medicine, College of Physicians and Surgeons of Columbia University, 630 West 168th Street, New York, NY 10032 Introduction The composition of

More information

Acetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol

More information

Lipoprotein Particle Profile

Lipoprotein Particle Profile Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular

More information

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL

CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol

More information

Natural Sources of Plasmalogens

Natural Sources of Plasmalogens Natural Sources of Plasmalogens Dawn Scott, Andrew MacKenzie and Reece Whitby 10 November 2016 Introduction What are Plasmalogens? Potential health benefits Survey of natural sources Stability Methods

More information

Presented at: Annual expert meeting on Drug-related deaths (DRD) and Drug-Related infectious diseases (DRDI), October 2014, EMCDDA, Lisbon

Presented at: Annual expert meeting on Drug-related deaths (DRD) and Drug-Related infectious diseases (DRDI), October 2014, EMCDDA, Lisbon Assessing the gender effect in mortality risk and excess mortality from natural and external causes among heroin and cocaine users in Spain Does being heroin or cocaine user add a differential risk of

More information

Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI

Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind

More information

Joslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia

Joslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia Consensus and Controversy in Diabetes and Dyslipidemia Om P. Ganda MD Director, Lipid Clinic Joslin diabetes Center Boston, MA, USA CVD Outcomes in DM vs non- DM 102 Prospective studies; 698, 782 people,

More information

Summary and concluding remarks

Summary and concluding remarks Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated

More information

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)

Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild

More information

EXPERIMENT 13: Isolation and Characterization of Erythrocyte

EXPERIMENT 13: Isolation and Characterization of Erythrocyte EXPERIMENT 13: Isolation and Characterization of Erythrocyte Day 1: Isolation of Erythrocyte Steps 1 through 6 of the Switzer & Garrity protocol (pages 220-221) have been performed by the TA. We will be

More information

Disclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017

Disclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017 Disclosures MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES Grants: NIH, Quest Diagnostics Consultant: Quest Diagnostics Merck Global Atherosclerosis Advisory Board Ronald M. Krauss, Children s Hospital

More information

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP

N-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA

More information

Prof. John Chapman, MD, PhD, DSc

Prof. John Chapman, MD, PhD, DSc Prof. John Chapman, MD, PhD, DSc Director of the Dyslipidemia and Atherosclerosis Research Unit of the National Institute for Health and Medical Research (INSERM) at the Pitié-Salpétrière Hospital in Paris

More information

Lipoprotein Pathophysiology. Lipoprotein Pathophysiology

Lipoprotein Pathophysiology. Lipoprotein Pathophysiology Lipoprotein Pathophysiology Genetic Dyslipidemia Thomas A. Hughes, M.D. Professor of Medicine Division of Endocrinology, Metabolism, and Diabetes University of Tennessee Health Science Center GW is a 47

More information

Zuhier Awan, MD, PhD, FRCPC

Zuhier Awan, MD, PhD, FRCPC Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier

More information

New Frontiers for MS in Metabolipidomics

New Frontiers for MS in Metabolipidomics New Frontiers for MS in Metabolipidomics Giuseppe Astarita, PhD Principal Scientist Discovery & Life Sciences Milford, MA USA 2011 Waters Corporation 1 Why Metabolipidomics? Biomedical Sciences o Biomarker

More information

Glossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein

More information

Acute coronary syndromes (unstable angina, myocardial

Acute coronary syndromes (unstable angina, myocardial Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J. Meikle, Gerard Wong, Despina Tsorotes, Christopher K. Barlow, Jacquelyn M. Weir, Michael J. Christopher, Gemma L. MacIntosh,

More information

Improving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF

Improving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF Application Note Lipidomics Improving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF Authors Jeremy Koelmel Department of

More information

Phospholipid characterization by a TQ-MS data based identification scheme

Phospholipid characterization by a TQ-MS data based identification scheme P-CN1716E Phospholipid characterization by a TQ-MS data based identification scheme ASMS 2017 MP-406 Tsuyoshi Nakanishi 1, Masaki Yamada 1, Ningombam Sanjib Meitei 2, 3 1 Shimadzu Corporation, Kyoto, Japan,

More information

Customer Bulletin January 2017

Customer Bulletin January 2017 Customer Bulletin January 2017 Revised s: PTS Panels Multi-Chemistry Controls (Lot Numbers MC23, MC24, MC25, and MC26) (REF 721) Summary: New range cards has been issued for PTS Panels Multi-Chemistry

More information

Allogenic adipose-derived stem cell therapy overcomes ischemia-induced microvessel rarefaction in the myocardium: systems biology study

Allogenic adipose-derived stem cell therapy overcomes ischemia-induced microvessel rarefaction in the myocardium: systems biology study Vilahur et al. Stem Cell Research & Therapy (2017) 8:52 DOI 10.1186/s13287-017-0509-2 RESEARCH Open Access Allogenic adipose-derived stem cell therapy overcomes ischemia-induced microvessel rarefaction

More information

HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington

HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington Disclosures NIH AHA Insilicos Consultant Merck Research Support GSK Research Support Pfizer Research Support Corcept

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed

More information

Postnatal development of hepatocellular apolipoprotein B assembly and secretion in the rat

Postnatal development of hepatocellular apolipoprotein B assembly and secretion in the rat Postnatal development of hepatocellular apolipoprotein B assembly and secretion in the rat Dietmar Plonné, 1, * Hans-Peter Schulze,* Ulla Kahlert,* Kerstin Meltke,* Holger Seidolt,* Andrew J. Bennett,

More information

SUPPLEMENTAL DATA AGING, April 2013, Vol.5 No.4

SUPPLEMENTAL DATA AGING, April 2013, Vol.5 No.4 SUPPLEMENTAL DATA Figure S1. Under CR conditions, the atg32δ mutation elevates the extent of oxidative damage to proteins. WT and atg32δ strains were cultured in the nutrient rich YP medium initially containing

More information

Lipids digestion and absorption, Biochemistry II

Lipids digestion and absorption, Biochemistry II Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very

More information