SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients
|
|
- Stephen Willis
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró a, Maisa García-Arguinzonis a, Gemma Vilahur a, Inka Miñambres b, Jose María Pou b, Juan Ybarra c, Lina Badimon a,d * From a Cardiovascular Research Center (CSIC-ICCC) and Biomedical Research Institute Sant Pau (IIB-Sant Pau); b Endocrinology Department, Hospital de la Santa Creu i Sant Pau; c Teknon Medical Center; d Cardiovascular Research Chair UAB; Barcelona, Spain. 7 Supplemental Figures and 1 Supplemental Table Correspondence to: Prof. Lina Badimon Cardiovascular Research Center, c/sant Antoni MªClaret 167, Barcelona, Spain. Phone: (34) Fax: (34) lbadimon@csic-iccc.org 1
2 LEGENDS TO SUPPLEMENTAL FIGURES Supplemental Figure 1. Representative serum 2-DE image Apo A-I spots profile in different ph and MW ranges (pi 4-7, 10% PAGE; and pi , 15% PAGE) and 3D image of the 5 detected forms of 28kDa. Supplemental Figure 2. Representative images of Apo A-I profile in VLDL samples (N=3/group) showing only the 28 kda form by 2-DE (pi range 4-7, 10% PAGE) and 1-DE followed by WB Apo A-I detection. Supplemental Figure 3. Representative 2-DE image (pi range 4-7, 10% PAGE) of LDL. The main detected proteins are Apo A-I and Apo E. Supplemental Figure 4. Bar diagrams showing differences in lipidomic profile in LDL fractions between DM (N=10) and non-dm-patients (N=8): (A) Free cholesterol and triglycerides in LDL assessed by TLC; (B) Cholesterol esters (CE), lysophosphatidylcholine (LPC), lysophosphatidylethanolamine (LPE), lysophosphatidylserine (LPS), phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylserine (PS), and sphingomyelin (SM) analyzed by LC-MS. *p<0.05 Supplemental Figure 5. Representative 2-DE image (pi range 4-7, 10% PAGE) of Apo A-I in HDL subclasses. Apo A-I Δ(1-38) is not detected in HDL2 nor in HDL3. Supplemental Figure 6. (A) Representative 2-DE image (pi range 4-7, 10% PAGE) of Apo A-I in rat serum showing both Apo A-I forms of 28 and 26 kda. (B) Box-plot diagram of the intensity of the 26 kda Apo A-I form in hepatic tissue of control and diabetic rats (N=3/group; *p<0.05). (C) Human and rat Apo A-I aminoacid sequences showing in silico cathepsin D cleavage site. 2
3 Supplemental Figure 7. (A) 1-DE profile of cathepsin D digestion of purified Apo A-I. Hemoglobin was used as a possitive control for cathepsin D activity. (B) Box-plot diagram of cathepsin D activity in hepatic tissue of control (N=8) and diabetic rats (N=7; *p<0.05). (C) Representative 2-DE, followed by Apo A-I WB, image (pi range 4-7, 10% PAGE) of Apo A-I in rat liver extracts showing both Apo A-I forms of 28 and 26 kda. (D) Box-plot diagram showing the intensity of the 26 kda Apo A-I form in hepatic tissue of control (N=4) and diabetic rats (N=4; *p<0.05). 3
4 SUPPLEMENTAL TABLE 1: Peak list obtained in the simulated tryptic digestion of Apo A-I using Sequence Editor tool of BioTools (Bruker Daltonics, BioTools 3.02) Nº Range Mono Partials Sequence 44 [ ] QKVEPLR 49 [ ] AELQEGAR 55 [ ] LHELQEK 29 [75-82] DLEEVKAK 77 [ ] LAARLEALK 1 [1-9] ATVYVDVLK 65 [ ] ARAHVDALR 91 [ ] AKPALEDLR 58 [ ] LSPLGEEMR 50 [ ] AELQEGARQK 53 [ ] QKLHELQEK 80 [ ] LEALKELGGAR 88 [ ] ATEHLSTLSEK 94 [ ] QGLLPVLESFK 34 [83-92] VQPYLDDFQK 75 [ ] QRLAARLEALK 63 [ ] DRARAHVBALR 40 [94-102] WQEEMELYR 70 [ ] THLAPYSDELR 59 [ ] LSPLGEEMRDR 23 [64-74] ETEGLRQEMSK 26 [70-80] QEMSKDLEEVK 35 [83-93] VQPYLDDFQKK 97 [ ] VSFLSALEEYTK 7 [14-26] DYVSQFEGSALGK 38 [93-102] KWQEEMELYR 83 [ ] ENGGARLAEYHAK 2 [1-13] ATVYVDVLKDSGR 32 [81-92] AKVQPYLDDFQK 47 [ ] VEPLRAELQEGAR 98 [ ] VSFLSALEEYTKK 60 [ ] LSPLGEEMRDRAR 27 [70-82] QEMSKDLEEVKAK 41 [94-104] WQEEMELYRQK 78 [ ] LAARLEALKENGGAR 33 [81-93] AKVQPYLDDFQKK 71 [ ] THLAPYSDELRQR 13 [32-45] LLDNVDSVTSTFSK 39 [93-104] KVQEEMELYRQK 45 [ ] QKVEPLRAELQEGAR 48 [ ] VEPLRAELQEGARQK 5 [10-26] DSGRDYVSQFEGSALGK 4
5 Nº Range Mono Partials Sequence 14 [32-47] LLDNWDSVTSTFSKLR 56 [ ] LHELQELSPLGEEMR 19 [48-63] EQLGPVTQEFWDNLEK 81 [ ] LEALKENGGARLAEYHAK 99 [ ] VSFLSALEEYTKKLNTQ 8 [14-31] DYVSQFEGSALGKQLNLK 72 [ ] THLAPYSDELRQRLAAR 51 [ ] AELQEGARQKLHELQEK 24 [64-80] ETEGLRQEMSKDLEEVK 86 [ ] LAEYHAKATEHLSTLSEK 68 [ ] AHVDALRTHLAPYSDELR 42 [94-109] WQEEMELYRQKVEPLR 30 [75-92] DLEEVKAKVQPYLDDFQK 54 [ ] QKLHELQEKLSPLGEEMR 57 [ ] LHELQEKLSPLGEEMRDR 17 [46-63] LREQLGPVTQEFWDNLEK 11 [27-45] QLNLKLLDNWDSVTSTFSK 89 [ ] ATEHLSTLSEKAKPALEDLR 92 [ ] AKPALEDLRQGLLPVLESFK 66 [ ] ARAHVDALRTHLAPYSDELR 69 [ ] AHVDALRTHLAPYSDELRQR 6 [10-31] DSGRDYVSQFEGSALGKQLNLK 12 [27-47] QLNLKLLDNWDSVTSTFSKLR 95 [ ] QGLLPVLESFKVSFLSALEEYTK 84 [ ] ENGGARLAEYHAKATEHLSTLSEK 20 [48-69] EQLGPVTQEFWDNLEKETEGLR 36 [83-102] VQPYLDDFQKKWQEEMELYR 96 [ ] QGLLPVLESFKVSFLSALEEYTKK 3 [1-26] ATVYVDVLKDSGRDYVSQFEGSALGK 18 [46-69] LREQLGPVTQEFWDNLEKETEGLR 5
6 6
7 7
8 8
9 9
10 10
11 11
12 12
Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationPoly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
More informationPCs Acyl chain double bonds. PEs
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationLC/MS Method for Comprehensive Analysis of Plasma Lipids
Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,
More informationImpact of Chromatography on Lipid Profiling of Liver Tissue Extracts
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction
More informationMOLECULAR PATHOLOGY OF ATHEROSCLEROSIS
MOLECULAR PATHOLOGY OF ATHEROSCLEROSIS Dubrovnik 2013 Lina Badimon Barcelona Cardiovascular Research Center (CSIC-ICCC) IIB-Sant Pau, Hospital de la Santa Creu i Sant Pau ATHEROSCLEROSIS ATHEROTHROMBOSIS
More information(1) Cardiovascular Research Center (CSIC-ICCC), IIB-Sant Pau (2) Cardiovascular Research
Lipidomic changes of LDL in overweight and moderately hypercholesterolemic subjects taking phytosterol and omega-3 supplemented milk. Running title: Phytosterols and omega-3 effects on plasma LDL-lipid
More informationLipids Analysis. Lipids
Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationBringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health
Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive
More informationMass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
More informationEnrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents
Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationSUPPORTING INFORMATION. Nontargeted quantitation of lipid classes using hydrophilic interaction liquid
SUPPORTING INFORMATION Nontargeted quantitation of lipid classes using hydrophilic interaction liquid chromatography - electrospray ionization mass spectrometry with single internal standard and response
More informationGlycerolipid Analysis. LC/MS/MS Analytical Services
Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric
More informationNature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
More informationLarge-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention
Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..
More informationDECLARATION OF CONFLICT OF INTEREST. None
DECLARATION OF CONFLICT OF INTEREST None Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J Meikle 1, Gerard Wong 1, Despina Tsorotes 1, Christopher K Barlow 1, Jacquelyn
More informationArticle Phytosterols and Omega 3 Supplementation Exert Novel Regulatory Effects on Metabolic and Inflammatory Pathways: A Proteomic Study
Article Phytosterols and Omega 3 Supplementation Exert Novel Regulatory Effects on Metabolic and Inflammatory Pathways: A Proteomic Study Carmen Lambert 1, Judit Cubedo 1,2,, Teresa Padró 1,2, Joan Sánchez-Hernández
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationOverview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer
Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel
More informationSupporting Information
Composition and lipid spatial distribution of High Density Lipoprotein particles in subjects with Laxman Yetukuri, 1 Sanni Söderlund, 2 Artturi Koivuniemi, 3 Tuulikki Seppänen-Laakso, 1 Perttu S. Niemelä,
More informationBlood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.
Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary
More informationPhospholipid Analysis. P NMR Analytical Services
Phospholipid Analysis 31 P NMR Analytical Services Quantitative Phospholipid Analysis of Soy Lecithin and Krill Lecithin by 31 P NMR Katherine L Lanier; Jeff D Moore; Dale Smith; Shengrong Li; Ben Davis;
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More informationWalter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI
Walter B. Bayubay CLS (ASCP), AMT, MA Ed, CPI Biochemical Analysis (Lipid Panel) Analyte Total Cholesterol Reference Range Patient A < 200 241 LDL-C /= 40 38 Triglycerides
More informationSupplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
More informationStudies on the effect of dietary fish oil on the physical and chemical properties of low density lipoproteins in cynomolgus monkeys
Studies on the effect of dietary fish oil on the physical and chemical properties of low density lipoproteins in cynomolgus monkeys John S. Parks' and Abraham K. Gebre Department of Comparative Medicine,
More informationLipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry
Lipoproteins Metabolism Reference: Campbell Biochemistry and Lippincott s Biochemistry Learning Objectives 1. Define lipoproteins and explain the rationale of their formation in blood. 2. List different
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationSoluble LRP1 is an independent biomarker of epicardial fat volume in patients with type 1 diabetes mellitus
www.nature.com/scientificreports Received: 16 August 2017 Accepted: 28 December 2017 Published: xx xx xxxx OPEN Soluble LRP1 is an independent biomarker of epicardial fat volume in patients with type 1
More informationLipid Imaging Mass Spectrometry.
Lipid Imaging Mass Spectrometry. NH 2 P H H H H P H H P H N N Advanced Graduate Course in Metabolomics 3-11-2015 Janusz Kabarowski, Dept. of Microbiology, UAB. Matrix-Assisted Laser Desorption/Ionization
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationA Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids
A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids Jeremy Netto, 1 Stephen Wong, 1 Federico Torta, 2 Pradeep Narayanaswamy, 2
More informationSupplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification
Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics
More informationReplacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
More informationThe use of mass spectrometry in lipidomics. Outlines
The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid
More informationEffect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I
Effect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I Yoshifumi Kurosaki 1), Hitoshi Ikeya 2), Hisao Haniu 3) and Zensuke Ogawa 1) It is reported that self-associated
More informationDefective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome
Defective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome Fabiana Rached, *, Raul D. Santos, Laurent Camont, * Marcio H. Miname, Marie
More informationSupporting information
Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo
More informationOpinion on the safety assessment of phospholipds obtained from egg yolk as food produced using a new process
EUROPEAN COMMISSION DIRECTORATE-GENERAL XXIV CONSUMER POLICY AND CONSUMER HEALTH PROTECTION Directorate B - Scientific opinions on health matters Unit B3 - Management of scientific committees II SCIENTIFIC
More informationINNOVATION THAT REALLY MATTERS. Prof. Lina Badimon. Institut Català de Ciències Cardiovasculars (ICCC), Barcelona
INNOVATION THAT REALLY MATTERS Prof. Lina Badimon, Barcelona THE INSTITUTION THE INSTITUTION THE ICCC CATALAN INSTITUTE FOR CARDIOVASCULAR SCIENCE (ICCC) Objectives LEADING AN STRATEGIC PLANNING IN CVR
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationComprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer
B American Society for Mass Spectrometry, 2014 J. Am. Soc. Mass Spectrom. (2015) 26:133Y148 DOI: 10.1007/s13361-014-1013-x RESEARCH ARTICLE Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid
More informationHypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002
Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low
More informationHypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC
Hypertriglyceridemia: Why, When, and How to Treat Gregory Cohn, MD, FNLA, FASPC DISCLOSURES Consultant to Akcea Therapeutics (in the past 12 months). OUTLINE I. Lipoproteins II. Non-HDL-C III. Causes and
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationThe New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk
The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing
More informationEmerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids
Emerging science on omega-3: A lipidomic view of omega-3 in health and disease Peter Meikle 04 May 2017 Health benefits of omega 3 fatty acids Can lower plasma triacylglycerol can reduce the risk of metabolic
More informationChapter VIII: Dr. Sameh Sarray Hlaoui
Chapter VIII: Dr. Sameh Sarray Hlaoui Lipoproteins a Lipids are insoluble in plasma. In order to be transported they are combined with specific proteins to form lipoproteins: Clusters of proteins and lipids.
More informationBy: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
More informationTest Definition: FNMR2 NMR LipoProfile w/ir Markers
Reporting Title: Performing Location: Labcorp Burlington Specimen Requirements: Submit only one of the following specimens: Serum Draw blood in a plain red-top tube(s). (Serum gel tube is not acceptable.)
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More informationLow-density lipoprotein as the key factor in atherogenesis too high, too long, or both
Low-density lipoprotein as the key factor in atherogenesis too high, too long, or both Lluís Masana Vascular Medicine and Metabolism Unit. Sant Joan University Hospital. IISPV. CIBERDEM Rovira i Virgili
More informationDysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE
Dysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE PIs and Members of HDL Project Wei Gao, M.D., Ph.D. Professor and Chair Cardiology Third Hospital, PUHSC Yong Huo, M.D., Ph.D.
More informationPrograma Cooperación Farma-Biotech Jornada II: Oncología
Programa Cooperación Farma-Biotech Jornada II: Oncología Minerval : Treatment of glioma and other types of cancer Vicenç Tur. CEO, Co-founder Barcelona, 13 de abril de 2011 Programa Cooperación Farma-Biotech
More informationNOVEL BIOMARKERS IN RISK ASSESSMENT AND MANAGEMENT OF CARDIOVASCULAR DISEASE
CARDIOVASCULAR DISEASE Non-Discrimination Statement and Multi-Language Interpreter Services information are located at the end of this document. Coverage for services, procedures, medical devices and drugs
More informationFig. S1. REGN1500 reduces plasma levels of cholesterol, TG and NEFA in WT and Ldlr -/- mice. (A) WT
Figure Legends for Supplementary Figures. Fig. S1. REGN15 reduces plasma levels of cholesterol, TG and NEF in WT and Ldlr -/- mice. () WT and Ldlr -/- mice were injected with control IgG or REGN15 (1 mg/kg)
More informationSUPPORTING INFORMATION FOR:
SUPPORTING INFORMATION FOR: Metabolomics and lipidomics profiling of a combined mitochondrial plus endoplasmic reticulum fraction of human fibroblasts: a robust tool for clinical studies Charlotte Veyrat-Durebex
More informationObtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS
Obtaining Answers to Biological Questions Sample Prep to Data Analysis Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS OMICS Research Why Quantitative OMICS? 2 2015 AB Sciex SCIEX
More informationMetabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
More informationSubj ect Index. For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes)
Subj ect Index For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes) A absorption, intestinal 48-63, 66,77,78 ACAT-enzyme 187,188,192,197, 198,203 acetate 66,67,152,158,160,173 acetone-butanol
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationDefining Severe Familial Hypercholesterolemia. Raul D. Santos MD, PhD Brazil
Defining Severe Familial Hypercholesterolemia Raul D. Santos MD, PhD Brazil 1 Disclosure Honoraria received for consulting, speaker and or researcher activities : Astra Zeneca, Akcea, Amgen, Biolab, Esperion,
More informationControl 7 d cold 7 d CL
Control 7 d cold 7 d ibat iwat gwat Supplementary Figure 1. Histology of adipose tissues after cold or 3-adrenergic receptor stimulation. C57BL/6J wild-type mice were housed at 4 C or injected daily with
More informationSOCIETA ITALIANA DI NUTRIZIONE UMANA Milano novembre Geltrude Mingrone. Istituto di Clinica Medica Università Cattolica S.
SOCIETA ITALIANA DI NUTRIZIONE UMANA Milano 29-30 novembre 2007 Geltrude Mingrone Istituto di Clinica Medica Università Cattolica S. Cuore Roma Treatment Goals for Type II Achieve normal or near-normal
More informationGlossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
More informationMetabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD
Metabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy
More informationREVIEW-THEMED ISSUE Systems biology approaches to understand the effects of nutrition and promote health
British Journal of Clinical Pharmacology Br J Clin Pharmacol (2017) 83 38 45 38 REVIEW-THEMED ISSUE Systems biology approaches to understand the effects of nutrition and promote health Correspondence Professor
More informationPlasma lipid transfer proteins
Plasma lipid transfer proteins Alan R. Tall Department of Medicine, College of Physicians and Surgeons of Columbia University, 630 West 168th Street, New York, NY 10032 Introduction The composition of
More informationAcetyl CoA HMG CoA Mevalonate (C6) Dimethylallyl Pyrophosphate isopentenyl Pyrophosphate (C5) Geranyl Pyrophosphate (C10) FarnesylPyrophosphate (C15) Squalene (C30) Lanosterol (C30) 7 Dehydrocholesterol
More informationLipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
More informationCHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
More informationNatural Sources of Plasmalogens
Natural Sources of Plasmalogens Dawn Scott, Andrew MacKenzie and Reece Whitby 10 November 2016 Introduction What are Plasmalogens? Potential health benefits Survey of natural sources Stability Methods
More informationPresented at: Annual expert meeting on Drug-related deaths (DRD) and Drug-Related infectious diseases (DRDI), October 2014, EMCDDA, Lisbon
Assessing the gender effect in mortality risk and excess mortality from natural and external causes among heroin and cocaine users in Spain Does being heroin or cocaine user add a differential risk of
More informationWelcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI
Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind
More informationJoslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia
Consensus and Controversy in Diabetes and Dyslipidemia Om P. Ganda MD Director, Lipid Clinic Joslin diabetes Center Boston, MA, USA CVD Outcomes in DM vs non- DM 102 Prospective studies; 698, 782 people,
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationDietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
More informationEXPERIMENT 13: Isolation and Characterization of Erythrocyte
EXPERIMENT 13: Isolation and Characterization of Erythrocyte Day 1: Isolation of Erythrocyte Steps 1 through 6 of the Switzer & Garrity protocol (pages 220-221) have been performed by the TA. We will be
More informationDisclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017
Disclosures MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES Grants: NIH, Quest Diagnostics Consultant: Quest Diagnostics Merck Global Atherosclerosis Advisory Board Ronald M. Krauss, Children s Hospital
More informationN-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP
Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA
More informationProf. John Chapman, MD, PhD, DSc
Prof. John Chapman, MD, PhD, DSc Director of the Dyslipidemia and Atherosclerosis Research Unit of the National Institute for Health and Medical Research (INSERM) at the Pitié-Salpétrière Hospital in Paris
More informationLipoprotein Pathophysiology. Lipoprotein Pathophysiology
Lipoprotein Pathophysiology Genetic Dyslipidemia Thomas A. Hughes, M.D. Professor of Medicine Division of Endocrinology, Metabolism, and Diabetes University of Tennessee Health Science Center GW is a 47
More informationZuhier Awan, MD, PhD, FRCPC
Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier
More informationNew Frontiers for MS in Metabolipidomics
New Frontiers for MS in Metabolipidomics Giuseppe Astarita, PhD Principal Scientist Discovery & Life Sciences Milford, MA USA 2011 Waters Corporation 1 Why Metabolipidomics? Biomedical Sciences o Biomarker
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationAcute coronary syndromes (unstable angina, myocardial
Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J. Meikle, Gerard Wong, Despina Tsorotes, Christopher K. Barlow, Jacquelyn M. Weir, Michael J. Christopher, Gemma L. MacIntosh,
More informationImproving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF
Application Note Lipidomics Improving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF Authors Jeremy Koelmel Department of
More informationPhospholipid characterization by a TQ-MS data based identification scheme
P-CN1716E Phospholipid characterization by a TQ-MS data based identification scheme ASMS 2017 MP-406 Tsuyoshi Nakanishi 1, Masaki Yamada 1, Ningombam Sanjib Meitei 2, 3 1 Shimadzu Corporation, Kyoto, Japan,
More informationCustomer Bulletin January 2017
Customer Bulletin January 2017 Revised s: PTS Panels Multi-Chemistry Controls (Lot Numbers MC23, MC24, MC25, and MC26) (REF 721) Summary: New range cards has been issued for PTS Panels Multi-Chemistry
More informationAllogenic adipose-derived stem cell therapy overcomes ischemia-induced microvessel rarefaction in the myocardium: systems biology study
Vilahur et al. Stem Cell Research & Therapy (2017) 8:52 DOI 10.1186/s13287-017-0509-2 RESEARCH Open Access Allogenic adipose-derived stem cell therapy overcomes ischemia-induced microvessel rarefaction
More informationHDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington
HDL and Its Galaxy of Proteins: What Do they Do? Jay Heinecke, University of Washington Disclosures NIH AHA Insilicos Consultant Merck Research Support GSK Research Support Pfizer Research Support Corcept
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed
More informationPostnatal development of hepatocellular apolipoprotein B assembly and secretion in the rat
Postnatal development of hepatocellular apolipoprotein B assembly and secretion in the rat Dietmar Plonné, 1, * Hans-Peter Schulze,* Ulla Kahlert,* Kerstin Meltke,* Holger Seidolt,* Andrew J. Bennett,
More informationSUPPLEMENTAL DATA AGING, April 2013, Vol.5 No.4
SUPPLEMENTAL DATA Figure S1. Under CR conditions, the atg32δ mutation elevates the extent of oxidative damage to proteins. WT and atg32δ strains were cultured in the nutrient rich YP medium initially containing
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More information