PCs Acyl chain double bonds. PEs
|
|
|
- Gwenda McDonald
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs Acyl chain double bonds PEs Acyl chain double bonds Supplementary figure 1. Relationship between gender and acyl chain double bond content of lipids. The mean ratio level of males vs females for (a) PCs; phosphatidylcholines and (b) PEs, phosphatidylethanolamines. Each data point represents a distinct lipid organised along the x axis by double bond content.
2 Supplementary figure 2. Hierarchical clustered heat map showing correlations between the biochemical parameters and lipidome data as determined by rcca. Dendograms on the right and bottom illustrate the arrangement of the clusters produced by hierarchical clustering of the similarity matrix produced by rcca. The colour in the heatmap indicates the nature and strength of the correlation between different inflammatory markers and lipids as defined by the colour key in the top left corner. Lipid class is indicated by the colour key to the bottom of the
3 heat map; lysophosphatidylcholine, dark yellow; lysophosphatidylethanolamine, light yellow phosphatidylserine, blue; ceramides, orange; phosphatidylcholine, light green; phosphatidylethanolamine, dark green; sphingomyelin, pink; phosphatidylglycerol, grey.
4 Supplementary figure 3. Hierarchical clustered heat map of results from rcca of the lipoprotein and lipidome data. Dendograms on the right and bottom illustrate the arrangement of the clusters produced by hierarchical clustering of the similarity matrix produced by rcca. The colour in the heatmap indicates the nature and strength of the correlation between different biochemical parameters and lipids as defined by the colour key in the top left corner. Lipid class is indicated by the colour key to the bottom of the heat map; lysophosphatidylcholine, dark yellow; lysophosphatidylethanolamine, light yellow phosphatidylserine, blue; ceramides, orange; phosphatidylcholine, light green; phosphatidylethanolamine, dark green; sphingomyelin, pink; phosphatidylglycerol, grey.
5 Supplementary Information Table I. Results for Rcca of lipid analytes and biochemical parameters. Associations exceeding the similarity threshold of 0.3 are shown. (a) Negative similarity score, (b) positive similarity score (a) Biochemical/Inflammatory parameter Lipid Similarity score Leptin LPC.a.C C reactive protein LPC.a.C Leptin LPC.a.C TNF alpha PE.ae.C TNF alpha PE.ae.C C reactive protein LPC.a.C TNF alpha PE.ae.C TNF alpha PE.ae.C TNF alpha PE.ae.C MCP - 1 LPC.a.C TNF alpha PC.ae.C TNF alpha PE.ae.C Leptin LPC.e.C TNF alpha PC.ae.C TNF alpha PE.ae.C TNF alpha PC.ae.C Resistin SM.C TNF alpha LPC.e.C TNF alpha PE.ae.C TNF alpha PC.ae.C TNF alpha SM.C TNF alpha PE.ae.C Leptin PC.ae.C C reactive protein LPC.a.C TNF alpha PE.ae.C Leptin PC.ae.C Resistin PC.ae.C C reactive protein PC.aa.C TNF alpha PE.aa.C TNF alpha PC.aa.C C reactive protein LPC.e.C C reactive protein PC.ae.C TNF alpha N.C20.1.Cer.2H MCP - 1 PE.ae.C Resistin PC.ae.C C reactive protein PC.ae.C TNF alpha PE.aa.C
6 TNF alpha PE.ae.C C reactive protein LPE.a.C Resistin PC.ae.C MCP - 1 PC.aa.C C reactive protein PE.ae.C TNF alpha PE.aa.C Resistin PE.ae.C Resistin PE.ae.C MCP - 1 PC.aa.C Resistin N.C24.0.Cer Resistin PE.ae.C Leptin LPC.a.C C reactive protein PC.ae.C TNF alpha PC.ae.C Resistin PE.aa.C TNF alpha PC.ae.C Resistin SM.C C reactive protein LPE.a.C C reactive protein N.C16.0.Cer TNF alpha PC.aa.C TNF alpha PC.ae.C Leptin LPE.a.C TNF alpha PE.aa.C TNF alpha PC.ae.C TNF alpha PE.aa.C Resistin PC.ae.C C reactive protein PC.aa.C TNF alpha SM.C Leptin N.C20.1.Cer.2H Resistin N.C23.0.Cer Resistin PE.ae.C Resistin PE.ae.C C reactive protein LPE.a.C C reactive protein PC.ae.C Resistin PC.aa.C C reactive protein PE.ae.C C reactive protein PE.aa.C MCP - 1 PC.ae.C C reactive protein PE.ae.C C reactive protein PC.ae.C Resistin N.C16.0.Cer Leptin LPE.a.C MCP - 1 LPC.a.C C reactive protein LPE.a.C MCP - 1 PC.ae.C MCP - 1 LPE.a.C
7 Resistin PE.ae.C Resistin PC.ae.C C reactive protein PC.aa.C MCP - 1 PE.ae.C C reactive protein PC.ae.C TNF alpha PE.ae.C TNF alpha PC.ae.C Leptin PE.ae.C IL 8 LPC.a.C Resistin PC.aa.C MCP - 1 PC.aa.C Resistin PE.ae.C C reactive protein SM.C Leptin PC.ae.C Leptin PE.ae.C Resistin PC.aa.C C reactive protein PC.aa.C Leptin PE.aa.C MCP - 1 PC.aa.C Leptin PE.ae.C C reactive protein PC.aa.C MCP - 1 PC.aa.C Resistin PE.ae.C TNF alpha SM.C TNF alpha LPC.a.C Leptin PE.ae.C Leptin LPC.a.C C reactive protein LPE.a.C Resistin PC.ae.C TNF alpha PE.ae.C Resistin PC.ae.C Resistin PE.ae.C MCP - 1 SM.C MCP - 1 PE.ae.C C reactive protein PC.ae.C MCP - 1 PE.ae.C C reactive protein PC.aa.C TNF alpha PE.ae.C C reactive protein PE.aa.C C reactive protein PE.ae.C Resistin N.C22.0.Cer Resistin PC.aa.C MCP - 1 PE.aa.C MCP - 1 PC.ae.C
8 (b) Biochemical/Inflammatory parameter Lipid Similarity score IL 10 PC.aa.C TNF alpha N.C20.0.OH..Cer.2H IL 10 PE.aa.C IL 10 N.C16.0.Cer TNF alpha SM.C Leptin N.C27.1.Cer IL 8 SM.C IL 8 N.C25.1.Cer.2H IL 10 PE.aa.C IL 8 PS.ae.C TNF alpha SM.C IL 8 SM.C Leptin PS.aa.C IL 8 PS.aa.C IL 8 N.C27.1.Cer IL 8 SM.C TNF alpha SM.C IL 8 PS.ae.C Leptin PS.ae.C Leptin SM.C IL 8 SM.C IL 8 SM.C Leptin N.C22.0.OH..Cer IL 10 PC.aa.C IL 8 SM.C IL 10 PE.aa.C IL 8 N.C23.1.Cer Leptin PS.aa.C IL 8 SM.C TNF alpha PS.aa.C IL 8 SM.C IL 10 N.C24.0.Cer Leptin PS.aa.C TNF alpha N.C25.1.Cer.2H Leptin SM.C IL 8 PE.ae.C Leptin SM.C IL 8 SM.C
9 Supporting Information Table 2. Results for Rcca of lipid analytes and lipoproteins. Associations exceeding the similarity threshold of 0.35 are shown. Biochemical parameter Lipid Similarity score HDL PC.aa.C LDL PE.aa.C LDL PC.aa.C Apo.C3 PE.ae.C Apo.C3 PE.aa.C HDL LPE.a.C HDL LPE.a.C LDL N.C22.0.OH.Cer HDL LPE.a.C ApoA1 PE.ae.C ApoA1 PE.ae.C LDL LPE.a.C Apo.C3 PC.aa.C LDL SM.C Apo.B PC.aa.C Apo.B LPE.a.C Apo.C3 PE.aa.C LDL PE.aa.C Apo.B PC.aa.C ApoA1 PC.aa.C Apo.B PC.aa.C Apo.B PE.aa.C LDL N.C24.1.Cer Apo.C3 PE.ae.C LDL PC.aa.C ApoA1 PC.aa.C HDL N.C10.0.Cer LDL PE.aa.C Apo.B PE.aa.C LDL SM.C Apo.B PE.aa.C LDL SM.C LDL SM.C LDL N.C24.0.OH..Cer Apo.C3 PE.ae.C Apo.C3 PE.aa.C Apo.C3 PE.aa.C LDL PC.aa.C Apo.B PE.ae.C HDL PC.aa.C
10 Apo.B N.C25.0.Cer.2H LDL N.C22.1.Cer LDL N.C18.1.Cer Apo.B SM.C Apo.E LPE.a.C LDL SM.C HDL PC.aa.C Apo.C3 PE.ae.C Apo.C2 PC.aa.C Apo.B SM.C Apo.B PC.aa.C Apo.B N.C24.1.Cer Apo.C3 PE.ae.C Apo.C3 PE.ae.C ApoA1 PC.aa.C Apo.C3 PE.aa.C Apo.C2 PC.aa.C Apo.C3 PE.aa.C LDL N.C22.0.Cer LDL N.C23.0.OH..Cer LDL N.C16.0.Cer Apo.C3 PE.ae.C Apo.C2 PE.aa.C Apo.B PE.aa.C Apo.B PE.ae.C Apo.B PE.ae.C Apo.C3 PE.ae.C LDL SM.C Apo.C2 PE.aa.C Apo.B PE.ae.C Apo.B PE.ae.C Apo.C3 PC.aa.C LDL PC.aa.C HDL PC.aa.C HDL PC.aa.C Apo.B N.C23.0.Cer Apo.C3 PE.aa.C LDL N.C22.0.Cer.2H Apo.B LPE.a.C Apo.B PC.aa.C Apo.B N.C23.0.OH..Cer Apo.C3 PC.aa.C Apo.B PC.aa.C Apo.B PE.aa.C LDL N.C23.0.Cer ApoA1 PE.ae.C
11 Apo.C3 PE.ae.C Apo.E PC.aa.C Apo.B PE.ae.C Apo.B PC.ae.C HDL LPE.a.C Apo.C3 PC.aa.C Apo.E LPE.a.C Apo.B PE.aa.C Apo.C3 PE.aa.C Apo.C3 PE.aa.C Apo.B PC.aa.C LDL SM.C Apo.B PE.ae.C LDL N.C25.1.Cer Apo.E LPE.a.C Apo.C3 PC.aa.C Apo.C3 PC.aa.C LDL N.C20.1.Cer Apo.E N.C18.1.Cer ApoA1 PE.ae.C Apo.B PE.ae.C LDL PC.aa.C HDL PE.aa.C Apo.C2 PC.aa.C Apo.B SM.C ApoA1 PE.aa.C Apo.B PE.ae.C Apo.B PC.aa.C LDL N.C21.0.Cer LDL SM.C HDL PC.aa.C LDL N.C24.0.Cer Apo.C3 PC.aa.C Apo.C2 PE.aa.C Apo.B N.C16.0.Cer.2H ApoA1 PC.ae.C LDL N.C25.0.Cer.2H LDL PC.aa.C LDL SM.C Apo.C2 PE.ae.C Apo.B PE.aa.C ApoA1 PC.aa.C Apo.B PE.aa.C Apo.C2 PE.ae.C Apo.B N.C22.0.OH..Cer Apo.B PE.aa.C
12 Apo.B PE.aa.C Apo.B PC.aa.C Apo.C3 PC.ae.C ApoA1 SM.C LDL SM.C Apo.B PC.aa.C LDL PE.aa.C LDL N.C24.1.Cer.2H Apo.B N.C24.0.OH..Cer ApoA1 PE.ae.C Apo.B SM.C ApoA1 PE.aa.C LDL PC.aa.C HDL PC.aa.C Apo.B N.C25.1.Cer Apo.B N.C16.0.Cer HDL LPC.a.C Apo.C3 LPE.a.C LDL N.C12.0.Cer.2H Apo.B SM.C Apo.B PC.aa.C LDL N.C18.0.Cer LDL N.C18.0.OH..Cer.2H LDL SM.C HDL PC.aa.C Apo.E N.C20.0.OH..Cer Apo.B SM.C Apo.B PE.aa.C ApoA1 PE.aa.C Apo.C2 PC.aa.C LDL PE.aa.C Apo.B LPE.a.C Apo.B N.C12.0.Cer.2H Apo.C2 PC.aa.C Apo.B N.C24.0.Cer LDL PC.aa.C LDL PE.aa.C Apo.B PC.aa.C Apo.B N.C24.1.Cer.2H Apo.B PE.ae.C Apo.B SM.C Apo.B PC.aa.C LDL PE.ae.C HDL N.C18.1.Cer Apo.B PC.aa.C ApoA1 PE.aa.C
13 LDL N.C18.0.Cer.2H Apo.B LPC.a.C Apo.B PE.aa.C Apo.C3 N.C25.0.Cer.2H Apo.B PE.aa.C LDL PE.aa.C Apo.B PE.ae.C Apo.C2 PE.ae.C Apo.B N.C21.0.Cer Apo.C2 PE.aa.C Apo.C3 N.C16.0.Cer.2H Apo.C3 PE.ae.C Apo.C2 PE.aa.C Apo.C3 PE.aa.C LDL SM.C Apo.C2 PS.ae.C Apo.C2 PE.ae.C Apo.B SM.C LDL SM.C LDL N.C17.0.OH..Cer Apo.B PC.aa.C Apo.B PE.aa.C Apo.C2 PC.ae.C Apo.C3 PE.ae.C LDL N.C24.0.Cer.2H Apo.C3 SM.C Apo.C3 PC.aa.C LDL PE.aa.C LDL PC.ae.C Apo.B PE.aa.C LDL N.C23.1.Cer Apo.B PE.ae.C Apo.C3 PE.ae.C LDL PC.aa.C ApoA1 PE.ae.C ApoA1 LPE.a.C LDL LPE.a.C
Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
Mass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
SUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients
SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró
The use of mass spectrometry in lipidomics. Outlines
The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid
Poly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
Supporting Information
Composition and lipid spatial distribution of High Density Lipoprotein particles in subjects with Laxman Yetukuri, 1 Sanni Söderlund, 2 Artturi Koivuniemi, 3 Tuulikki Seppänen-Laakso, 1 Perttu S. Niemelä,
Supplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification
Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics
Supplementary material
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Epithelial-to-mesenchymal transition involves triacylglycerol accumulation in DU145
LC/MS Method for Comprehensive Analysis of Plasma Lipids
Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
Lipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
in-silico Design of Nanoparticles for Transdermal Drug Delivery Application
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 in-silico Design of Nanoparticles for Transdermal Drug Delivery Application Rakesh Gupta and Beena
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction
SUPPORTING INFORMATION. Nontargeted quantitation of lipid classes using hydrophilic interaction liquid
SUPPORTING INFORMATION Nontargeted quantitation of lipid classes using hydrophilic interaction liquid chromatography - electrospray ionization mass spectrometry with single internal standard and response
Citation for published version (APA): Sivapalaratnam, S. (2012). The molecular basis of early onset cardiovascular disease
UvA-DARE (Digital Academic Repository) The molecular basis of early onset cardiovascular disease Sivapalaratnam, S. Link to publication Citation for published version (APA): Sivapalaratnam, S. (2012).
Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms
Supplementary table 1 Demographic and clinical characteristics of participants by paraoxonase-1 (PON-1) gene polymorphisms QQ QR/RR n = 36 n = 80 Men (%) 20 (55) 54 (67) 0.216 Age (years) 57 ± 10 56 ±
Bringing metabolic profiling into clinical practice. Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health
Bringing metabolic profiling into clinical practice Linda Mustelin, MD, PhD, MPH Senior Medical Scientist Nightingale Health Nightingale Health Ltd. Finnish biotech company specialized in comprehensive
Nature Genetics: doi: /ng.3561
Supplementary Figure 1 Pedigrees of families with APOB p.gln725* mutation and APOB p.gly1829glufs8 mutation (a,b) Pedigrees of families with APOB p.gln725* mutation. (c) Pedigree of family with APOB p.gly1829glufs8
7/11/17. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell
Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions
Nature Medicine: doi: /nm.3967
Supplementary Figure 1. Network clustering. (a) Clustering performance as a function of inflation factor. The grey curve shows the median weighted Silhouette widths for varying inflation factors (f [1.6,
2.28E E AKT/CAT P-3-4:
Supplemental Table 1: IPA network analysis of the microarray data presented in Figure 6 showing the most significant molecular and cellular function classifications along with the respective number of
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
Identification of Lipidomic Biomarkers for Coexposure to Subtoxic Doses of Benzo[a]pyrene and Cadmium: The Toxicological Cascade Biomarker Approach
![Identification of Lipidomic Biomarkers for Coexposure to Subtoxic Doses of Benzo[a]pyrene and Cadmium: The Toxicological Cascade Biomarker Approach](/thumbs/86/94000882.jpg "Identification of Lipidomic Biomarkers for Coexposure to Subtoxic Doses of Benzo[a]pyrene and Cadmium: The Toxicological Cascade Biomarker Approach")
Supporting Information Identification of Lipidomic Biomarkers for Coexposure to Subtoxic Doses of Benzo[a]pyrene and Cadmium: The Toxicological Cascade Biomarker Approach Harald Jungnickel,*,1 Sarah Potratz,
Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures
Supplementary Data Supplementary Table 1. Baseline Characteristics by Quintiles of Systolic and Diastolic Blood Pressures Quintiles of Systolic Blood Pressure Quintiles of Diastolic Blood Pressure Q1 Q2
Lipid Analysis. Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th Introduction to lipid structures
Lipid Analysis Andréina Laffargue, IRD CRYMCEPT Montpellier workshop, October 17th 2005 Introduction to lipid structures Fatty acids Acylglycerols Glycerophospholipids Sterols Strategies involved in lipid
Supplemental Information. Genetic Regulation of Plasma Lipid Species. and Their Association with Metabolic Phenotypes
Cell Systems, Volume 6 Supplemental Information Genetic Regulation of Plasma Lipid Species and Their Association with Metabolic Phenotypes Pooja Jha, Molly T. McDevitt, Emina Halilbasic, Evan G. Williams,
Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention
Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..
1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant
1 Classification. Digestion and absorption. Membrane structure and functions. Lecturer KOVAL Alexander N. PhD, assistant Lipid: Definition Biological molecules that are insoluble in aqueous solutions and
Mass-Spectrometric Analysis of Lipids (Lipidomics)
Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:
Phospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
Supplemental Material. Results
Supplemental Material Results Fractionation of mouse plasma by high-resolution SEC. APOA1 eluted as a single major peak in fractions 16 of plasma (the apparent size of mature, lipidated HDL) when it was
A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids
A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids Jeremy Netto, 1 Stephen Wong, 1 Federico Torta, 2 Pradeep Narayanaswamy, 2
Lipid Class Separation Using UPC 2 /MS
Michael D. Jones, 1,3 Giorgis Isaac, 1 Giuseppe Astarita, 1 Andrew Aubin, 1 John Shockcor, 1 Vladimir Shulaev, 2 Cristina Legido-Quigley, 3 and Norman Smith 3 1 Waters Corporation, Milford, MA, USA 2 Department
Suppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
Delacroix et al Renal effects of renal denervation Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate
Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate Supplementary Table 1: Ranking each patient based on the number of measurements showing a numerical improvement. Rank at each
Emerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids
Emerging science on omega-3: A lipidomic view of omega-3 in health and disease Peter Meikle 04 May 2017 Health benefits of omega 3 fatty acids Can lower plasma triacylglycerol can reduce the risk of metabolic
Perfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus)
Perfluoroalkyl Acids (PFAAs) in Plasma of the West Indian Manatee (Trichechus manatus) 6 th Florida Marine Mammal Conference March 29, 2018 Orlando, Fl John A. Bowden National Institute of Standards and
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids
What You Can t See Can Hurt You. How MS/MS Specificity Can Bite Your Backside
What You Can t See Can Hurt You How MS/MS Specificity Can Bite Your Backside Johan van den Heever, Tom Thompson, and Don Noot Agri-Food Laboratories Branch Advances in Trace rganic Residue Analysis early
Glycerolipid Analysis. LC/MS/MS Analytical Services
Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric
Supporting Information
Supporting Information Development of a High Coverage Pseudotargeted Lipidomics Method Based on Ultra-High Performance Liquid Chromatography-Mass Spectrometry Qiuhui Xuan 1,2#, Chunxiu Hu 1#, Di Yu 1,2,
LIPIDS Introduction - complex lipids. Marek Vecka
LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other
Annotation of potential isobaric and isomeric lipid species measured with the AbsoluteIDQ p180 Kit (and p150 Kit)
We provide the Phenotype to the Genotype! DocNr. 35017 V 2 2017-02 Annotation of potential isobaric and isomeric lipid species measured with the (and p150 Kit) Introduction Lipidomics, a branch of metabolomics
Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI
Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind
Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.
Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary
High density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
By: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
Defective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome
Defective functionality of HDL particles in familial apoa-i deficiency: relevance of alterations in HDL lipidome and proteome Fabiana Rached, *, Raul D. Santos, Laurent Camont, * Marcio H. Miname, Marie
Main Functions maintain homeostasis
The Cell Membrane Main Functions The main goal is to maintain homeostasis. Regulates materials moving in and out of the cell. Provides a large surface area on which specific chemical reactions can occur.
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
Phospholipid Analysis. P NMR Analytical Services
Phospholipid Analysis 31 P NMR Analytical Services Quantitative Phospholipid Analysis of Soy Lecithin and Krill Lecithin by 31 P NMR Katherine L Lanier; Jeff D Moore; Dale Smith; Shengrong Li; Ben Davis;
Supplementary Data for:
Supplementary Data for: Tumour sampling method can significantly influence gene expression profiles derived from neoadjuvant window studies Dominic A. Pearce 1, Laura M. Arthur 1, Arran K. Turnbull 1,
Quantification of labile and stable non-polar arsenolipids in commercial fish meals and edible seaweed samples
Electronic Supplementary Material (ESI) for Journal of Analytical Atomic Spectrometry. This journal is The Royal Society of Chemistry 7 Quantification of labile and stable non-polar arsenolipids in commercial
PPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents
Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823
SUPPORTING INFORMATION FOR:
SUPPORTING INFORMATION FOR: Metabolomics and lipidomics profiling of a combined mitochondrial plus endoplasmic reticulum fraction of human fibroblasts: a robust tool for clinical studies Charlotte Veyrat-Durebex
Metabolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients
Metaolism dysregulation induces a specific lipid signature of nonalcoholic steatohepatitis in patients Franck Chiappini, Audrey Coilly, Hanane Kadar, Philippe Gual, Alert Tran, Christophe Desterke, Didier
HDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation
HDL surface lipids mediate CETP binding as revealed by electron microscopy and molecular dynamics simulation Meng Zhang 1, River Charles 1, Huimin Tong 1, Lei Zhang 1, Mili Patel 2, Francis Wang 1, Matthew
Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site.
Supplementary Figure 1 Detergent solubilised 5 TMD binds pregnanolone at the Q245 neurosteroid potentiation site. (a) Gel filtration profiles of purified 5 TMD samples at 100 nm, heated beforehand for
MEMBRANE STRUCTURE. Lecture 8. Biology Department Concordia University. Dr. S. Azam BIOL 266/
1 MEMBRANE STRUCTURE Lecture 8 BIOL 266/4 2014-15 Dr. S. Azam Biology Department Concordia University Plasma Membrane 2 Plasma membrane: The outer boundary of the cell that separates it from the world
Supplementary Figures
Supplementary Figures Supplementary Fig. 1: Map of the ten countries included in the analysis. Showing the first sub-national administrative boundaries in light grey, and DHS survey locations representing
MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
ADVANCED CARDIOMETABOLIC SCREENING
ADVANCED CARDIOMETABOLIC SCREENING INTRODUCTION SignatureMD and its affiliated physicians continuously seek out technology to identify health risk factors before they become serious diseases. SignatureMD
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation
Transient β-hairpin Formation in α-synuclein Monomer Revealed by Coarse-grained Molecular Dynamics Simulation Hang Yu, 1, 2, a) Wei Han, 1, 3, b) Wen Ma, 1, 2 1, 2, 3, c) and Klaus Schulten 1) Beckman
Vitamin C modulates the metabolic and cytokine profiles, alleviates hepatic endoplasmic reticulum stress, and increases the life span of Gulo / mice
www.impactaging.com AGING, March 2016, Vol 8 No 3 Research Paper Vitamin C modulates the metabolic and cytokine profiles, alleviates hepatic endoplasmic reticulum stress, and increases the life span of
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
1. Methodology of lipidomics: Tandem mass spectrometry of ether phospholipids
Transworld Research Network 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Lipidomics: Sea Food, Marine Based Dietary Supplement, Fruit and Seed, 2012: 1-19 ISBN: 978-81-7895-573-5 Editor: 1. Methodology
Supplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
The main biological functions of the many varied types of lipids include: energy storage protection insulation regulation of physiological processes
Big Idea In the biological sciences, a dehydration synthesis (condensation reaction) is typically defined as a chemical reaction that involves the loss of water from the reacting molecules. This reaction
Agilent Solutions for Lipidomics. Greater Insight into
Agilent Solutions for Lipidomics Greater Insight into Lipid Metabolism Understanding Lipidomics What is Lipidomics? The term "lipidome" refers to all the lipids that exist in an organism and their effects
Supporting information
Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo
Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice
Zheng et al. BMC Plant Biology (2016) 16:70 DOI 10.1186/s12870-016-0758-8 RESEARCH ARTICLE Open Access Glycerolipidome responses to freezingand chilling-induced injuries: examples in Arabidopsis and rice
Biological relevance of fatty acyl heterogeneity to the neural membrane dynamics of Rhesus macaques during normative aging
/, Vol. 7, No. 35 Biological relevance of fatty acyl heterogeneity to the neural membrane dynamics of Rhesus macaques during normative aging Sin Man Lam 1, Gek Huey Chua 1, Xiao-Jiang Li 1, Bing Su 2 and
Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease
Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,
Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro
1 Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro Dalibor Breznan 1*, Dharani D. Das 1, Christine MacKinnon-Roy 1, Stéphane Bernatchez 2, Abdelhamid
Chapter 1 Membrane Structure and Function
Chapter 1 Membrane Structure and Function Architecture of Membranes Subcellular fractionation techniques can partially separate and purify several important biological membranes, including the plasma and
Lipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
PHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure
SUPPORTING INFORMATION. Lysine Carbonylation is a Previously Unrecognized Contributor. to Peroxidase Activation of Cytochrome c by Chloramine-T
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 SUPPORTING INFORMATION Lysine Carbonylation is a Previously Unrecognized Contributor to
9/11/18. Cell Function & Chemistry. Molecular and Cellular Biology. 2. Bio-Chemical Foundations & Key Molecules of a Cell
Molecular and Cellular Biology Cell Function & Chemistry 2. Bio-Chemical Foundations & Key Molecules of a Cell Prof. Dr. Klaus Heese Interaction Molecular Bonds Define Cellular Functions Water H 2 O Interactions
Principles of Shotgun Lipidomics
Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition
Selective phosphatidylcholine double bond. fragmentation and localization using. Paternó-Büchi reactions and ultraviolet.
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Selective phosphatidylcholine double bond fragmentation and localization using Paternó-Büchi reactions
Lipid Profiles in Obese Children
Ada Medica et Biologica Vol. 49, R elation of Apolipoprotein E Polymorphism Lipid Profiles in Obese Children T adashi ASAMI1, 'Division of Pediatrics and Dental Sciences, Tatiana CIOMARTEN1, Sueshi Department
COR 011 Lecture 9: ell membrane structure ept 19, 2005
COR 011 Lecture 9: ell membrane structure ept 19, 2005 Cell membranes 1. What are the functions of cell membranes? 2. What is the current model of membrane structure? 3. Evidence supporting the fluid mosaic
BIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 1: Membranes Lecturer: Christopher Larbie, PhD Introduction Introduction Cells and Organelles have membranes Membranes contain lipids, proteins and polysaccharides
Appendix F Simon Broome Diagnostic criteria for index individuals and relatives
Appendix F Simon Broome Diagnostic criteria for index individuals and relatives 1 SIMON BROOME DIAGNOSTIC CRITERIA FOR INDEX INDIVIDUALS (PROBANDS) 2 2 GENDER- AND AGE-SPECIFIC LDL-C CRITERIA FOR THE DIAGNOSIS
Effect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I
Effect of lecithin: cholesterol acyltransferase on the formation of cross-linked apolipoprotein A-I Yoshifumi Kurosaki 1), Hitoshi Ikeya 2), Hisao Haniu 3) and Zensuke Ogawa 1) It is reported that self-associated
ICAP 2017, 3rd - 6th July 2017, Caparica, Portugal Philip Morris International is the sole source of funding and sponsor of this project.
Thomas Schneider PMI R&D, Philip Morris Products S.A., Quai Jeanrenaud 5, CH-2000 Neuchâtel, Switzerland (Part of Philip Morris International group of companies) ICAP 2017, 3rd - 6th July 2017, Caparica,
1 + denotes a higher variable value for the deletion or depletion than the control scenario; - denotes a lower value.
Table S1. Significant changes in granuloma variables at 200 days post-infection for deletion and depletion of combinations of two individual TNF activities versus the baseline control scenario 1. Sample
Physical effects underlying the transition from primitive to modern cell membranes
Physical effects underlying the transition from primitive to modern cell membranes Itay Budin and Jack W. Szostak* *To whom correspondence should be addressed. Email: szostak@molbio.mgh.harvard.edu This
Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels. Supplementary Information
Arginine side chain interactions and the role of arginine as a mobile charge carrier in voltage sensitive ion channels Craig T. Armstrong, Philip E. Mason, J. L. Ross Anderson and Christopher E. Dempsey
USING NON -TRADITIONAL RISK MARKERS IN ASSESSING CV RISK
USING NON -TRADITIONAL RISK MARKERS IN ASSESSING CV RISK JAMES M FALKO MD PROFESSOR OF MEDICINE UNIVERSITY OF COLORADO Adapted from: Rader D. N Engl J Med. 2000 hs-crp (mg/l) 6 5 4 3 2 1 *p
ab Lipoprotein A (APOA) Human ELISA Kit
ab108878 Lipoprotein A (APOA) Human ELISA Kit Instructions for Use For the quantitative measurement of Human Lipoprotein A (APOA) in plasma, serum, urine, milk and cell culture supernatants. This product
METABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
Subj ect Index. For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes)
Subj ect Index For abbreviations see p.4 (lipids), p.5 (lipoproteins), p.202 (enzymes) A absorption, intestinal 48-63, 66,77,78 ACAT-enzyme 187,188,192,197, 198,203 acetate 66,67,152,158,160,173 acetone-butanol
Biochemistry. Chapter 6
Biochemistry Chapter 6 Game Plan for Today. - Collect your papers - Hand back quests - Go over Amoeba Sister Chart - Biochem Notes - Video Carbohydrate Lab Food Label Lab! Testing For Carbohydrates Benedict's
Central role of apociii
University of Copenhagen & Copenhagen University Hospital Central role of apociii Anne Tybjærg-Hansen MD DMSc Copenhagen University Hospital and Faculty of Health and Medical Sciences, University of Copenhagen,
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number