The Novel Compound NO-1886 Increases Lipoprotein Lipase Activity with Resulting Elevation of High Density Lipoprotein Cholesterol, and Long-term

Transcription

1 The Novel Compound NO-1886 Increses Lipoprotein Lipse Activity with Resulting Elevtion of High Density Lipoprotein Cholesterol, nd Long-term Administrtion Inhibits Atherogenesis in the Coronry Arteries of Rts with Experimentl Atherosclerosis Kzuhiko Tsutsumi,* Ysuhide Inoue,* Atsushi Shim,* Kentro Iwski,t Msko Kwmur, nd Toshio Murse *New Drug Reserch Lbortory, nd tdeprtment ofpthology, Nruto Reserch Institute, Otsuk Phrmceuticl Fctory, Incorported, Tokushim, Jpn; nd IDeprtment ofendocrinology nd Metbolism, Tornomon Hospitl, Tokyo, Jpn Abstrct We hve discovered novel compound, NO-1886, which possesses powerful lipoprotein lipse (LPL) ctivity-incresing ction. Administrtion of NO-1886 incresed LPL ctivity in the postheprin plsm, dipose tissue, nd myocrdium of rts, nd produced reduction in plsm triglyceride levels with concomitnt elevtion ofhdl cholesterol levels. Administrtion of NO-1886 incresed LPL enzyme mss in postheprin plsm nd mrna ctivity in epididyml dipose tissue, nd it ws concluded tht the mode of ction of this compound is stimultion of tissue LPL synthesis. We lso conducted longterm studies to ssess the impct of increses in LPL ctivity nd HDL levels on the development of therosclerotic lesions in rts. Administrtion of NO-1886 for s long s 90 d significntly decresed the degrere of therosclerotic chnges in the coronry rteries of vitmin D2-treted, cholesterol-fed rts. Sttisticl nlysis indicted tht incresed concentrtion of HDL is the fctor contributing mostly to the prevention of coronry rtery sclerosis. In summry, the results of our study indicte tht compound NO-1886 increses LPL ctivity, cusing n elevtion in HDL levels, nd tht long-term dministrtion of NO-1886 to rts with experimentl therosclerosis provides significnt protection ginst the development of coronry rtery lesions. (J. Clin. Invest : ) Key words: NO-1886 * lipoprotein lipse * hypertriglyceridemi * high density lipoprotein cholesterol * therosclerosis Introduction Recently there hs been incresing evidence of n ssocition between triglycerides nd incresed risk of coronry hert disese (1). Hypertriglyceridemi per se is n independent risk fctor, nd this is especilly true in certin specific groups of individuls, such s women, those with high plsm LDL (or totl) cholesterol levels (2, 3), those with low HDL cholesterol, nd dibetics (4, 5). Thus, mneuver which would lower plsm triglyceride levels should be ofgret vlue in protecting ginst therosclerosis. Over the pst severl yers, we hve been seeking out compounds tht reduce plsm triglyceride Address correspondence Kzuhiko Tsutsumi, New Drug Reserch Lbortory, Otsuk Phrmceuticl Fctory, Inc., Muy-cho, Nruto, Tokushim, 772 Jpn. Received for publiction 3 Februry 1992 nd in revised form 2 Februry J. Clin. Invest. The Americn Society for Clinicl Investigtion, Inc /93/07/41 1/07 $2.00 Volume 92, July 1993, levels nd hve screened compounds synthesized for this purpose Ḣypertriglyceridemi cn be cused by either incresed synthesis or indequte removl of triglycerides or both. We hoped to obtin compounds which would increse lipoprotein lipse (LPL)I ctivity, n enzyme plying crucil role for triglyceride removl, becuse such compounds should enhnce triglyceride ctbolism vi the enzyme's ctlytic ction nd lower the plsm triglyceride levels. In ddition, since precursorproduct reltionship ppers to exist between triglyceride-rich lipoproteins nd HDL levels (6), compounds tht increse LPL ctivity re expected to increse HDL levels. Among 100 compounds synthesized in our lbortory, we discovered the compound NO-1886 which hs potent LPL ctivity-incresing ction in rts. In this report, we describe the properties of NO-1886 nd its effects on plsm lipids. We were lso especilly interested in lerning whether induction of LPL ctivity would promote or suppress the development oftherosclerosis. To ddress this question directly, we dministered NO to rts with experimentl therosclerosis for 90 d nd exmined its effect on their coronry rteries histochemiclly. The experiments reveled tht NO-1886 prevents the development ofcoronry rtery sclerosis in nimls with experimentl model of the disese. Methods Mterils Agent NO-1886, 4-diethoxyphosphorylmethyl-N-(4-bromo-2-cynophenyl) benzmide ws synthesized in the New Drug Reserch Lbortory of Otsuk Phrmceuticl Fctory, Inc., Nruto, Tokushim, Jpn. Glycerol tri[l-'4ciolete (2.2 Gq/mmol) ws obtined from Amershm Interntionl, Amershm, United Kingdom, triolein, protmine sulfte, nd minerl oil from Sigm Chemicl Co., St. Louis, MO, nd heprin from Novo, jsveld, Denmrk. Tq DNA polymerse nd rndom primer were obtined from Tkr Shuzo Co., Ltd., Kyoto, Jpn, RNAse inhibitor from Phrmci LK iotechnology, Uppsl, Sweden, nd reverse trnscriptse from GICO RL, (Life Technologies, Inc.), Githersburg, MD. All other chemicls used were high grde commercilly vilble products. Animl experiments Mle Wistr rts weighing g were obtined from the Nissin Tokushim Institute for Animl Reproduction, Tokushim, Jpn. The nimls were mintined under 12-h light-drk cycle t constnt temperture of 23±20C nd cclimtized for t lest 2 wk before the strt ofthe experiment. NO-1886 ws suspended in 5% gum rbic nd dministered to rts vi gstric tube. Whenever blood smples were collected, the nimls were nesthetized with sodium pentobrbitl (50 mg/kg body weight [W]). 1. Abbrevitions used in this pper: W, body weight; HTGL, heptic triglyceride lipse; LPL, lipoprotein lipse. Atherosclerosis Prevention by Rising Lipoprotein Lipse Activity 411

2 Effects of single dose of NO-1886 in norml rts. Chnges in plsm lipid concentrtions nd LPL ctivity in postheprin plsm were determined fter single dministrtion ofno in doses of 3, 6, 12, nd 25 mg/kg W to norml rts. Control nimls received 5% gum rbic, diluent ofno sed on the results of time-course study, blood ws collected 4 h fter NO dministrtion. Without prior fsting, blood smples were drwn from the til vein into tubes contining 1 mg EDTA/ml, nd plsm isolted using refrigerted centrifuge ws used for lipid determintion. The nimls were then injected with heprin (100 U/kg W) vi the til vein, nd blood smples were collected 5 min lter. Plsm smples were used to determine LPL nd heptic triglyceride lipse (HTGL) ctivity. In some experiments, LPL enzyme mss in postheprin plsm ws lso mesured. Effects of repeted dministrtion of NO-1886 in norml rts. Three groups of norml rts received NO-1886 in dily doses of 25 mg/kg W for 2, 4, nd 8 d, respectively, nd control niml experiments were run prllel with the experimentl group. lood smples nd smples fter heprin injection were collected in the sme wy s described bove. In n ttempt to mesure LPL ctivity in both dipose tissue nd myocrdium, we performed nother set of experiments in which no heprin ws dministered. Long-term dministrtion of NO-1886 to rts with experimentl therosclerosis. Mle Wistr rts, ged 7 wk nd weighing g, were divided into four groups, norml control group nd three therogenic diet-fed groups. Norml control rts were fed stndrd lbortory chow. The therogenic diet-fed nimls were further divided into () controls nd rts treted with either (b) low dose (dily dose of 3 mg/kg W throughout the experimentl period) or (c) high dose (30 mg/kg W) NO These three groups of rts were given orl vitmin D2 in dily dose of 350,000 U/kg W for the initil 4 d nd subsequently fed stndrd lbortory chow supplemented with 2% cholesterol, 0.5% cholic cid sodium slt, nd 0.2% 6-methyl-2-thiourcil for up to 90 d (7, 8). The nimls were given free ccess to food nd tp wter. Food consumption ws mesured dily, nd body weight ws recorded weekly. At the end of the experimentl period, the nimls were killed by exsnguintion under sodium pentobrbitl nesthesi. lood smples were collected from the posterior ven cv for lipid mesurements. The herts were removed immeditely nd pssed in blind fshion to the pthologist for histologicl exmintion. The hert ws divided longitudinlly into two hlves from the scending ort to the pex. The scending ort, septum, nd right nd left ventricles were exposed on the cut surfces. The mterils were fixed in 10% neutrl buffered formlin, nd embedded in prffin. Thin sections (4,um) obtined were stined with hemtoxylin nd eosin, lcin blue for cid-mucopolyscchride determintion, nd by von Koss's method to determine clcium. Frozen sections were lso stined with oil red 0 for lipid determintion. More thn 10 coronry rteries, both right nd left coronry rteries nd their brnches, could be identified on the cut surfces of ech section. All of the coronry rteries on the sections were exmined histopthologiclly. Anlyticl methods Plsm lipids. Plsm totl cholesterol, HDL cholesterol, nd triglycerides were determined by conventionl enzymtic methods. The cholesterol C-test Wko (Wko Pure Chemicl Industries, Osk, Jpn) ws used in the cse of cholesterol, the Nescote HDL-C kitn (heprin clcium precipittion; Nippon Shoji, Osk, Jpn) for HDL cholesterol nd the triglyceride G-test Wko (Wko Pure Chemicl Industries) for triglycerides. Plsm lipoprotein nlysis. Ultrcentrifugtion of plsm lipoproteins ws crried out using rotor (L42T; Hitchi Koki Co., Ltd., Tokyo, Jpn). The density ofthe smples ws djusted with Kr nd Kr solutions of known density. Plsm smples ( 100 u I) were ultrcentrifuged t densities of 1.006, 1.019, 1.063, nd g/ml, respectively, nd the lipid concentrtion of ech frction ws mesured (9). The lipid levels of five lipoprotein frctions were clculted: VLDL, d < g/ml, intermedite density lipoprotein, d , LDL, d ), HDL2, d ), nd HDL3, d> Mesurement of LPL ctivity nd mss in postheprin plsm. LPL ctivity in postheprin plsm ws mesured by n immunochemicl method described previously ( 10) using glycerol tri[l- '4C]olete s substrte nd selective blocking of heptic lipse ctivity with ntiserum to rt heptic lipse. HTGL ctivity in postheprin plsm ws obtined by subtrcting LPL ctivity from totl plsm lipse ctivity. LPL enzyme mss ws mesured by sndwich ELISA using polyclonl ntibodies rised ginst humn LPL, s described previously ( 11). Tissue LPL ctivity. Myocrdil LPL ctivity ws mesured s reported previously ( 12). A specimen of myocrdium ws homogenized in 50 mm NH40H-NH4CI buffer (ph 8.5) contining heprin for 60 min t 0C. The suspension ws then centrifuged, nd the superntnt ws used to mesure LPL ctivity. Adipose tissue LPL ctivity ws mesured s described erlier ( 13). A specimen ofepididyml dipose tissue weighing 100 mg ws minced into smll pieces nd plced in Krebs-Ringer bicrbonte buffer (ph 7.4) in the presence of heprin for 60 min t 370C. The incubtion medium ws then ssyed for LPL ctivity (heprin-relesble LPL). In some experiments, the residul LPL ctivity in the dipose tissue ws lso mesured (tissue-bound, heprin-extrctble LPL)( 14) to determine totl LPL ctivity in the tissue. RNA preprtion nd Northern nlysis. Totl RNA smples were prepred from rt epididyml dipose tissue by n cid gunidium thiocynte-phenol chloroform extrction method (15). Agrose gel electrophoresis of RNA nd Northern blotting were crried out by the method described by Smbrook et l. ( 16). The two moleculr probes for the Northern blotting were prepred by reverse trnscription nd subsequent PCR s follows. First, the mixture of 5.0 Mg of totl RNA obtined from rt dipose tissue nd 200 pmol of rndom primer in finl vol of 5.0 Ml ws denturted t 70 C for 3 min nd cooled on ice. The synthesis of the first strnd ofcdna ws initited by the ddition of 5.0 Ml of premixture contining 100 mm Tris-HCI buffer, ph 8.3, 148 mm KCI, 6 mm MgC12, 2 mm dntp, 20 mm DTT, 16.5 U of RNse inhibitor, nd 100 U of reverse trnscriptse. This mixture ws incubted t 37 C for 1 h, nd the reverse trnscriptse ws denturted by heting t 98 C for 10 min. A 1.0-Ml liquot of this mixture ws used directly s the PCR templte. The PCR mixture (100 M1) contined 1.0 Ml of templte, 100 pmol of ech primer, 10 mm Tris -HCl buffer, ph 8.3, 50 mm KCI, 1.5 mm MgCl2, 1.6 mm dntp, nd 2.5 units of Tq DNA polymerse. After overlying the rection mixture with 50 Ml of minerl oil, mplifiction ws performed under the stndrd conditions for PCR ( 16). To obtin the puttive cdna frgment encoding rt LPL by PCR, two synthesized oligonucleotides, 5'- CGAAGTATTGGGATCCAGAAAC nd 5-CTTTCACTCGGATC- CTCTCGAT, were used s the downstrem nd upstrem primer, respectively. These primers correspond to position nd position on mouse LPL cdna (in this pper, the nucleotide sequences were numbered by defining the trnsltion initition site s + 1). The cdna frgment obtined (649 bp) ws subcloned into pluescript (Strtgene Inc., L Joll, CA), nd its nucleotide sequence ws determined by the chin-termintion method. We confirmed tht the nucleotide sequences of the cdna figment obtined (649 bp) nd the cdna encoding mouse LPL were highly homologous (93.7%). To obtin the puttive rt,-ctin cdna frgment, the downstrem primer (5'-ATGGATGACGATATCGCTGCG) nd the upstrem primer (5'-GTGCCTAGGGCGGCCCACGAT) were used for PCR. These primers correspond to position 1-22 nd position on rt fl-ctin cdna, respectively. The nucleotide sequence ofthe cdna frgment obtined ( 120 bp) ws identicl to the region on the cdna encoding rt #l-ctin where it hs low homology with -ctin. These cdna frgments were rdiolbeled by the multipriming method nd used for Northern blotting. Sttisticl nlysis The results re expressed s mens±sd. Comprisons between two groups were nlyzed for sttisticl significnce by Student's t test or 412 Tsutsumi, Inoue, Shim, Iwski, Kwmur, nd Murse

3 A ce 1. E 1 CO :y < 0 w x. o ;/C DOSE (mg/kg) 25 CL F0- =1 0 b c HOURS AFTER ADMINISTRATION Figure 1. Postheprin plsm LPL nd HTGL ctivity in NO treted norml rts. (A) Dose reltionship: NO-1886 ws dministered to rts, nd 4 h lter the rts were injected with heprin (100 U/kg body wt) vi the til vein. lood smples were collected 5 min lter, nd LPL nd HTGL ctivity in postheprin plsm were mesured, s described previously ( 10). () Time-course study: chnges of post-heprin plsm LPL (.) nd HTGL (A ) ctivity in reltion to elpsed time fter dministrtion of NO-1886, 25 mg/kg body wt. Dt re expressed s mens±sd (n = 6). Significntly different from the respective vlues in control rts: P < , bp < 0.01, cp < Aspin-Welch's t test. Comprisons mong more thn two groups were nlyzed using the one wy nlysis of vrince, followed by the Dnnett's test. Multiple regression nlysis ws used to evlute the reltionship between coronry rtery sclerosis nd protective fctors. Sttisticl clcultions were performed on FACOM M-760/40 computer (Fujitsu Ltd., Tokyo, Jpn) using the progrm ANALYST (Fujitsu Ltd.). Results Effects of single dose ofno-1886 in norml rts Postheprin plsm LPL ctivity nd mss. Single doses of NO-1886 cused significnt increse in postheprin plsm LPL ctivity in norml rts. The increses were dose dependent in the 0-25 mg/kg W rnge (Fig. 1 A). The increse peked 4 h fter NO-1886 dministrtion nd declined therefter returning to the bseline level fter 24 h (Fig. 1 ). Single dose of NO hd no effect on postheprin plsm HTGL ctivity (Fig. 1). The question rises s to whether NO itself enhnces LPL ctivity rther thn incresing tissue LPL. To resolve this mtter, we dded NO in concentrtions of 10-4 M-10-6 M to plsm smples collected fter heprin dministrtion nd mesured lipse ctivities. The in vitro ddition of NO filed to produce ny enhncement in LPL ctivity. Administrtion of NO-1886 in dose of 25 mg/kg W cused n increse of LPL mss in postheprin plsm, which Tble I. LPL Enzyme Mss in the Postheprin Plsm of NO-1886-treted Norml Rts LPL mss LPL ctivity n U/mi umol FFA/mlper min Control ± ±0.06 NO ±0.10* 1.93±0.09* NO ws dministered to norml rts in dose of 25 mg/kg W nd 4 h lter the rts were injected with heprin (100 U/kg W) vi the til vein. lood smples were collected 5 min lter. Plsm smples were used to mesure LPL enzyme mss, s well s LPL ctivity. 1 U corresponds to 100 ng of humn LPL. Dt re expressed s mens±sd. Significntly different from the vlue in the respective control rts: * P < s AI. w ( b co 90 co 12(!0 C b w w w 2 w 9o0 b ' 60 b EL 0o 6 b c < Q) DOSE (mg/kg) HOURS AFTER ADMINISTRATION Figure 2. Plsm lipid levels in NO-l 886-treted norml rts. (A) Dose reltionship: NO-1886 ws dministered to rts. lood smples were collected 4 h lter, nd plsm lipids were mesured. () Timecourse study: chnges of plsm cholesterol (e), HDL cholesterol (), nd triglycerides (-) in reltion to elpsed time fter dministrtion ofno-1 886, 25 mg/kg body wt. Significntly different from the respective vlues in the control rts: P < 0.001, bp < 0.01, CP < ws 17% higher thn control rts (P < 0.001). The degree of increse of LPL mss ws very similr to tht of enzyme ctivity (Tble I). Plsm lipids. Single doses ofno to norml rts were followed by significnt decreses in plsm triglyceride levels with concomitnt increses in HDL cholesterol. Plsm triglycerides fell to their lowest levels in response to 6 mg/kg W of NO- 1886, while HDL cholesterol levels rose s the dose ofno ws incresed to 25 mg/kg W (Fig. 2). The chnges in both triglyceride nd HDL cholesterol levels were ssocited with chnges in postheprin plsm LPL ctivity. This experiment reveled significnt increse in totl cholesterol concentrtions in the experimentl nimls (Fig. 2). Further nlysis by ultrcentrifugtion showed tht the cholesterol in the LDL frction did not chnge nd tht the in- Tble II. Lipid Levels in the Plsm Lipoprotein Frctions of NO-1886-treted Norml Rts Composition Control NO treted Cholesterol (mg/dl) Totl 52.1± ±5.4* VLDL 5.6± ±2.2 IDL ND ND LDL 7.4± ±3.0 HDL2 35.4± ±5.0* HDL3 1.6± ±0.1 Triglyercides (mg/db Totl 121.2± ±6.2* VLDL 102.8± ±5.7* IDL 4.7± ±1.4* LDL 11.0± ±1.8 HDL2 ND ND HDL3 ND ND NO- 1886, 25 mg/kg W, ws dministered to norml rts. lood smples were collected 4 h fter NO dministrtion, nd plsm lipoproteins were nlyzed by ultrcentrifugtion. Recovery rtes of cholesterol nd triglycerides were 96 nd 97%, respectively. Dt re expressed s mens±sd (n = 7); ND, not detectble. Significntly different from the vlue in the respective control rts: * P < ~~~~~~~c Atherosclerosis Prevention by Rising Lipoprotein Lipse Activity 413

4 w 120 A 100 ; 80. <r 20~~~~~~ < C POST-HEPARIN PLASMA LPL ACTIVITY (pmoles FFA / ml /min) -X w;- 80 H 60 A , CO) POST-HEPARIN PLASMA LPL ACTVITY (umos FFA/rNr/min) Figure 3. Reltionship between postheprin plsm LPL ctivity nd (A) triglycerides nd () HDL cholesterol levels. crese in plsm totl cholesterol ws primrily reflection of n increse in the HDL cholesterol frction (Tble II). Plsm lipids in reltion to postheprin plsm LPL ctivity. The reltionship between preheprin triglyceride nd HDL cholesterol levels in plsm nd LPL ctivity in postheprin plsm ws ssessed in experimentl nimls given different doses of NO As shown in Fig. 3, plsm triglyceride levels were inversely correlted with LPL ctivity (r = , P < 0.01, n = 30), while HDL cholesterol levels were positively correlted with the ctivity of the enzyme (r = 0.678, P < 0.01 ). To further demonstrte tht the increse in LPL ctivity elevted HDL cholesterol levels directly, n experiment ws performed in which protmine sulfte ws used to block the rise in LPL ctivity ( 17) in response to dministrtion of NO Prior intrvenous protmine sulfte, 25 mg dissolved in sline/kg W, inhibited both the rise in HDL cholesterol nd the fll in plsm triglyceride levels, both of which were lwys induced by the compound (Tble III). Effects ofrepeted dministrtion ofno-1886 in norml rts Plsm nd tissue lipse ctivities. Dily dministrtion of NO to norml rts cused significnt increse in postheprin plsm LPL ctivity, while HTGL ctivity in postheprin plsm remined unchnged (Fig. 4). The LPL ctivity of epididyml dipose tissue rose grdully nd 8 d lter the ctivity of the NO-l 886-treted rts ws 2.7 times higher thn tht of controls (Fig. 5 A). Myocrdil LPL ctivity ws 1.4 times Tble III. Effects ofprior Administrtion ofprotmine Sulfte on Plsm Lipids in NO-1886-treted Rts Plsm lipids Groups Cholesterol HDL-C Triglycerides mg/dl Norml rts control 54±2]* 49±4]* 119±17]* NO ±3-60±4-77±12- Protmine sulftetreted rts control 54±3 38±4 187±42 NO ±5 * 39±3 * 176±23 Protmine sulfte, 25 mg/kg W, ws dministered to rts vi the til vein. 5 min lter, NO ws dministered in dose of 25 mg/kg W nd 2 h lter blood ws drwn to mesure plsm lipids. Dt re expressed s mens±sd (n = 7). Significntly different from the vlue in the respective norml rts treted with NO- 1886: * P < , *g@ ~0 A < 3 zn FE ELe :1- Z~ 2 j tro, << U co 0 El Control rts C NO-1886-treted rts -r DAYS AFTER ADMINISTRATION CL E 2 z c=-)a 3 i: E-:3 Contro rts NO-1886 treted 2 t Am #g2 rts 4 8 DAYS AFTER ADMINISTRATION Figure 4. Postheprin plsm lipses of norml rts fter repeted dministrtion of NO (A) LPL. () HTGL. NO-1886 ws dministered to norml rts in dily dose of 25 mg/kg W for 2, 4, nd 8 d. Postheprin plsm ws collected 4 h fter the finl dose. Dt re expressed s mens±sd (n = 6). Significntly different from the respective vlues in the control rts: P < higher in the NO treted rts thn controls (Fig. 5 ). In nother set of experiments, we mesured both heprin-relesble nd tissue-bound heprin-extrctble LPL in dipose tissue. The ctivities of both frctions of LPL were higher in the NO treted rts thn in the controls (Tble IV). Plsm lipids. Chnges in plsm triglyceride nd HDL cholesterol levels fter repeted dministrtion ofno re shown in Fig. 6. Plsm triglyceride levels hd fllen by 52% nd plsm HDL cholesterol levels risen by 37% 8 d lter. Effect ofno-1886 on the expression oflpl in epididyml dipose tissue LPL expression ws enhnced 4 h fter dministrtion of NO As shown in Fig. 7, the mount ofmrna encoding LPL ws incresed by NO in dose-dependent mnner. Imge nlysis of the utordiogrph by prticle nlysis indicted thht NO-1886 in doses of 25 nd 100 mg/kg W incresed the mount of mrna 3.2- nd 5.1-fold, respectively, compred with the controls. On the other hnd, the verge mount of A: c E (n ( < 0.8 0wes A E Control rts * NO-1886-Ireted rts 04 T DAYS AFTER ADMINISTRATION )2.0 > nll 5 _. CD 0.0 D M Controi rts NO-1886-treted rts )AYS AFTER ADMINISTRATION Figure 5. Tissue LPL ctivity of norml rts fter repeted dministrtion of NO (A) Adipose tissue LPL ctivity. () Myocrdil LPL ctivity. NO ws dministered to norml rts in dily dose of 25 mg/kg W for 2, 4, nd 8 d. Epididyml dipose tissue nd myocrdium were removed 4 h fter the finl dose. Adipose tissue LPL ctivity ws mesured s described previously (13). A specimen of dipose tissue weighing 100 mg ws minced into smll pieces, plced in 1 ml of Krebs-Ringer bicrbonte buffer, ph 7.4, contining 40 mg of SA nd 1.8 mg ofglucose, nd incubted in the presence of heprin (2 U/ml) for 60 min t 370C. The incubtion medium ws then ssyed for LPL ctivity. Myocrdil LPL ctivity ws mesured s reported previously (12). A specimen of myocrdium weighing 200 mg ws homogenized in 1 ml of 50 mm NH40H- NH4CI buffer (ph 8.5) contining 0.5 U/ml heprin on ice for 60 min. The suspension ws then centrifuged, nd the superntnt ws ssyed for LPL ctivity. Dt re expressed s mens±sd (n = 6). Significntly different from the respective vlues in the control rts: P < 0.00 l, bp < 0.0 1, 'P < Tsutsumi, Inoue, Shim, Iwski, Kwmur, nd Murse

5 Tble IV. Effect ofno-1886 on Heprin-relesble nd Tissuebound Heprin-extrctble LPL in the Adipose Tissue ofrts Heprin-relesble Tissue-bound heprin- Totl LPL LPL extrctble LPL ctivity Amol FFA/min per wet g tissue Control 0.205± ± ±0.082 NO- i ±0.121 * 0.339±0.093* 0.800± LPL NO Control 25mg/kg 1OOg/kg 1 I1I ,W W 28S NO ws dministered to norml rts in dily dose of 25 mg/kg W for 4 d. Epididyml dipose tissue ws removed 4 h fter the finl dose, nd two distinct frctions of LPL, i.e., heprin-relesble nd tissue-bound heprin-extrctble frctions, were mesured. Heprin-relesble LPL ws mesured s described in the legend of Fig. 5. After collection of heprin-relesble LPL, cetone/ether-dried powder of dipose tissue ws prepred. The residul LPL in the tissue ws extrcted nd mesured ccording to modifiction of the method of Slmn nd Robinson (16). Dt re expressed s mens±sd (n = 6). Significntly different from the vlue in the respective control rts: * P < , * P < 0.05, I P < mrna encoding f3-ctin ws very similr in ll three groups. These findings suggest tht NO increses the mount of LPL protein by enhncing trnscription nd/or stbiliztion of the mrna encoding LPL. Effects of long-term dministrtion ofno-1886 on experimentl therosclerosis in the rt The experiment ws performed twice, nd ech result ws combined. There were no differences in body weight gin (Tble V) nd food consumption between NO-1886 treted rts nd controls. Plsm lipids. Rts with experimentl therosclerosis exhibited mrked increse in plsm cholesterol. Administrtion of NO to rts fed n therogenic diet incresed HDL cholesterol nd decresed triglyceride levels (Tble V). Histopthologiclfindings. 10 of the 11 rts fed specil therogenic diet were found to hve moderte to severe therosclerotic lesions of their coronry rteries chrcterized by thickening of the tunic intim with fom cell ccumultion nd fibrous prolifertion (Fig. 8 A). The tunic intim of the ffected coronry rteries contined mny oil red 0-stinble lipid droplets nd exhibited incresed deposition ofcid-mucopolyscchride when stined with lcin blue, nd von Koss's method reveled clcifiction nd prtil rupture of the internl elstic lmin. On the other hnd, therogenic diet-fed 120, Figure 6. Plsm lipid 0) ED 100 b X b levels fter repeted d ministrtion of NO- 0* 2 r < NO-1886 ws dminis- D60- r T V _ tered to norml rts in X dily dose of 25 mg/ 40' kg W for 2, 4, nd 8 e20- d. lood smples were co collected 4 h fter NO 0o dministrtion Dt re expressed s DAYS AFTER ADMINISTRATION mens±sd (n = 6): cholesterol (X), HDL cholesterol (-), triglycerides (A). Significntly different from the respect -e vlues in control rts: P < 0.01, bp < Figure 7. Northern blot nlysis of dipose tissue totl RNA extrct using cdna for rt LPL. Rts were divided into three groups nd ech group included three nimls. Rts fsted overnight were dministered NO-1886 in doses of either 25 or 100 mg/kg W. Rts of control group received 5% gum rbic diluent of the compound. 4 h lter, the nimls were killed by exsnguintion under sodium pentobrbitl nesthesi. Totl RNA ws prepred from the epididyml dipose tissue ofthe individul rts using the method described in Methods, nd 4,g of totl RNA ws electrophoresed in ech single lne. The positions of ribosoml RNA re indicted by rrows. NO treted rts hd only very mild to moderte lesions (Fig. 8 ). - To represent the dt sttisticlly, we exmined 10 coronry rteries t rndom nd clssified the severity of coronry rtery sclerosis into five grdes on the bsis of the extent of the therosclerotic lesions. The results re summrized in Tble VI. Higher doses of NO produced greter suppression of the development oftherosclerotic lesions ofthe coronry rteries (P < 0.01, by two-wy cumultive chi-squre test). To further define the reltive contribution of HDL cholesterol, non- HDL cholesterol (totl cholesterol - HDL-C), nd triglycerides to protection from coronry rtery sclerosis, multiple regression nlysis ws performed. The severity of coronry rtery sclerosis ws ssessed on the bsis of fom cell ccumultion nd grded s follows: " " for grde 1, "2" for grde 2, "3" for grde 3, "4" for grde 4, nd "5" for grde 5. The results showed tht plsm HDL cholesterol ws the most powerful protector (stndrd regression coefficient [p3] = , P = 0.003, multiple correltion coefficient [R] = 0.599). Nor ml control rts hd no therosclerotic lesions of the coronry rteries. Discussion In this pper, we hve described new compound tht increses tissue LPL ctivity in rts, resulting in significnt reduction in plsm triglyceride levels ccompnied by concomitnt rise in HDL cholesterol. NO-1886 ws shown to increse LPL enzyme mss in postheprin plsm nd LPL mrna ctivity in dipose tissue. Long-term dministrtion of NO-1886 significntly suppressed the development of coronry rtery sclerosis in vitmin D2-treted, cholesterol-fed rts. LPL plys centrl role in the ctbolism of triglyceriderich lipoproteins. Single doses of NO-1886 cused mrked increse of postheprin plsm LPL ctivity in norml rts, nd the increse ws dose dependent. This increse ws confirmed when repeted doses of NO-1886 were dministered. The increse in postheprin plsm LPL is thought to be reflection of the increses in LPL ctivity in dipose tissue, the Atherosclerosis Prevention by Rising Lipoprotein Lipse Activity 415

6 Tble V. Effects oflong-term Administrtion ofno-1886 on Plsm Lipid Levels in Rts with Experimentl Atherosclerosis Plsm lipids No. of Groups nimls W Cholesterol HDL-C Triglycerides g Atherosclerotic rts Control (10) 237±11 809± ±26 72±17 N mg/kg (5) 239±9 724± ±251* 54±9 N mg/kg (10) 240±19 977±103 * 360±31 52±12 * Dt re expressed s mens±sd. Significntly different from the vlue in the respective control rts: * P < 0.01, P < 0.05, P < mg/dl myocrdium, nd skeletl muscle. In dipose tissue, both heprin-relesble LPL nd residul LPL were higher in NO treted rts thn in controls, nd thus totl LPL ctivity in the tissue ws certinly incresed by the compound. In the LPL expression studies, NO ws demonstrted to increse mrna ctivity in dipose tissue, one of the mjor LPL producing tissues, indicting tht the compound increses tissue LPL synthesis. The compound hd no effect on the ctivity of HTGL, the enzyme mediting the ctbolism of remnnt lipoproteins by the liver ( 18). The reduction in plsm triglyceride levels fter single nd repeted doses of NO is consequence of elevted LPL ctivity. In seprte series of experiments, we found tht the triglyceride synthesis rte ws not diminished in rts treted with NO-1886 (dt not shown). Another remrkble chnge occurring fter NO dministrtion ws mrked elevtion of plsm HDL cholesterol, especilly HDL2 cholesterol. Previous reports hve clerly demonstrted tht enhnced lipolysis of triglyceride-rich lipoproteins results in n increse in HDL2 prticles, thus precursor-product reltionship exists between the two (6, 19). Our protmine sulfte study provided direct evidence tht the increse in LPL ctivity elevtes HDL cholesterol level. The finding tht the NO-1886-treted rts exhibited mrked elevtion of HDL cholesterol levels is of gret interest. In humns, the trnsfer of cholesterol from newly formed HDL2 prticles to VLDL is medited by cholesterol ester trnsfer protein (20). Rts, however, lck cholesterol ester trnsfer protein (21 ), nd becuse ofthis number of HDL prticles following enhnced VLDL degrdtion by LPL ws incresed nd ccumulted in the circultion, resulting in mrked elevtion of HDL cholesterol. The increses in plsm totl cholesterol re obviously result of the increses in HDL2, nd there ws no chnge in cholesterol in the LDL frction fter NO dministrtion. Of prticulr importnce is tht long-term dministrtion of NO-1886 to rts with experimentl therosclerosis significntly inhibited the development of therosclerotic lesions in the coronry rteries. This effect ws probbly not due to LPL per se but the consequence of high concentrtion of HDL induced by LPL. A number of epidemiologicl studies hve demonstrted n inverse ssocition between plsm HDL levels nd the development of coronry rtery disese (22, 23). V ;, 1. A~~~~ Ẉ s. 4*, n # *.* 9 t..# vi s% i ~4~1 F~~~~ *** ')}v/, r/ ii + /*\ I' \*s,i' 4ti' %ds i% 44'4 >'^ *~ %' * *. * I...,...*. ADS-* S44 *4 ~~~~~~~~~~~~~~~~~~~4 4 si S 9 io * 4 4,- *; N 4)944 * * 14 4N.4~~~~~~~~~~~~~~~~~~4.0~~~~~~4 *4ls -N8i< 14~~~~~~~~~~~~~~~~~~~I4 ujf F mp 0 X{ I_ At fi t4' V.11 *~ ~ Y. d~ ~ ',,+)\:,,,i. 4*, n 7.s f.~~- ~~~ $h?. -*,b*^,~ t I i. _-..*t.r.* W~~ ~~~~- +.W *,...'. ::.. v1 e.. 0 r..', ;, s.. o I.. ~ N..f' Figure 8. (A) Coronry rtery section stined with hemtoxylin nd eosin, showing mrked thickening of tunic intim with fom cell ccumultion nd fibrous prolifertion from n therogenic diet-fed rt. Mgnifiction, 175. () Section of corresponding portion of coronry rtery from n therogenic diet-fed, NO-1886 (30 mg/kg)-treted rt showing no therosclerotic lesions. Mgnifiction, Tsutsumi, Inoue, Shim, Iwski, Kwmur, nd Murse 4.14

7 Tble VI. Effect oflong-term Administrtion ofno-1886 on the Coronry Arteries ofrts with Experimentl Atherosclerosis Atherogenic diet-fed, NO-1886-treted rts Atherogenic diet- Histopthologicl Findings Grde of therosclerotic fed controls lesions (n = 11) 3 mg/kg (n = 5) 30 mg/kg (n = 11) Thickening of the tunic intim 1 1/1 1* 1/5 5/11 chrcterized by fom cell 2 1/11 2/5 3/11 ccumultion nd fibrous 3 2/11 0/5 3/11 prolifertion 4 6/11 2/5 0/11 5 1/11 0/5 0/11 * The number of rts with lesions/the number of rts exmined. The severity of the therosclerotic lesions ws evluted by exmining 10 coronry - rteries nd clssifying them into five grdes on the bsis of the extent of the therosclerotic lesions: grde 1: no therosclerotic lesions in ny of the coronry rteries exmined; grde 2: very mild (<25% of the re ffected) therosclerotic chnges in few coronry rteries; grde 3: mild (25-49%) therosclerotic chnges in severl coronry rteries; grde 4: moderte (50-74%) chnges in lmost ll coronry rteries, nd grde 5: severe ('75%) therosclerotic chnges in ll coronry rteries exmined. Very recently, two different groups of investigtors hve demonstrted n inhibitory effect of high HDL on the development of therosclerotic lesions, i.e., dimon et l. (24), who repetedly dministered HDL to cholesterol-fed rbbits, nd Rubin et l. (25), who used trnsgenic mice with high polipoprotein A I nd HDL levels. The results of multiple regression nlysis in our study lso suggest tht HDL cholesterol is strong protector ginst coronry rtery sclerosis. Thus, mneuvers tht increse HDL cholesterol levels might be expected to prevent the development of therosclerotic lesions, nd NO is compound with just such n ction. In summry, we hve described compound with n ction which potently increses LPL ctivity with resulting elevtion in HDL cholesterol levels. Long-term dministrtion of this compound significntly protected ginst the development of therosclerotic lesions in the coronry rteries of rts fed n therogenic diet. Acknowledgments We thnk Drs. Kzuyoshi Miyt, Ysuo Shoji, Yoshihiko Tsud (Deprtment of Orgnic Chemistry), Eiji Uesk, nd Chieko Nb (Deprtment of Phrmcology), New Drug Reserch Lbortory, Otsuk Phrmceuticl Fctory, Inc., for their coopertion. We lso thnk Drs. Nobuhiro Ymd nd Tknori Gotod, Third Deprtment of Internl Medicine, University of Tokyo, for their vluble comments. References 1. Austin, M. A Plsm triglyceride nd coronry hert disese. Arterioscler. Thromb. 1 1: Lpidus, L., C. engtsson, 0. Lindquist, J. A. Sigurdsson, nd E. Rybo Triglyceride: min lipid risk fctor for crdiovsculr disese in womn? Act Med. Scnd. 217: Cstelli, W. P The triglyceride issue: view from Frminghm. Am. Hert J. 112: Fontbone, A., E. Eschwege, F. Cmbien, J. L. Richrd, P. Ducimetiere, N. Thibult, J. M. Wrnet, J. R. Clude, nd G. E. Rosselin Hypertriglyceridemi s risk fctor of coronry hert disese mortlity in subjects with impired glucose tolernce or dibetes. Results from the 11-yer follow-up of the Pris Prospective Study. Dibetologi. 32: West, K. M., M. M. S. Ahuj, P. H. ennett, A. Czyzyk, 0. M. De Acost, J. H. Fuller,. Grb, V. Grbusks, R. J. Jrrett, K. Kosk, et l The role of circulting glucose nd triglyceride concentrtions nd their interctions with other risk fctors s determinnts of rteril disese in nine dibetic popultion smples from the WHO multintionl study. Dibetes Cre. 6: Ptsch, J. R., A. M. Gotto, Jr., T. Olivecron, nd S. Eisenberg Formtion of high density lipoprotein2-like prticles during lipolysis of very low density lipoproteins in vitro. Proc. Ntl. Acd. Sci. USA. 75: jw, G. S., L. M. Morrison, nd. H. Ershoff Induction ofortic nd coronry thero-rteriosclerosis in rts fed hypervitminosis D, cholesterolcontining diet. Proc. Soc. Exp. iol. Med. 138: Pge, I. H., nd H.. rown Induced hypercholesterolemi nd therogenesis. Circultion. 6: Hvel, R. J., H. A. Eder, nd J. H. rgdon The distribution nd chemicl composition of ultrcentrifuglly seprted lipoproteins in humn serum. J. Clin. Invest. 34: Murse, T., nd H. Uchimur A selective decline of post-heprin plsm heptic triglyceride lipse in hypothyroid rts. Metb. Clin. Exp. 29: Gotod, T., N. Ymd, M. Kwmur, K. Kozki, N. Mori, S. Ishibshi, H. Shimno, F. Tkku, Y. Yzki, Y. Furuichi, nd T. Murse Heterogeneous muttions in the humn lipoprotein lipse gene in ptients with fmilil lipoprotein lipse deficiency. J. Clin. Invest. 88: Mori, N., T. Murse, N. Ymd, N. Arkw, nd F. Tkku Wide vritions of plsm triglyceride concentrtions in guine pig. Lipids. 19: Murse, T., N. Ymd, nd F. Mtsuzki The in vitro effect of growth hormone on dipose tissue lipoprotein lipse in rts. LifeSci. 28: Slmn, M. R., nd D. S. Robinson Clering fctor lipse in dipose tissue. iochem. J. 99: Chomczynski, P., nd N. Scchi Single-step method ofrna isoltion by cid gunidium thiocynte-phenol-chloroform extrction. Anl. iochem. 162: Smbrook, J., E. F. Fritsch, nd T. Mnitis Moleculr Cloning. Second edition. Extrction, purifiction nd nlysis of messenger RNA from eukryotic cells. Cold Spring Hrbor Lbortory, Cold Spring Hrbor, NY Kye, J. P., nd D. J. Glton Triglyceride-production rtes in ptients with type-iv hypertriglyceridemi. Lncet. i: Murse, T., nd H. Itkur Accumultion of intermedite density lipoprotein in plsm fter intrvenous dministrtion of heptic triglyceride lipse ntibody in rts. Atherosclerosis. 39: Tskinen, M., nd E. A. Nikkil High density lipoprotein subfrctions in reltion to lipoprotein lipse ctivity oftissues in mn-evidence for reciprocl regultion ofhdl2 nd HDL3 levels by lipoprotein lipse. Clin. Chim. Act. 112: Tll, A., T. Swenson, C. Hesher, nd E. Grnet Mechnism of fscilitted lipid trnsfer medited by plsm lipid trnsfer proteins in plsm lipoproteins. New Compr. iochem. 14: Tll, A. R Plsm lipid trnsfer proteins. J. Lipid Res. 27: Gorden, D. J., nd. M. Rifkind High-density lipoprotein: the clinicl implictions of recent studies. N. Engl. J. Med. 321: Frick, M. H., 0. Elo, K. Hp, 0. P. Heinonen, P. Heinslmi, P. Helo, J. K. Huttunen, P. Kitniemi, P. Koskinen, V. Mnninen, et l Helsinki hert study: primry-prevention tril with gemfibrozil in middle-ged men with dyslipidemi. N. Engl. J. Med. 317: dimon, J. J., L. dimon, nd V. Fuster Regression oftherosclerotic lesions by high density lipoprotein plsm frction in the cholesterol-fed rbbit. J. Clin. Invest. 85: Rubin, E. M., R. M. Krss, E. A. Spngler, J. G. Verstuyft, nd S. M. Cliff Inhibition of erly therogenesis in trnsgenic mice by humn polipoprotein Al. Nture (Lond.). 353: Atherosclerosis Prevention by Rising Lipoprotein Lipse Activity 417