Emerging science on omega-3: A lipidomic view of omega-3 in health and disease. Health benefits of omega 3 fatty acids
|
|
- Lisa Warner
- 5 years ago
- Views:
Transcription
1 Emerging science on omega-3: A lipidomic view of omega-3 in health and disease Peter Meikle 04 May 2017 Health benefits of omega 3 fatty acids Can lower plasma triacylglycerol can reduce the risk of metabolic syndrome and type 2 diabetes? Have anti-inflammatory properties Can lower systemic inflammation Can reduce the risk of heart disease AHA Science Advisory Can reduce the risk of age related cognitive decline? Preclinical vs clinical trials Omega-3 fatty acids and incident type 2 diabetes Br J Nutr Jun;107 Suppl 2:S Omega-3 fatty acids and incident type 2 diabetes: a systematic review and meta-analysis. Wu JH 1, Micha R, Imamura F, Pan A, Biggs ML, Ajaz O, Djousse L, Hu FB, Mozaffarian D. The overall pooled findings do not support either major harms or benefits of fish/seafood or EPA + DHA on development of DM, and suggest that ALA may be associated with modestly lower risk. Reasons for potential heterogeneity of effects, which could include true biologic heterogeneity, publication bias, or chance, deserve further investigation. Omega-3 Polyunsaturated Fatty Acid (Fish Oil) Supplementation and the Prevention of Clinical Cardiovascular Disease Randomised control trials show evidence for omega-3 in cardiovascular disease May reduce CHD death in patients with a prior history of CHD May reduce CHD death in patients with a history of heart failure Evidence supports the reduction of recurrent atrial fibrillation No effect on recurrent non-fatal MI No benefit in CVD outcomes in patients with or at risk of diabetes mellitus No benefit in recurrent stoke in patients with prior stoke Effects thought to be through a reduction of ischemia induced sudden cardiac death Circulation Apr 11;135(15):e867-e884 Omega-3 Polyunsaturated Fatty Acid (Fish Oil) Supplementation and the Prevention of Clinical Cardiovascular Disease: A Science Advisory From the American Heart Association. Siscovick et al. American Heart Association Nutrition Committee of the Council on Lifestyle and Cardiometabolic Health; Council on Epidemiology and Prevention; Council on Cardiovascular Disease in the Young; Council on Cardiovascular and Stroke Nursing; and Council on Clinical Cardiology.
2 How do Omega-3 fatty acids exert health benefits Omega-3 fatty acid metabolites Protectins, resolvins and maresins have demonstrated anti-inflammatory effects o Can modulate the immune response and lower systemic inflammation Can influence other factors such as oxidation Can be oxidised and so protect other lipids/proteins (oxidative stress) Direct effect on cell receptors PPAR and other transcription factors Effects on cell behaviour mediated by composition of cell membranes Influence cell membrane fluidity (lipid rafts) o Via incorporation into phospholipid pools Plasma lipidomics at Baker Institute Clinical lipid measures Cholesterol, HDL-C, triglycerides, LDL-C Lipid composition of plasma Cholesteryl esters Di- and Triacylglycerols Phospholipids Ceramides Glycosphingolipids Sphingomyelin LCAT ApoA-I cholesterol cholesterol ester phospholipid triglyceride Modified lipids (oxidized, glycated) 1-palmitoyl-2-(5'-oxo-valeroyl)-sn-glycero- Phosphatidylcholine 3-phosphocholine Ceramide (POVPC) (d18:1/16:0) 16:0/18:0 Lysolipids Triacylglycerol 16:0/16:0/16:0 Free fatty acids 10,000 different lipids in humans (most will be in plasma at some level (>1000 abundant species) Metabolomics Laboratory (Analytical platforms) Metabolomics Laboratory (High throughput lipidomics) Lipid extraction (10µL plasma) 1 Addition of stable isotope/non-physiological standards Single phase BuOH/MeOH Centrifuge (supernatant) LC-MS/MS Sciex API 4000 Q/TRAP triple quadrupole mass spectrometer Agilent 1200 HPLC system Column = Agilent Zobax C-18 eclipse (1.8 um x 50 mm) Agilent 6490 triple quadrupole mass spectrometer Agilent 1290 HPLC system Column = Agilent Zobax C-18 eclipse plus (1.8 um x 50 mm) Lipid quantification (relative) 2 LC ESI-MS/MS Stable isotope dilution (non-physiological) Multiple reaction monitoring (scheduled) 350 lipid species (10 min) 1 Alshehry et al. An efficient single phase method for the extraction of plasma lipids. Metabolites. 2015;5:(2) Weir et al. Plasma lipid profiling in a large population-based cohort. Journal of lipid research. 2013;54:(10)
3 Plasma lipid MRM experiment (20min LC gradient) %B Separation of isobaric and isomeric species XIC of +MRM (159 pairs): / amu Expected RT: 0.0 I e6 1.00e6 9.00e5 8.00e5 7.00e5 6.00e5 5.00e5 4.00e5 Phospholipids Separation of acyl / alkyl / alkenyl species of the same nominal mass PC(P-36:4) Max. 1.1e6 cps. Current capabilities >600 lipid species in 15 min e5 2.00e5 1.00e PC(35:5) PC(O-36:5) Time, min Separation of isobaric and isomeric species (phosphatidylcholine species) x10 6 +ESI x10 5 MRM Frag=380.0V CF=0.000 DF=0.000 CID@21.0 ( > ) 2016_02_13-TQC.d Smooth Cpd 146: PC 36:3: +ESI MRM Frag=380.0V CF=0.000 DF=0.000 CID@21.0 ( > ) FT03_0007 TQC 0745.d * * PC 36: PC 18:1/18:2 PC 16:0/20: Counts 6.78 vs. Acquisition 6.8 Time 6.82 (min) Counts vs. Acquisition Time (min) High throughput lipidomic profile Lipid class/subclass No. of species Parent ion Daughter ion dihydroceramide (dhcer) 6 [M+H] m/z ceramide (Cer) 41 [M+H] + Sphingoid specific m/z monohexosylceramide (MHC) 6 [M+H] m/z dihexosylceramide (DHC) 6 [M+H] /z trihexosylcermide phosphatidylcholine (THC) (PC) 686 [M+H] m/z sulphatide alkylphosphatidylcholine (Sul) (PC(O)) 22 6 [M+H] [M+H] m/z m/z G M1 ganglioside (GM1) 1 [M+2H] m/z alkenylphosphatidylcholine (PC(P)) 24 [M+H] G M3 ganglioside (GM3) 6 [M+H] m/z m/z sphingomyelin lysophosphatidylcholine (SM) (LPC) [M+H] m/z lysoalkylphosphatidylcholine (PC) (LPC(O)) [M+H] m/z phosphatidylethanolamine (PE) lysoalkenylphosphatidylcholine (LPC(P)) [M+H] [M+H] + NL, Da m/z phosphatidylinositol (PI) 32 [M+NH 4 ] + NL, Da lysophosphatidylinositol phosphatidylethanolamine (LPI) (PE) 36 8 [M+NH [M+H] + 4 ] + NL, NL, Da Da phosphatidylserine alkylphosphatidylethanolamine (PS) (PE(O)) 14 7 [M+H] + NL, Da phosphatidylglycerol alkenylphosphatidylethanolamine (PG) (PE(P)) 56 4 [M[M+H] + NH 4 ] + NL, Acyl specific Da bis(monoacylglycerol)phosphate (BMP) 1 [M + NH 4 ] m/z lysophosphatidylethanolamine (LPE) 14 [M+H] free cholesterol (COH) 1 [M + NH NL, Da 4 ] m/z cholesteryl lysoalkenylphosphatidylethanolamine ester (CE) (LPE(P)) 28 4 [M[M+H] + NH 4 ] + NL, m/z Da cholesteryl ester derivatives 18 [M + NH 4 ] /369.3 m/z acylcarnitine 14 [M+H] m/z diacylglycerol (DG) 20 [M + NH 4 ] + NL, fatty acid triaclyglycerol (TG) 44 [M + NH 4 ] + NL, fatty acid alkyl-diacylglycerol (TG(O)) 3 [M + NH 4 ] + NL, fatty acid TOTAL 602
4 Lipid (partial) Lipid (partial) Serine + palmitate fatty acid cholesterol Sphingolipid Serine + palmitate fatty acid cholesterol Sphingolipid Cardiolipin Cardiolipin CerS1-6 dihydroceramide DEGS SMGS ceramide UGCG monohexosylceramide B4GALT6 sphingomyelin G-3-P 1-acyl-G-3-P Cholesteryl ester Cho acyl-coa fatty alcohol DHAP P-Cho CDP-Cho Etn P-Etn CDP-Etn Plasmalogen Phosphatidylcholine Cholesteryl ester Glycerolipid Phosphatidylinositol CerS1-6 dihydroceramide DEGS SMGS ceramide UGCG monohexosylceramide B4GALT6 sphingomyelin G-3-P 1-acyl-G-3-P Cholesteryl ester Cho acyl-coa fatty alcohol DHAP P-Cho CDP-Cho Etn P-Etn CDP-Etn Plasmalogen Phosphatidylcholine Cholesteryl ester Glycerolipid Phosphatidylinositol dihexosylceramide A4GALT trihexosylceramide 1,2-diacyl-G-3-P 1-O-alkyl-2-acyl-glycerol EPT1 PEMT PC PE PE(O) Desaturase dihexosylceramide A4GALT trihexosylceramide 1,2-diacyl-G-3-P 1-O-alkyl-2-acyl-glycerol EPT1 PEMT PC PE PE(O) Desaturase PPAP2 CDS1 DG pgpa PG PGP DGAT cls CDP-DG pgsa Cardiolipin CDIPT TG PE(P) LPC LPE PLC PEMT PC(O) PC(P) 1-O-alkenyl-2-acyl-Gylcerol LPE(P) PPAP2 CDS1 DG pgpa PG PGP DGAT cls CDP-DG pgsa Cardiolipin CDIPT TG PE(P) LPC LPE PLC PEMT PC(O) PC(P) 1-O-alkenyl-2-acyl-Gylcerol LPE(P) PI LPI LPC(O) LPC(P) PI LPI LPC(O) LPC(P) Obesity, Impaired Glucose Tolerance and Diabetes Australia has an obesity epidemic Increase in type 2 diabetes 7.6% in 2000 will rise to 11.4% by 2025 More than 1/3 individuals will develop diabetes 1,000,000 new cases by 2025 Cost is in the $billions Obesity is an important risk factor for type 2 diabetes not all obese individuals will go on to develop diabetes. Changes in lipid play a key role in the development and progression of diabetes. What is the lipid profile characteristic of: Diabetes? Prediabetes? Obesity? What is the difference between: Diabetes and obesity? Diabetes and prediabetes? Can we classify/predict diabetes from the lipid profile? What is the influence of intervention (diet, drug) on the diabetiogenic lipid profile?
5 AusDiab cohort: Cross sectional study of newly diagnosed patients at baseline Age Sex (%F) BMI Systolic BP Total Chol HDL Chol TRIGs NGT (n = 170) (+/- 13) (+/-3.1) (+/-21) (+/-1.0) (+/-0.4) (+/-0.6) IGT/IFG (n=64) (+/- 11) (+/-3.2) (+/-23) (+/-1.1) (+/-0.5) (+/-1.1) Diabetic (n = 117) (+/- 13) (+/-3.5) (+/-20) (+/-1.1) (+/-0.4) (+/-1.3) (Lipid analysis: API-4000 Q/TRAP ) Lipid extraction 10mL plasma Single phase CHCl 3 / MeOH / H 2 O BuOH / MeOH / H 2 O Multiple reaction monitoring (MRM) 2 x LC ESI-MS/MS experiments 351 participants 337 lipid species in total 7 days 118,000 measurements (Logistic regression analysis) Logistic regression (standardised to inter-quartile range) Diabetes against NGT o Adjust for age, sex, systolic BP, obesity Prediabetes against NGT o Adjust for age, sex, systolic BP, obesity Obese against non-obese (in NGT group only) o Based on median waist/hip ratio o Adjust for age, sex, systolic BP 282 known lipid species 142 associated with Diabetes (vs. NGT, p<0.05)* 116 associated with Prediabetes (vs. NGT, p<0.05)* 58 associated with Obesity (vs.non-obese, p<0.05)* o 108 associated with Obesity (vs. Non-obese, p<0.05) * Corrected for multiple comparisons (Benjamini-Hochberg) (Logistic regression analysis) dihydroceramide ceramide Chol monohexosylceramide dihexosylceramide HDL trihexosylceramide phosphatidylcholine LDL odd chain phosphatidylcholine alkylphosphatidylcholine TRIG alkenylphosphatidylcholine phosphatidylethanolamine phosphatidylserine phosphatidylinositol phosphatidylglycerol cholesterol ester diacylglycerol triacylglycerol glycosyltransferase Odds Ratio Odds Ratio serine + palmitate dihydroceramide multiple enzymes desaturase ceramide glycosyltransferase monohexosylceramide dihexosylceramide Diabetes vs. glycosyltransferase NGT* Prediabetes vs. NGT* trihexosylceramide Obese vs. non-obese (NGT only) (Adjusted for age, sex, SBP, obesity*)
6 Validation with San Antonio Family Heart Study (n=1200, 40 families) (Odds Ratio: Diabetes vs Obesity) dihydroceramide ceramide monohexosylceramide dihexosylceramide trihexosylceramide GM3 ganglioside sphingomyelin hydroxysphingomyelin phosphatidylcholine odd chain phosphatidylcholine alkylphosphatidylcholine alkenylphosphatidylcholine lysophosphatidylcholine lysoalkylphosphatidylcholine phosphatidylethanolamine phosphatidylglycerol phosphatidylinositol phosphatidylserine free cholesterol cholesterol ester diacylglycerol triacylglycerol Odds Ratio Cer 16:0 Cer 18:0 Cer 20:0 Cer 22:0 Cer 24:0 Cer 24:1 total ceramide Odds Ratio Diabetes vs. NGT (Adjusted for age, sex, SBP, obesity) AUSDIAB SAFHS dhcer 18:0 SM(OH) 20:1 LPC(O-18:0) oddpc 33:2 oddpc 35:2 oddpc 37:4 PC(O-34:2) PE 38:6 PE 40:7 PE 40:6 PS 40:6 PI 32:1 PI 34:0 PI 34:1 PI 38:6 PI 40:6 CE 16:2 CE 16:1 CE 24:2 DG 18:2/18: y = x R² = Kroger et al. Erythrocyte membrane phospholipid fatty acids, desaturase Djousse activity, 1.00L, Gaziano and dietary JM, fatty Buring acids JE, in Lee relation IM: to risk of type 2 diabetes in the Dietary European omega-3 Prospective fatty acids Investigation and fish consumption into Cancer and and risk Nutrition of type 2 (EPIC)- diabetes. Am J Clin NutrPotsdam 2011;93: Study. Am J Clin Nutr 2011;93: Diabetes vs. NGT* 0.25 Prediabetes vs. NGT* Obese vs. non-obese (NGT only) (Adjusted 4.00 for age, sex, SBP, obesity*) Odds Ratio (Diabetes) Odds Ratio (correlation to dietary n-3 PUFA) PE 38:6 PE 38:5 PE 40:7 PE 40:6 PS 40:6 PS 40:5 PI 38:6 PI 40:6 CE 22:6 CE 22:5 DG 16:0 22:5 DG 16:0 22:6 TG 18:1 18:1 22: Odds ratio Correlation P value E E E E E E E E E E E E E-11 Omega-3 and type 2 diabetes (Summary) Plasma lipid species are altered in obesity prediabetes and type 2 diabetes Ceramides are positively associated with T2D Alkenylphosphatidylcholines (plasmalogens) are negatively associated with T2D Omega-3 containing species correlate with dietary intake of omega-3 fatty acids Distribution into different lipid pools likely to also be a contributing factor Omega-3 containing species are positively associated with type 2 diabetes This may be a result rather than a cause of T2D The plasma lipidomic profile provides a detailed view of lipid and can be used to assess the effect of dietary intervention studies on metabolic health.
7 Plasmalogens as a potential therapeutic for cardiometabolic disease Plasmalogens and atherosclerosis vinyl ether polar head group Anti-atherogenic anti-oxidant anti-inflammatory cholesterol efflux Plasmalogens and cardiometabolic disease Baker IDI clinical cohort (n=220) Plasmalogens negatively associated with stable and unstable coronary artery disease (Meikle et al, ATVB. 2011;31(11): ) San Antonio Family Heart Study (n=1200) Plasmalogens negatively associated with type 2 diabetes Plasmalogens negatively associated with future CVE (particularly omega-3 species) (Meikle et al, PLoS One. 2013;8(9):e74341) LIPID / ADVANCE Study (n= 10,000) Plasmalogens negatively associated with future CVE (CVD death) o particularly omega-3 species Biosynthetic pathway of plasmalogens Dietary intake Long chain fatty alcohol Acyl-CoA Peroxisome Far-1*/2 1-alkyl-glycerol Acyl-CoA DHAP 1-acyl-DHAP 1-O-alkyl-DHAP DHAP-AT ADHAP-S 1-O-alkenyl-2-acyl-Gylcerol C-PT PLC PC-plasmalogen 1-O-alkyl-2-acyl-GPC C-PT AG kinase 1 desaturase 1-O-alkyl-2-acyl-Gylcerol 1-O-alkyl-2-acyl-G3P AADHAP-R PEMT AAG3P-AT 1-O-alkyl-G3P 1-O-alkyl-DHAP PE-plasmalogen 1-O-alkyl-2-acyl-GPE Cytosol E-PT PH AADHAP-R ER
8 Plasmalogen upregulation to prevent atherosclerosis in ApoE mice (Aliki Rasmiena) Analysis C57/BL6 (controls) ApoE -/- ApoE -/- GPx -/- batyl alcohol Lipid profiles of mouse plasma and heart Sudan IV staining for lesions/plaque in aorta Detection of inflammatory and oxidative markers in aorta and aortic sinus sections plasmalogen chow high fat diet +/- 2% batyl alcohol diet Weekly weighing and twice weekly scruffing 0 wk 6 wk 18 wk Batyl alcohol supplementation increased plasmalogen levels in plasma Batyl alcohol supplementation increased plasmalogen levels in heart Data are median (interquartiles) of N = 9 10 /group. indicates P<0.001 Data are median (interquartiles) of N = 9 10 /group. indicates P<0.001
9 Assessment of aortic lesions C57/BL6 ApoE -/- ApoE -/- GPx1 -/- Batyl alcohol supplementation attenuated atherosclerosis in ApoE deficient mice 0% BA -71% -69% 2% BA Data are mean SEM, expressed as % plaque area, n = 10/group. Data were analysed using student t-tests and compared to 0% BA treated group of the corresponding genotypes. indicates P< Diagram obtained from JACC Plasmalogen upregulation to prevent atherosclerosis in ApoE mice Batyl alcohol containing diet successfully elevated plasmalogen concentration in plasma and heart Plasmalogen up-regulation reduced atherosclerosis in ApoE -/- and ApoE -/- GPx -/- Differential effects on inflammation and oxidative stress were observed in ApoE -/- and ApoE -/- GPx -/- mouse model A lipidomic view of omega-3 in health and disease Plasma lipidomics provide a composite measure of environmental (dietary) and genetic influences on Plasma lipidomics can provide a detailed picture of metabolic health Plasma lipidomics can predict risk of disease Future studies will enable us to assess the effect of dietary interventions on plasma lipidomic profile and thereby on disease risk Such studies may help guide dietary recommendations in the future
10 Acknowledgments Baker Heart and Diabetes Institute Metabolomics Lab Baker Heart and Diabetes Institute Jonathan Shaw / Dianna Magliano Bronwyn Kingwell / Melissa Formosa Paul Nestel University of Indonesia Kevin Aristyo Gunawan Kevin Culham
DECLARATION OF CONFLICT OF INTEREST. None
DECLARATION OF CONFLICT OF INTEREST None Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J Meikle 1, Gerard Wong 1, Despina Tsorotes 1, Christopher K Barlow 1, Jacquelyn
More informationLarge-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention
Large-scale plasma lipidomic profiling identifies lipids that predict cardiovascular events in secondary prevention Piyushkumar A. Mundra,, Peter J. Meikle, LIPID Study Investigators JCI Insight. 2018;3(17):e121326..
More informationMass Spectrometry based metabolomics
Mass Spectrometry based metabolomics Metabolomics- A realm of small molecules (
More informationThe use of mass spectrometry in lipidomics. Outlines
The use of mass spectrometry in lipidomics Jeevan Prasain jprasain@uab.edu 6-2612 utlines Brief introduction to lipidomics Analytical methodology: MS/MS structure elucidation of phospholipids Phospholipid
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationLC/MS Method for Comprehensive Analysis of Plasma Lipids
Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,
More informationPoly-unsaturated phospholipids WE (FA18:1) A B C D OAHFA 18:1/24:0 OAHFA 18:1/30:2 PS 38:4 C18:1C23:0 OAHFA 18:1/25:0 OAHFA 18:1/30:1
Figure S1, related to Figure 1. Correlation scatter plots illustrating individual lipid species from various classes that exhibited statistically significant correlations to age. (A-B) Various species
More informationEnrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents
Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823
More informationANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd
ANSC (NUTR) 618 LIPIDS & LIPID METABOLISM Membrane Lipids and Sphingolipidsd I. Classes of membrane lipids A. Glycerolipids (quantitatively the most important of the three membrane lipids) B. Shingolipids
More informationSupplemental Information. LipiDex: An Integrated Software Package. for High-Confidence Lipid Identification
Cell Systems, Volume 6 Supplemental Information LipiDex: An Integrated Software Package for High-Confidence Lipid Identification Paul D. Hutchins, Jason D. Russell, and Joshua J. Coon Figure S1. Omics
More informationImpact of Chromatography on Lipid Profiling of Liver Tissue Extracts
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction
More informationAcute coronary syndromes (unstable angina, myocardial
Plasma Lipidomic Analysis of Stable and Unstable Coronary Artery Disease Peter J. Meikle, Gerard Wong, Despina Tsorotes, Christopher K. Barlow, Jacquelyn M. Weir, Michael J. Christopher, Gemma L. MacIntosh,
More informationFuture directions for nutritional and therapeutic research in omega-3 3 lipids
Future directions for nutritional and therapeutic research in omega-3 3 lipids Philip Calder Professor of Nutritional Immunology University of Southampton Aim To review dietary sources and intakes of long
More informationSUPPLEMENTARY DATA. Materials and Methods
SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters
More informationPattern of lipid biomarkers and risk of cardiovascular disease
Pattern of lipid biomarkers and risk of cardiovascular disease Robert Clarke Clinical Trial Service Unit University of Oxford 9 January 2017 Biomarkers for dietary fats Blood lipids (LDL, HDL, triglycerides,
More informationSUPPLEMENTAL MATERIAL
SUPPLEMENTAL MATERIAL Supplemental Methods Lipid extraction. Tissue was pulverized with a mortar and pestle or a ball-grinding method (Mikro Dismembrator, Sartorius). All subsequent steps were performed
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationNew Frontiers for MS in Metabolipidomics
New Frontiers for MS in Metabolipidomics Giuseppe Astarita, PhD Principal Scientist Discovery & Life Sciences Milford, MA USA 2011 Waters Corporation 1 Why Metabolipidomics? Biomedical Sciences o Biomarker
More informationGlycerolipid Analysis. LC/MS/MS Analytical Services
Glycerolipid Analysis LC/MS/MS Analytical Services Molecular Characterization and Quantitation of Glycerophospholipids in Commercial Lecithins by High Performance Liquid Chromatography with Mass Spectrometric
More informationObtaining Answers to Biological Questions Sample Prep to Data Analysis. Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS
Obtaining Answers to Biological Questions Sample Prep to Data Analysis Jeremiah D. Tipton, Ph.D. SCIEX Advanced Workflow Specialist in OMICS OMICS Research Why Quantitative OMICS? 2 2015 AB Sciex SCIEX
More informationLipids Analysis. Lipids
Lipids Analysis Stephen Barnes 3 5 15 Lipids Lipids are mostly very hydrophobic Most are conjugates of fatty acids of a variety of chain lengths, which have different degrees of unsaturation, cis trans
More informationQuantitation of Sphingolipids in Tissue Extracts by LC/MS/MS
Quantitation of Sphingolipids in Tissue Extracts by LC/MS/MS Alexei Belenky CASSS, Meritage Resort, Napa 2008 Outline Role of lipid analysis in drug discovery and disease diagnostics Analytical tools and
More informationMass-Spectrometric Analysis of Lipids (Lipidomics)
Mass-Spectrometric Analysis of Lipids (Lipidomics) 1. Identification 2. Quantification 3. Metabolism Why to do lipidomics? Biology: Functions of different lipids? Medicine: Diagnostics and Therapy Industry:
More informationSelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics
ANSWERS FOR SCIENCE. KNOWLEDGE FOR LIFE. SelexION Technology for Lipid Analysis: Pushing the Boundaries of Lipidomics Baljit Ubhi, Ph.D ASMS Baltimore, June 2014 Lipidomics Profiling Needs and Deliverables
More informationMEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS
December 6, 2011 Lecturer: Eileen M. Lafer MEMBRANE LIPIDS I and II: GLYCEROPHOSPHOLIPIDS AND SPHINGOLIPIDS Reading: Stryer Edition 6: Chapter 26 Images: All images in these notes were taken from Lehninger,
More informationA Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids
A Definitive Lipidomics Workflow for Human Plasma Utilizing Off-line Enrichment and Class Specific Separation of Phospholipids Jeremy Netto, 1 Stephen Wong, 1 Federico Torta, 2 Pradeep Narayanaswamy, 2
More informationAnnotation of potential isobaric and isomeric lipid species measured with the AbsoluteIDQ p180 Kit (and p150 Kit)
We provide the Phenotype to the Genotype! DocNr. 35017 V 2 2017-02 Annotation of potential isobaric and isomeric lipid species measured with the (and p150 Kit) Introduction Lipidomics, a branch of metabolomics
More informationMASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES. Cassie J.
MASS SPECTROMETRY STRATEGIES FOR COMPREHENSIVE LIPIDOME ANALYSIS OF COLORECTAL CANCER CELLS AND THEIR SECRETED EXOSOMES By Cassie J. Fhaner A DISSERTATION Submitted to Michigan State University in partial
More informationCETP inhibition: pros and cons. Philip Barter The Heart Research Institute Sydney, Australia
CETP inhibition: pros and cons Philip Barter The Heart Research Institute Sydney, Australia Philip Barter Disclosures Received honorariums for lectures, consultancies or membership of advisory boards from:
More informationWelcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind. Course: Search of MS/MS files with the NIST MS Search GUI
Biology Informatics Chemistry Welcome! Mass Spectrometry meets Cheminformatics WCMC Metabolomics Course 2014 Tobias Kind Course: Search of MS/MS files with the NIST MS Search GUI http://fiehnlab.ucdavis.edu/staff/kind
More informationThe health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences
The health benefits of shellfish: What should we be promoting? Professor Bruce Griffin Nutrition Division Faculty of Health & Medical Sciences What should we be promoting? Define health benefits in terms
More informationBy: Dr Hadi Mozafari 1
Biological lipids are a chemically diverse group of compounds, the common and defining feature of which is their insolubility in water. By: Dr Hadi Mozafari 1 Fats and oils are the principal stored forms
More informationBlood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations.
Blood fatty acids understanding the relevance of different tissue fractions and interpreting circulating concentrations Leanne Hodson Fatty acid composition as a biomarker of intake Complements dietary
More informationSaturated fat- how long can you go/how low should you go?
Saturated fat- how long can you go/how low should you go? Peter Clifton Baker IDI Heart and Diabetes Institute Page 1: Baker IDI Page 2: Baker IDI Page 3: Baker IDI FIGURE 1. Predicted changes ({Delta})
More informationCase Presentation. Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer
Case Presentation Rafael Bitzur The Bert W Strassburger Lipid Center Sheba Medical Center Tel Hashomer Case Presentation 50 YO man NSTEMI treated with PCI 1 month ago Medical History: Obesity: BMI 32,
More informationOverview on the identification of different classes of. lipids by HPTLC (High Performance Thin Layer. Chromatography) and ITLC (Immuno Thin Layer
Overview on the identification of different classes of lipids by HPTLC (High Performance Thin Layer Chromatography) and ITLC (Immuno Thin Layer Chromatography) Iuliana Popa 1, Marie-Jeanne David 2, Daniel
More informationJanet B. Long, MSN, ACNP, CLS, FAHA, FNLA Rhode Island Cardiology Center
Primary and Secondary Prevention of Coronary Artery Disease: What is the role of non statin drugs (fenofibrates, fish oil, niacin, folate and vitamins)? Janet B. Long, MSN, ACNP, CLS, FAHA, FNLA Rhode
More informationCardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
More informationAchieve Broad Lipid Quantitation using a High-Throughput Targeted Lipidomics Method
Achieve Broad Lipid Quantitation using a High-Throughput Targeted Lipidomics Method LC-Based Approach for Lipid Class Separation and Quantitation on QTRAP 6500+ System Mackenzie Pearson, Santosh Kumar
More informationPhospholipid characterization by a TQ-MS data based identification scheme
P-CN1716E Phospholipid characterization by a TQ-MS data based identification scheme ASMS 2017 MP-406 Tsuyoshi Nakanishi 1, Masaki Yamada 1, Ningombam Sanjib Meitei 2, 3 1 Shimadzu Corporation, Kyoto, Japan,
More informationDysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE
Dysfunctional HDL and Coronary Artery Disease (CAD) UMHS-PUHSC JOINT INSTITUTE PIs and Members of HDL Project Wei Gao, M.D., Ph.D. Professor and Chair Cardiology Third Hospital, PUHSC Yong Huo, M.D., Ph.D.
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationFacts on Fats. Ronald P. Mensink
Facts on Fats Ronald P. Mensink Department of Human Biology NUTRIM, School for Nutrition, Toxicology and Metabolism Maastricht University Maastricht The Netherlands Outline of the Presentation Saturated
More informationPrinciples of Shotgun Lipidomics
Principles of Shotgun Lipidomics Xianlin Han Diabetes and Obesity Research Center Sanford-Burnham Medical Research Institute Lake Nona Orlando, FL 32827 What is shotgun lipidomics? Original definition
More informationMetabolomic fingerprinting of serum samples by direct infusion mass spectrometry
Metabolomic fingerprinting of serum samples by direct infusion mass spectrometry Raúl González-Domínguez * Department of Chemistry, Faculty of Experimental Sciences. University of Huelva, Spain. * Corresponding
More informationAgilent Solutions for Lipidomics. Greater Insight into
Agilent Solutions for Lipidomics Greater Insight into Lipid Metabolism Understanding Lipidomics What is Lipidomics? The term "lipidome" refers to all the lipids that exist in an organism and their effects
More informationLipidomics Discovery Profiling and Targeted LC/MS Analysis in 3T3-L1 Differentiating Adipocytes
Lipidomics Discovery Profiling and Targeted LC/MS Analysis in 3T3-L1 Differentiating Adipocytes Application Note Authors Theodore Sana and Steve Fischer Agilent Technologies, Inc. Santa Clara, CA, USA
More informationLIPIDS Introduction - complex lipids. Marek Vecka
LIPIDS Introduction - complex lipids Marek Vecka CLASSIFICATION OF LIPIDS IV - biosynthetic route Lipid class Fatty acyls Glycerolipids Glycerophospholipids Sphingolipids Sterol lipids Prenol lipids Other
More informationSupporting information
Supporting information A novel lipidomics workflow for improved human plasma identification and quantification using RPLC-MSn methods and isotope dilution strategies Evelyn Rampler 1,2,3, Angela Criscuolo
More informationLipid Class Separation Using UPC 2 /MS
Michael D. Jones, 1,3 Giorgis Isaac, 1 Giuseppe Astarita, 1 Andrew Aubin, 1 John Shockcor, 1 Vladimir Shulaev, 2 Cristina Legido-Quigley, 3 and Norman Smith 3 1 Waters Corporation, Milford, MA, USA 2 Department
More informationLipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND. Bridgwater, England LIPIDOMIC ANALYSIS. Fourth Edition. Invergowrie, Dundee, Scotland
Lipid Analysis ISOLATION, SEPARATION, IDENTIFICATION AND LIPIDOMIC ANALYSIS Fourth Edition WILLIAM W.CHRISTIE MRS Lipid Analysis Unit, Scottish Crop Research Institute, Dundee, Scotland Invergowrie, and
More information10/8/2015. MN Nursing Conference October 7th, 2015 Michael Miedema, MD MPH. None
MN Nursing Conference October 7th, 2015 Michael Miedema, MD MPH None 1 Objectives Why the need for change in the guidelines? What is the potential impact of these guidelines? Where do we go from here?
More informationMetabolomics and systems biology approaches to study health and disease. Matej Oreši
Metabolomics and systems biology approaches to study health and disease Matej Oreši 14.12.2011 1/19/2012 2 Biomarker concept in domain of human health [Wikipedia definition] A substance used as an indicator
More informationCHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS
28 09/16/2013 17:44:40 Page 415 APTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents
More informationCardiac patient quality of life. How to eat adequately?
Cardiac patient quality of life How to eat adequately? François Paillard CV Prevention Center CHU Rennes JESFC, Paris, 17/01/2013 Mrs. L. 55 yrs, Coronary artery disease, normal weight, mild hypertension
More informationThe inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema
The inhibition of CETP: From simply raising HDL-c to promoting cholesterol efflux and lowering of atherogenic lipoproteins Prof Dr J Wouter Jukema Dept Cardiology, Leiden University Medical Center, Leiden,
More informationRapid Lipid Profiling of Serum by Reverse Phase UPLC-Tandem Quadrupole MS
Rapid Lipid Profiling of Serum by Reverse Phase UPLC-Tandem Quadrupole MS Mark Ritchie and Evelyn Goh Waters Pacific Pte Ltd., Singapore A P P L I C AT ION B E N E F I T S Delivers a rapid 10-min MRM method
More informationAnnotation of potential isobaric and isomeric lipid species analyzed using the MxP Quant 500 Kit
Annotation of potential isobaric and isomeric lipid species analyzed using the MxP Quant 500 Kit Introduction The MxP Quant 500 kit enables the analysis of up to 630 metabolites covering 26 compound classes
More informationCHAPTER 28 LIPIDS SOLUTIONS TO REVIEW QUESTIONS
HAPTER 28 LIPIDS SLUTINS T REVIEW QUESTINS 1. The lipids, which are dissimilar substances, are arbitrarily classified as a group on the basis of their solubility in fat solvents and their insolubility
More informationSoo LIM, MD, PHD Internal Medicine Seoul National University Bundang Hospital
Soo LIM, MD, PHD Internal Medicine Seoul National University Bundang Hospital 1. Importance of Lowering LDL-Cholesterol in Diabetes Patients & Lipid Guidelines Prevalence of dyslipidemia in Korea Prevalence
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationPhospholipid Analysis. P NMR Analytical Services
Phospholipid Analysis 31 P NMR Analytical Services Quantitative Phospholipid Analysis of Soy Lecithin and Krill Lecithin by 31 P NMR Katherine L Lanier; Jeff D Moore; Dale Smith; Shengrong Li; Ben Davis;
More informationPhospholipids Metabolism
Chapter VI: Phospholipids Metabolism Dr. Sameh Sarray Hlaoui Phospholipids Features: Amphipatic: - Hydrophobic head: fatty acids - Hydropholic head: P group+ alcohol Composed of alcohol attached by a phosphodiester
More informationDietary Reference Values: a Tool for Public Health
HOGE GEZONDHEISRAAD Dietary Reference Values: a Tool for Public Health CONSEIL SUPERIEUR DE LA SANTE Belgian Dietary Reference Values for Energy and Macronutrients: FATS G. De Backer Brussels, February
More informationSUPPLEMENTAL MATERIAL. A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in. diabetic patients
SUPPLEMENTAL MATERIAL A novel truncated form of Apolipoprotein A-I transported by dense LDL is increased in diabetic patients Cubedo et al: ApoA-I truncated form in diabetes By Judit Cubedo a, Teresa Padró
More informationmedicine nature Metabolomics Studies Reveal New Pathways in Cardiovascular Disease with Potential for Diagnostics and Therapeutic Targeting
Metabolomics Studies Reveal New Pathways in Cardiovascular Disease with Potential for Diagnostics and Therapeutic Targeting nature medicine VOLUME 19 NUMBER 5 MAY 213 www.nature.com/naturemedicine Stanley
More informationEicosapentaenoic Acid and Docosahexaenoic Acid: Are They Different?
Eicosapentaenoic Acid and Docosahexaenoic Acid: Are They Different? Trevor A Mori, Ph.D., Professor, School of Medicine and Pharmacology, Royal Perth Hospital Unit, University of Western Australia, Perth,
More informationAgilent 6470 Triple Quadrupole LC/MS System and EMR-Lipid. The Combination for Confident Pesticide Quantitation. Christoph Mueller
Agilent 670 Triple Quadrupole LC/MS System and EMR-Lipid The Combination for Confident Pesticide Quantitation Christoph Mueller Agilent Technologies LCMS Application Scientist EMEAI Food Market Program
More informationDietary Lipid Utilization by Haddock (Melanogrammus aeglefinus)
Dietary Lipid Utilization by Haddock (Melanogrammus aeglefinus) Santosh P. Lall & Dominic A. Nanton National Research Council of Canada Halifax, Canada vis, California ne 23, 2003 Body Components of Wild
More informationOmega-3 Fatty Acids. Alison L. Bailey MD, FACC Erlanger Heart and Lung Institute/University of Tennessee COM
Omega-3 Fatty Acids Alison L. Bailey MD, FACC Erlanger Heart and Lung Institute/University of Tennessee COM Chattanooga @a_l_bailey Disclosures None Objectives Describe omega-3 fatty acids Review the historic
More informationComprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease
Comprehensive Lipid Profiling of Human Liver Tissue Extracts of Non-Alcoholic Fatty Liver Disease Multiplexed Precursor Ion Scanning and LipidView Software Brigitte Simons 1 and Bianca Arendt 2 1 AB SCIEX,
More informationChapter 8. Functions of Lipids. Structural Nature of Lipids. BCH 4053 Spring 2001 Chapter 8 Lecture Notes. Slide 1. Slide 2.
BCH 4053 Spring 2001 Chapter 8 Lecture Notes 1 Chapter 8 Lipids 2 Functions of Lipids Energy Storage Thermal Insulation Structural Components of Membranes Protective Coatings of Plants and Insects Hormonal
More information1. Methodology of lipidomics: Tandem mass spectrometry of ether phospholipids
Transworld Research Network 37/661 (2), Fort P.O. Trivandrum-695 023 Kerala, India Lipidomics: Sea Food, Marine Based Dietary Supplement, Fruit and Seed, 2012: 1-19 ISBN: 978-81-7895-573-5 Editor: 1. Methodology
More informationImpact of Lifestyle Modification to Reduce Cardiovascular Disease Event Risk of High Risk Patients with Low Levels of HDL C
Impact of Lifestyle Modification to Reduce Cardiovascular Disease Event Risk of High Risk Patients with Low Levels of HDL C Thomas P. Bersot, M.D., Ph.D. Gladstone Institute of Cardiovascular Disease University
More informationLife Science and Chemical Analysis Solutions. Baljit Ubhi, Jeff Patrick, David Alonso, and Joe Shambaugh 1 2 3
Complementary LC- and GC- Mass Spectrometry Techniques Provide Broader Coverage of the Metabolome Cross-Platform Metabolomics Data Analysis Combining AB SCIEX LC/MS, LECO GC/MS, and Genedata Software 1
More informationSupporting Information
Composition and lipid spatial distribution of High Density Lipoprotein particles in subjects with Laxman Yetukuri, 1 Sanni Söderlund, 2 Artturi Koivuniemi, 3 Tuulikki Seppänen-Laakso, 1 Perttu S. Niemelä,
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationLC-Based Lipidomics Analysis on QTRAP Instruments
LC-Based Lipidomics Analysis on QTRAP Instruments Junhua Wang and Paul RS Baker SCIEX LC-Based Lipidomics Analysis Topics Covered Lipid extraction techniques Hydrophilic Interaction Chromatography (HILIC)
More informationLipids. Lipids. Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague
Lipids Jiří Jonák and Lenka Fialová Institute of Medical Biochemistry, 1st Medical Faculty of the Charles University, Prague Lipids 1. General introduction 2. Nomenclature of fatty acids 3. Degradation
More informationLipid Management 2013 Statin Benefit Groups
Clinical Integration Steering Committee Clinical Integration Chronic Disease Management Work Group Lipid Management 2013 Statin Benefit Groups Approved by Board Chair Signature Name (Please Print) Date
More informationGoing Coconut over Saturated Fat? Why So Much Confusion? Part 1 Interpreting Conflicting Research
Going Coconut over Saturated Fat? Why So Much Confusion? Part 1 Interpreting Conflicting Research Disclosures Alice H Lichtenstein Board Member/Advisory Panel Food and Nutrition Board, National Academies
More informationModifying effects of dietary polyunsaturated fatty acid (PUFA) on levels of cholesterol and their implications for heart health
Modifying effects of dietary polyunsaturated fatty acid (PUFA) on levels of cholesterol and their implications for heart health Robert Clarke Clinical Trial Service Unit University of Oxford 28 th May
More informationPHOSPHOLIPIDS METABOLISM. BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
PHOSPHOLIPIDS METABOLISM BY Dr. Walid Said Zaki Dr. Marwa Ali LECTURER OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1. State the definition and classification of Phospholipids. 2. Describe the general structure
More information2013 W. H. Freeman and Company. 10 Lipids
2013 W. H. Freeman and Company 10 Lipids CHAPTER 10 Lipids Key topics: Biological roles of lipids Structure and properties of storage lipids Structure and properties of membrane lipids Structure and properties
More informationPlacebo-Controlled Statin Trials EXPLAINING THE DECREASE IN DEATHS FROM CHD! PREVENTION OF CARDIOVASCULAR DISEASE IN WOMEN EXPLAINING THE DECREASE IN
PREVENTION OF CARDIOVASCULAR DISEASE IN WOMEN Robert B. Baron MD MS Professor and Associate Dean UCSF School of Medicine Declaration of full disclosure: No conflict of interest EXPLAINING THE DECREASE
More informationPCs Acyl chain double bonds. PEs
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2014 Male/Female ratio Male/Female ratio PCs 1.3 1.2 1.1 1 0.9 0.8 0.7 0.6 0.5 0.4 0 1 2
More informationLipid and Bile Acids as NAFLD- Related Biomarkers
Lipid and Bile Acids as NAFLD- Related Biomarkers Puneet Puri, MBBS, MD Division of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University, Richmond, VA 1st International Workshop
More informationComprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid Quadrupole-Orbitrap-Linear Ion Trap Mass Spectrometer
B American Society for Mass Spectrometry, 2014 J. Am. Soc. Mass Spectrom. (2015) 26:133Y148 DOI: 10.1007/s13361-014-1013-x RESEARCH ARTICLE Comprehensive Lipidome Analysis by Shotgun Lipidomics on a Hybrid
More informationAnalysis of Lipid Metabolites. = Lipidomics
Analysis of Lipid Metabolites = Lipidomics Pentti Somerharju Transmed 11.10.2012 utline of the talk What is Lipidomics? Where is lipidomics needed? Lipid classes and their functions Why mass-spectrometric
More informationNot Hard Choices. By Dato Dr. Rajen M. 27 October 2018
Make Choices Not Hard Choices By Dato Dr. Rajen M. 27 October 2018 Key Facts of Cardiovascular Disease 1. What is the burden of cardiovascular disease in Malaysia? 2. What causes cardiovascular disease?
More informationThere are many ways to lower triglycerides in humans: Which are the most relevant for pancreatitis and for CV risk?
There are many ways to lower triglycerides in humans: Which are the most relevant for pancreatitis and for CV risk? Michael Davidson M.D. FACC, Diplomate of the American Board of Lipidology Professor,
More informationTerm-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY
MCC-006 POST GRADUATE DIPLOMA IN CLINICAL CARDIOLOGY (PGDCC) 00269 Term-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY Time : 2 hours Maximum Marks : 60 Note : There will be multiple
More informationHealthy Fats & Fatty Acids Current Dietary Recommendations and Popular Opinions
Healthy Fats & Fatty Acids Current Dietary Recommendations and Popular Opinions Presentation 1 of 2 Penny M. Kris-Etherton PhD RD FAHA FNLA FASN CLS Department of Nutritional Sciences Penn State University
More informationOptimising. membranes
Optimising Neuronal membranes Lipids are classified as 1. Simple lipids oils and fats 2. Complex lipids a) Phospholipids b) Glycosphingolipids containing a fatty acid, sphingosine and a CHO c) Lipoproteins
More informationHuman Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition
Human Complex Milk Lipids: Concentrations, benefits and the implications for Paediatric Nutrition Alastair MacGibbon, Bertram Fong, Angela Rowan and Paul McJarrow Fonterra Research and Development Centre,
More informationCan foods change your health? Good fats and bad fats: what is the evidence? Kay-Tee Khaw. Main categories of fats
Can foods change your health? Good fats and bad fats: what is the evidence? Kay-Tee Khaw UNIVERSITY OF CAMBRIDGE Hong Kong July 6 213 Yerushalmy J Hilleboe HE NY State J Med 1957 Coronary heart disease
More informationExamining the relationship between beverage intake and cardiovascular health. Ian Macdonald University of Nottingham UK
Examining the relationship between beverage intake and cardiovascular health Ian Macdonald University of Nottingham UK Outline Assessment of evidence in relation to health risks of dietary components Cardiovascular
More informationTest Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson
Test Bank for Lehninger Principles of Biochemistry 5th Edition by Nelson Link download full: http://testbankair.com/download/test-bank-forlehninger-principles-of-biochemistry-5th-edition-by-nelson/ Chapter
More informationImproving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF
Application Note Lipidomics Improving Coverage of the Plasma Lipidome Using Iterative MS/MS Data Acquisition Combined with Lipid Annotator Software and 6546 LC/Q-TOF Authors Jeremy Koelmel Department of
More informationEssential Lipidomics Experiments using the LTQ Orbitrap Hybrid Mass Spectrometer
Application Note: 367 Essential Lipidomics Experiments using the LTQ rbitrap Hybrid Mass Spectrometer Thomas Moehring 1, Michaela Scigelova 2, Christer S. Ejsing 3, Dominik Schwudke 3, Andrej Shevchenko
More information