Vol. 44, No. 1, January 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages
|
|
- Chad Stone
- 5 years ago
- Views:
Transcription
1 Vol. 44, No. 1, January 1998 Pages IN VIVO INHIBITION OF WALKER 256 TUMOUR CARNITINE PALMITOYLTRANSFERASE I BY SOYA OIL DIETARY SUPPLEMENTATION Alison Colquhoun 1, F~ibio E.P.de Mello* and Rui Curi*, Departamento de Histologia e Embriologia and *Departamento de Fisiologia e Biofisica, Instituto de CiSncias Biom6dicas, Universidade de Sao Paulo, CEP , S~o Paulo, SP, Brasil. Received October 27, 1997 The role of dietary fatty acids in the regulation of carnitine palmitoyltransferase (CPT) activity has been shown in liver but their role in the regulation of tumour CPT activity in vivo is unknown. The present study investigated the effects of several oils, given as dietary supplements, upon the activity of CPT I and II in the Walker 256 rat tumour and the inhibition or stimulation of tumour growth. CPT I activity was markedly inhibited by soya oil, rich in linoleic acid (70% inhibition vs control). CPT I mrna expression was not inhibited by any of the oils studied, indeed soya oil caused a marked increase (132% vs control) in expression. These results suggest that soya oil can modulate, in vivo, the 13-oxidative pathway of tumour tissue and further supports the hypothesis of tumour CPT I regulation by polyunsaturated fatty acids. Key Words:-carnitine palmitoyltransferase; fatty acids; soya oil; tumour; oxidation. INTRODUCTION Previous studies have reported the regulation of mrna expression of both lipogenic and glycolytic enzymes in rat liver by polyunsaturated fatty acids (1, 2). More recently, fatty acids have been reported to increase CPT I mrna expression in both foetal rat hepatocytes and the 1NS-1 pancreatic 13-cell line (3, 4). The regulation of CPT (E.C ) activity is largely unknown in tumour cells, both in vitro and in animal models. The present study has determined the in vivo effects of several oils on Walker 256 rat tumour cell proliferation and the 13-oxidative capacity of the tumour, by measurement of the maximal activity ofcpt I and II. The abbreviations used in the text are: CPT, carnitine palmitoyltransferase; PLC, phospholipase C. " 1 Corresponding author, Telephone , Fax /98/ ~ /0 Copyright by Academic Press Australia. All rights of reproduction in any form reserved.
2 Vol. 44, No. I, 1998 MATERIALS AND METHODS Animals - male Wistar rats weighing g were maintained at 23~ on a 12 hour light/dark cycle, with access to food (Purina chow) and water ad libitum. Animals received bilateral subcutaneous implants (100+3mg) of Walker 256 tumour in the flank under anaesthesia (chloral hydrate). The day of surgery was designated day 0 and, starting on day 1, the rats received daily dietary supplements ofoil by gavage, at a dose of 0.4% of body weight. Sham-treated rats received 0.9% saline at the same dose. Gavage was the chosen method of administration as this mimics the common form of human dietary supplementation with oils in the form of capsules in large, single doses. A minimum of fourteen rats were included in each group (minimum of 7 each in studies 1 and 2), and the studies were carried out for 12 days, after which the animals were killed and the tumour weight/volume measured. Rats were autopsied to check for macroscopic injury of the oesophagus, which may have limited food consumption~ but no animals presented such damage. Fatty acid compositions of the oils are given in Table 1. Mitoehondrial Preparation - tumours were fragmented and the mitochondria prepared for radiochemical measurement of maximal CPT I and II activity as in (5). Northern Blotting - Total RNA was extracted with Trizol (GIBCO), separated on 1% agarose gel and blotted onto Hybond-N nylon membrane (Amersham). Radioactive edna probe was prepared using the Rediprime system (Amersham) with [t~-32p]dctp. Membranes were hybridised with edna of rat CPT I and rat CPT II, generously provided by Prof. J.D. MeGarry, Dallas, USA and with edna of 13-actin, generously provided by Dr M. Hirata, S~o Paulo, Brazil. Results were normalised against 13-actin and quantified by scanning densitometry. Statistical significance was determined by Student's t-test, with significant difference being set at p<0.05. RESULTS Dietary supplementation was found to have no effect on mean body weight in all groups (Table 2). The presence of tumour prevented weight gain in all groups compared with normal rats of this age (gain of-30g/week). However, differences were found in food consumption, where almond oil caused a slight increase while soya oil caused a slight decrease in food consumption (Table 3). The final tumour weight was unchanged by the oils (Table 4), indicating a lack of effect on Walker 256 tumour cell proliferation by all of the oils studied. Tumour volume calculations correlated well (1"2=0.970) with measured tumour weights and are not presented here. Neither almond, macadamia, nor cod liver oil groups had altered CPT I activity compared with the control group (Table 5). However, CPT I activity was significantly decreased (p<0.01) in the soya oil group, with a decrease of 70% compared with the control group. In contrast to CPT I, CPT II activity was unchanged in all the groups. The effects of dietary supplementation upon CPT I and CPT II mrna expression were studied and the results were normalised by comparison with 13-actin mrna 152
3 TABLE 1 - Fatty acid composition of dietary oils (% of total) Fatty acid Almond Soya Macadamia Cod Liver 14: : : : : : : : : : t : : : : : TABLE 2 - Effect of dietary supplementation on rat body weight Dietary Group Mean body weight (g) Day 1 Day 12 Control Soya _+12.1 Almond Macadamia 155.2_ _+5.3 Cod Liver 161.3_ Values are mean + S.E.M. for eight rats per group. 153
4 TABLE 3 - Effects of dfetary supplementation on food consumption Dietary Group Mean food/rat/day (g) Week 1 Week 2 Control " Soya a 7, b Almond a b'~ Macadamia c Cod Liver C Values are mean + S.E.M. of six rats. Statistical significance p<0.05: a _ vs control week 1 b _ VS control week 2 ; c_ vs the same oil week 1 TABLE 4 - Effect of dietary supplementation on final tumour weight Dietary group Mean tumour weight (g) Study 1 Study 2 Combined data Control (7) (6) (13) Soya (6) (9) (15) Almond 1A (7) (7) (14) Macadamia (7) (6) (13) Cod liver (5) 1.56_+0.43 (7) (12) Values are mean + S.E.M., number of observations in parentheses. expression. CPT I mrna expression was increased in the soya oil group compared with the control group (Figure 1/Table 6). None of the other groups showed significant differences in expression. In the case of CPT II, mrna expression was increased, though not significantly, in the soya oil group and tended to increase in the other groups too. DISCUSSION These data show that soya oil, which is rich in linoleic acid, is able to modulate the maximal CPT I activity of the Walker 256 rat tumour in vivo. Long-chain polyunsaturated fatty acids derived from linoleic acid can readily be incorporated by tumour cells into various cellular compartments (6-8). In addition, they may be modified to produce eicosanoid derivatives, which may then be released to act in either an autocrine or 154
5 BIOCHEMISTRYond MOLECULAR BIOLOGY INTERNATIONAL TABLE 5 - Effects of dietary supplementation on Walker 256 tumour carnitine palmitoyltransferase I and li activity Dietary group CPT I CPT II (nmoles/rain/mg protein) Control S oya a Almond Macadamia Cod Liver Values are mean + S.E.M. for eight or nine observations. Statistical significance ~ - p<0.01 vs control CPT I (4.7Kb) CPT II (2,5Kb) 13-ACTIN (2.1Kb) FIGURE 1 - Northern blots of CPT I and CPT 1I mrna expression - Samples from left to right; 1-3 cod liver oil, 4-6 soya oil, 7-9 macadamia oil, almond oil, control paracrine way upon the tumour cells. Indeed, the Walker 256 tumour model has already been shown to have high plasma concentrations of prostaglandin E2 (9). While it remains to be identified how soya oil is able to decrease maximal CPT I activity of the tumour tissue, it does not appear to be via modifications in mrna expression (Figure 1/Table 6). The results show that CPT I mrna expression is, in fact, increased in response to the presence of soya oil, possibly in response to the inhibition of 155
6 TABLE 6 - Effects of dietary supplementation on Walker 256 tumour carnitine palmitoyltransferase I and II messenger RNA expression Dietary group % of control messenger RaNA CPT I CPT II Control Soya a Almond Macadamia Cod Liver _11.5 Values are mean + S.E.M. for four to six observations. Statistical significance a _ p<0.01 vs control enzyme activity in the mitochondria. The m vitro studies (see previous paper) have provided strong evidence in favour of the involvement of prostaglandins, derived from polyunsaturated fatty acids, in the regulation of tumour cell CPT I and, to some extent, CPT II activity. The mechanism by which these eicosanoids function in vivo remains to be determined, although it is reasonable to speculate on the involvement of second messenger systems linked to the prostaglandin E receptors, EP1-4, causing alterations in either camp or PLC/Ca 2+. (10, 11). Further studies are currently in progress to identify which mechanisms are involved in this novel regulation of tumour CPT activity. Preliminary data were presented at the 4th International Congress on Essential Fatty Acids and Eicosanoids, UK, July Funded by CNPq and FAPESP. REFERENCES 1. Jump,D.B., Clarke, S.D., Thelen,A.and Liimatta,M. (1994)d. LipidRes. 35, Clarke, S.D. and Jump, D.B. (1996) Lipids 31, $7-S Chatelain,F., Kohl,C., Esser, V., McGarry,J.D., Girard,L, Pegorier,J.P. (1996) Eur.d. Biochem. 235, Assimacopoulos-Jeannet,F., Thumelin, S., Roche,E, Esser, V., McGarry,J.D., Prentki,M. (1997)J.Biol.Chem. 272, Colquhoun,A. and Curi,R. (1995)Biochem.Mol.BioLlnt. 37, Rosenthal,M.D. (1987)Prog. LipidRes. 26, Sauer,L.A., Dauchy,R.T. and Blask,D.E. (1997) d.nutr. 127, Colquhoun,A. and Curi,R. (1997)Biochem.Mol.Biol.Int. 41, Siddiqui,R.A. and Williams,J.F. (1987)MedScLRes. 15, 45-46( 10. Chang,C.S., Negishi, M., Nishigaki, N. and Iehikawa, A. (1997) Biochem.d., 322, Schwaner,I. Offermans, S., Spicher,K., Seifert, R. and Schultz, G. (1995) Biochim.Biophys.Acta 1265,
BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL
Vol. 46, No. 3, October 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages 529-536 DIETARY FATS ALTER THE ACTIVITY AND EXPRESSION OF GLUCOSE-6-PHOSPHATE DEHYDROGENASE IN RAT LYMPHOID CELLS AND
More informationMetabolic fate of glutamine in lymphocytes, macrophages and neutrophils
Metabolic Brazilian Journal fate of of glutamine Medical in and immune Biological cells Research (1999) 32: 15-21 ISSN 0100-879X 15 Metabolic fate of glutamine in lymphocytes, macrophages and neutrophils
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More information: Overview of EFA metabolism
Figure 1 gives an overview of the metabolic fate of the EFAs when consumed in the diet. The n-6 and n-3 PUFAs when consumed in the form of dietary triglyceride from various food sources undergoes digestion
More informationKey words: Branched-chain c~-keto acid dehydrogenase complex, branched-chain c~-keto acid
Vol. 44, No. 6, May 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages 1211-1216 BRANCHED-CHAIN cx-keto ACID DEHYDROGENASE KINASE CONTENT IN RAT SKELETAL MUSCLE IS DECREASED BY ENDURANCE TRAINING
More informationALTERNATIVE SOURCES OF OMEGA-3 OILS FOR BARRAMUNDI, Lates calcarifer, AQUACULTURE
ALTERNATIVE SOURCES OF OMEGA-3 OILS FOR BARRAMUNDI, Lates calcarifer, AQUACULTURE By Ramez Alhazzaa B.Sc., Grad. Dip. Animal Husbandry A thesis submitted in fulfilment of the requirements for the degree
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationMicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells
MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on
More informationBIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL
Vol. 44, No. 1, January 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages 185-193 CARNITINE PALMITOYLTRANSFERASE II ACTIVITY IS DECREASED IN LIVER MITOCHONDRIA OF CACHECTIC RATS BEARING THE WALKER
More informationEffects of adrenalectomy and adrenal enucleation on liquid gastric emptying in rats
Brazilian Gastric emptying Journal of in Medical adrenal insufficiency and Biological Research (2000) 33: 1047-1051 ISSN 0100-879X Short Communication 1047 Effects of adrenalectomy and adrenal enucleation
More informationEffect of low fat diet on lipid absorption and fatty-acid transport following bowel resection
Pediatr Surg Int 2001) 17: 259±264 Ó Springer-Verlag 2001 MAIN TOPIC I. Sukhotnik á A. Semih Gork á M. Chen R. A. Drongowski á A. G. Coran á C. M. Harmon Effect of low fat diet on lipid absorption and
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationProliferative signaling initiated in ACTH receptors
ACTH Brazilian and Journal proliferative of Medical signaling and Biological Research (2000) 33: 1133-1140 ISSN 0100-879X 1133 Proliferative signaling initiated in ACTH receptors C.F.P. Lotfi 1, A.P. Lepique
More informationBalancing intestinal and systemic inflammation through cell type-specific expression of
Supplementary Information Balancing intestinal and systemic inflammation through cell type-specific expression of the aryl hydrocarbon receptor repressor Olga Brandstätter 1,2,6, Oliver Schanz 1,6, Julia
More informationA leucine-supplemented diet improved protein content of skeletal muscle in young tumor-bearing rats
Brazilian Leucine-supplemented Journal of Medical diet for and tumor-bearing Biological Research rats (2003) 36: 1589-1594 ISSN 0100-879X Short Communication 1589 A leucine-supplemented diet improved protein
More informationOmega-3 fatty acids in clinical nutrition
Omega-3 fatty acids in clinical nutrition Alastair Forbes With thanks to Jon Shaffer, UK and many ESPEN colleagues Omega-3 fatty acids in clinical nutrition Review of lipids in nutrition Why and how lipids
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More informationA high-fructose diet induces changes in pp185 phosphorylation in muscle and liver of rats
Fructose Brazilian diet Journal induces of Medical changes and in Biological rat pp185 Research () 33: 1421-1427 ISSN -879X Short Communication 1421 A high-fructose diet induces changes in pp185 phosphorylation
More informationPhysiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS
Physiology Unit 1 CELL SIGNALING: CHEMICAL MESSENGERS AND SIGNAL TRANSDUCTION PATHWAYS In Physiology Today Cell Communication Homeostatic mechanisms maintain a normal balance of the body s internal environment
More informationDietary omega-3 fatty acids and risk of type-2 diabetes: Lack of antioxidants?
Dietary omega-3 fatty acids and risk of type-2 diabetes: Lack of antioxidants? American Journal of Clinical Nutrition August 2011; Vol. 94; No. 2; pp. 618-619 Bjarne Osterud This author cites evidence
More informationINC International Nut & Dried Fruit Council Symposium Nuts in Health and Disease. Granada, 19 th September 2013 Press Kit
INC International Nut & Dried Fruit Council Symposium Nuts in Health and Disease Granada, 19 th September 2013 Press Kit Index Introduction Keynote Speakers Conference Abstract Useful Information The International
More informationJ. M. Hsu and S. T. Ding* Department of Animal Science, National Taiwan University, Taipei 106, Taiwan
British Journal of Nutrition (2003), 90, 507 513 q The Authors 2003 DOI: 10.1079/BJN2003918 Effect of polyunsaturated fatty acids on the expression of transcription factor adipocyte determination and differentiation-dependent
More informationEffect of chronic oral administration of a low dose of captopril on sodium appetite of hypothyroid rats. Influence of aldosterone treatment
Brazilian Sodium appetite Journal of in Medical hypothyroid and rats Biological Research (21) 34: 47-411 ISSN 1-879X Short Communication 47 Effect of chronic oral administration of a low dose of captopril
More informationEFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS
EFFECTORS IMPLICATED IN THE AC1 INHIBITORY EFFECT ON CELL MIGRATION IN PANCREATIC CANCER CELLS VIDYA MEDEPALLI ADVISOR: Maria Eugenia Sabbatini, PhD PHI KAPPA PHI RESEARCH CONFERENCE MARCH 8 th, 2017 Pancreatic
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationOutline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018
Fitting Nutrition into Your Genes, Ph.D., R.D. Human Nutrition The Ohio State University Outline I. History (abridged) of the Study of Genetics and Nutrition II. The Skinny on Fats & Genes III. How Dietary
More informationEvaluation of electromyographic activity and heart rate responses to isometric exercise. The role played by muscular mass and type
Brazilian Electromyography Journal of and Medical heart and rate Biological responses Research to isometric (1999) exercise 32: 115-120 ISSN 0100-879X Short Communication 115 Evaluation of electromyographic
More informationUsing the Organic Acids Test Part 3 Dr. Jeff Moss
Using organic acids to resolve chief complaints and improve quality of life in chronically ill patients Part III Jeffrey Moss, DDS, CNS, DACBN jeffmoss@mossnutrition.com 413-530-08580858 (cell) 1 Summer
More informationVoet Biochemistry 3e John Wiley & Sons, Inc.
* * Voet Biochemistry 3e Lipid Metabolism Part I: (Chap. 25, sec.1-3) Glucose C 6 H 12 O 6 + 6 O 2 6 CO 2 + 6 H 2 O G o = -2823 kj/mol Fats (palmitic acid) C 16 H 32 O 2 + 23 O 2 16 CO 2 + 16 H 2 O G o
More informationButter Composition and Texture from Cows with Different Milk Fatty Acid Compositions Fed Fish Oil or Roasted Soybeans
AS 654 ASL R2302 2008 Butter Composition and Texture from Cows with Different Milk Fatty Acid Compositions Fed Fish Oil or Roasted Soybeans Gerd Bobe Shelly Zimmerman Earl G. Hammond Gene Freeman Paul
More informationFatty acids and cardiovascular health: current evidence and next steps
Fatty acids and cardiovascular health: current evidence and next steps Emanuele Di Angelantonio, MD, PhD Department of Public Health and Primary Care NICE guidelines on fatty acids Eliminate the use of
More informationMultimedia in Biochemistry and Molecular Biology Education
2003 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Printed in U.S.A. Vol. 31, No. 3, pp. 204 208, 2003 Multimedia in Biochemistry and Molecular
More informationDoctor of Philosophy
Regulation of Gene Expression of the 25-Hydroxyvitamin D la-hydroxylase (CYP27BI) Promoter: Study of A Transgenic Mouse Model Ivanka Hendrix School of Molecular and Biomedical Science The University of
More informationEffects of L-Carnitine in the Diet of Weanling Pigs II. Apparent Nutrient Digestibility, Whole Body Composition, and Tissue Accretion
Effects of L-Carnitine in the Diet of Weanling Pigs II. Apparent Nutrient Digestibility, Whole Body Composition, and Tissue Accretion M.J. Rincker, S.D. Carter, R.W. Fent, B.W. Senne, and K.Q. Owen Story
More informationArachidonic acid and PGE 2 regulation of hepatic lipogenic gene expression
Arachidonic acid and PGE 2 regulation of hepatic lipogenic gene expression Michelle K. Mater, Annette P. Thelen, and Donald B. Jump 1 Departments of Physiology and Biochemistry, Michigan State University,
More informationFROM ABSTRACT Patients with rheumatoid arthritis (RA) improve on a vegetarian diet or supplementation with fish oil.
Anti-inflammatory effects of a low arachidonic acid diet and fish oil in patients with rheumatoid arthritis Rheumatol Int (2003) 23: 27 36 Olaf Adam, Corinna Beringer, Thomas Kless, Christa Lemmen, Alexander
More informationEffect of the aerobic capacity on the validity of the anaerobic threshold for determination of the maximal lactate steady state in cycling
Anaerobic Brazilian Journal threshold of Medical and maximal and Biological lactate steady Research state (2004) 37: 1551-1556 ISSN 0100-879X Short Communication 1551 Effect of the aerobic capacity on
More informationEFFECTS OF DIETARY L-CARNITINE SUPPLEMENTATION ON WEANLING PIG PERFORMANCE
EFFECTS OF DIETARY L-CARNITINE SUPPLEMENTATION ON WEANLING PIG PERFORMANCE P. Lyvers-Peffer and J. Odle Summary Weanling pigs (n = 120; 20.9 ± 1.97 d; 6.42 ±.23 kg;) were used to study the effects of L-
More informationStudents will analyze their own nutritional habits and draw conclusions as to how and why they could improve their lives in this area.
Nutrition NUTRITION 4780 Half year - ½ credit Grades 11, 12 Prerequisites: Earth Science and Living Environment Overview of Course This is an introductory nutrition course, designed for the promotion and
More informationHealth benefits of Omega-7 and the potential for Macadamia s.
Health benefits of Omega-7 and the potential for Macadamia s. Bianca Swanepoel & Lize Meades North-West University (Potchefstroom campus) Your logo or logos if you have more than one (edit in Slide Master)
More informationFatty acid breakdown
Fatty acids contain a long hydrocarbon chain and a terminal carboxylate group. Most contain between 14 and 24 carbon atoms. The chains may be saturated or contain double bonds. The complete oxidation of
More informationAmerican Journal of Clinical Nutrition July, 2004;80:204 16
1 Dietary intake of n 3 and n 6 fatty acids and the risk of prostate Cancer American Journal of Clinical Nutrition July, 2004;80:204 16 Michael F Leitzmann, Meir J Stampfer, Dominique S Michaud, Katarina
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationAnalysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
More informationIncreasing Marbling Gene Expression in Beef Cattle with Dietary Lipids
Increasing Marbling Gene Expression in Beef Cattle with Dietary Lipids Stephen B. Smith and Seong Ho Choi Texas A&M University Bradley J. Johnson Texas Tech University, Lubbock RMC 2012 June 18, 2012 Researchers
More informationSteroid Hormones Synthesis
*I ll try my best to incorporate the Slides in this Sheet; you don t need to study the slides if you study this sheet. Steroid Hormones Synthesis - The figure to the right is the Steroid nucleus, it has
More informationDietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationDevelopment of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia
Development of an RNA Interference Therapeutic Targeting Angiopoietin-Like Protein 3 for Treatment of Hyperlipidemia November 12 th, 2018 So C. Wong Arrowhead Pharmaceuticals Inc. Disclosures All authors
More informationFats, Cholesterol, and Hormones
Fats, Cholesterol, and Hormones 1 Types of Fats Lipids biological origin sparingly soluble in water Main classes of lipids Fatty Acids long hydrocarbon chains with a carboxylic acid on one end Triacylglycerols
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationInitial Assessment. Coriander Seed Oil
Initial Assessment Coriander Seed Oil Name of Applicant: Nestec Ltd. Contact person(s): Nigel Baldwin, Intertek Cantox Novel Food Classification: 2.1. Introduction An application for the authorisation
More informationFatty Acids: The Basics
Fatty Acids: The Basics Fatty Acids 101 Fatty acids are necessary nutrients found in our food. The problem is how much we eat of each: The historical ratio of omega-6s to omega- 3s may have been 1-to-1.
More informationChapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
More informationESSENTIAL FATTY ACIDS - RED CELL
Healthscope Functional Pathology 1868 Dandenong Road, Clayton, Victoria 3168, Australia www.functionalpathology.com.au ABN 62 006 823 089 T 1300 55 44 80 F 03 8540 5555 infofp@healthscope.com.au LAB No:
More informationA New Method for the Early Detection of Edible Oil Oxidation
WHITE PAPER Early Detection of Edible Oil Oxidation A New Method for the Early Detection of Edible Oil Oxidation Edible oils are used in a wide range of culinary applications. Oils containing unsaturated
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationEssential Fatty Acid Therapy in Canine Atopic Dermatitis and Cancer
Essential Fatty Acid Therapy in Canine Atopic Dermatitis and Cancer by Robert Hilton BVSc (Hons) MACVSc PO Box 42 Yarrambat 3091 Victoria, Australia rob_hilton@yahoo.com Essential polyunsaturated fatty
More informationLIPIDOMIC PROFILE MEMBRANE Assessment of the lipidomic profile of the erthyrocyte membrane
TEST RESULTS: Cod. ID: 123456 CCV: 2c9 Date: 01/01/2013 Patient: Rossi Mario Rapport de: NatrixLab Via Cavallotti, 16 42122 Reggio Emilia Aut.n. 67 del 26.01.10 Direttore Sanitario Dott. Michele Cataldo
More informationBiosynthesis of Fatty Acids. By Dr.QUTAIBA A. QASIM
Biosynthesis of Fatty Acids By Dr.QUTAIBA A. QASIM Fatty Acids Definition Fatty acids are comprised of hydrocarbon chains terminating with carboxylic acid groups. Fatty acids and their associated derivatives
More informationALTERATIONS IN NEURAL FATTY ACID METABOLISM CAUSED BY VITAMIN E DEFICIENCY
ALTERATIONS IN NEURAL FATTY ACID METABOLISM CAUSED BY VITAMIN E DEFICIENCY Bonnie Buckingham Faculty Mentor: Dr. Maret Traber Linus Pauling Institute HHMI Summer 2011 Outline Significance Background Hypothesis
More informationOmega-3 Fatty Acids and Athletics. Current Sports Medicine Reports July 2007, 6:
Omega-3 Fatty Acids and Athletics 1 Current Sports Medicine Reports July 2007, 6:230 236 Artemis P. Simopoulos, MD The Center for Genetics, Nutrition and Health, Washington, DC, USA EIB exercise-induced
More informationCitation for published version (APA): Minich, D. M. (1999). Essential fatty acid absorption and metabolism Groningen: s.n.
University of Groningen Essential fatty acid absorption and metabolism Minich, Deanna Marie IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationBiomolecules. Biomolecules. Carbohydrates. Biol 219 Lec 3 Fall Polysaccharides. Function: Glucose storage Fig. 2.2
Biomolecules Biomolecules Monomers Polymers Carbohydrates monosaccharides polysaccharides fatty acids triglycerides Proteins amino acids polypeptides Nucleic Acids nucleotides DNA, RNA Carbohydrates Carbohydrates
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationKey Statements. May 13, 2005
Key Statements May 13, 2005 This roundtable was held to provide guidance to the food industry on possible replacement options for hydrogenated fats and trans fatty acids Moderator Dennis Bier, M.D. Professor
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationRoles of Lipids. principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular
Roles of Lipids principal form of stored energy major constituents of cell membranes vitamins messengers intra and extracellular = Oxidation of fatty acids Central energy-yielding pathway in animals. O
More informationBrief Report. n-3 Polyunsaturated Fatty Acids Decrease Anxiety Feelings in a Population of Substance Abusers
Brief Report n-3 Polyunsaturated Fatty Acids Decrease Anxiety Feelings in a Population of Substance Abusers Laure Buydens-Branchey, MD and Marc Branchey, MD Abstract: There is mounting evidence that low
More informationVLC n-3 3 PUFA Intakes In the UK & Opportunities For Increase
VLC n-3 3 PUFA Intakes In the UK & Opportunities For Increase Rachael Gibbs University of Reading UK HUMAN CONSUMPTION VLC n-3 3 polyunsaturates OF FISH Animal Most important Very Long Chain (>2 C) feeds
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationHIGH CONCENTRATION. Concentrate of Omega esters extracted from plant sources in liquid form DIETARY SUPPLEMENT
HIGH CONCENTRATION Concentrate of Omega 3+6+9 esters extracted from plant sources in liquid form DIETARY SUPPLEMENT The need for access to natural nutrition In today s world, it is becoming more and more
More informationANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease
ANSC/NUTR) 618 LIPIDS & LIPID METABOLISM Dietary fat and Cardiovascular Disease I. Investigations in humans relating dietary fat intake to serum cholesterol A. Ansel Keys: the Keys Formula Cholesterol
More informationLinseed oils with different fatty acid patterns in the diet of broiler chickens
Linseed oils with different fatty acid patterns in the diet of broiler chickens J. ZELENKA, D. SCHNEIDEROVÁ, E. MRKVICOVÁ Faculty of Agronomy, Mendel University of Agriculture and Forestry, Brno, Czech
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationFatty Acids and Their Importance for Human Health
bio vis DIAGNOSTIK Fatty Acids and Their Importance for Human Health Summary Dietetic Principles of Fatty Acids and Diagnostic Options at biovis Diagnostik www.biovis.de www.thanyapurahealth.com Fatty
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationsimply the best... Generations of families have known the healthy benefits of Cod Liver Oil. Now, Carlson offers
Generations of families have known the healthy benefits of Cod Liver Oil. Now, Carlson offers simply the best... pure and fresh from the clean arctic waters, far off the coast of Norway. Available in great
More informationLABORATORY REPORT SAMPLE. Summary of Deficient Test Results. Vitamin B12 Pantothenate Biotin Spectrox Immunidex
LABORATORY REPORT Account Number: Name: Jon Doe Gender: Male DOB: 12/28/1984 Requisition Number: Summary of Deficient Test Results Testing determined the following functional deficiencies: Oleic Acid Borderline
More informationGel-assisted formation of giant unilamellar vesicles
Gel-assisted formation of giant unilamellar vesicles Andreas Weinberger 1, Feng-Ching Tsai 2, Gijsje H. Koenderink 2, Thais F. Schmidt 3, Rosângela Itri 4, Wolfgang Meier 5, Tatiana Schmatko 1, André Schröder
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationAntihyperlipidemic Drugs
Antihyperlipidemic Drugs Hyperlipidemias. Hyperlipoproteinemias. Hyperlipemia. Hypercholestrolemia. Direct relationship with acute pancreatitis and atherosclerosis Structure Lipoprotein Particles Types
More informationNutrients Beyond the NRC: Designing the Ideal Ration
Beyond the NRC: Designing the Ideal Ration Meri Stratton Phelps, DVM, MPVM, DACVIM (LAIM), DACVN When it comes to proper nutrition, veterinarians, horse owners and nutritionists all have the same goal
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationBIOH111. o Cell Module o Tissue Module o Skeletal system o Muscle system o Nervous system o Endocrine system o Integumentary system
BIOH111 o Cell Module o Tissue Module o Skeletal system o Muscle system o Nervous system o Endocrine system o Integumentary system Endeavour College of Natural Health endeavour.edu.au 1 Textbook and required/recommended
More informationINSULIN IS A key regulator of nutrient metabolism in
0013-7227/99/$03.00/0 Vol. 140, No. 9 Endocrinology Printed in U.S.A. Copyright 1999 by The Endocrine Society Glucose-Induced Preproinsulin Gene Expression Is Inhibited by the Free Fatty Acid Palmitate*
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationStudy of the main chemical components of Ganoderma lucidum
Study of the main chemical components of Ganoderma lucidum Yasuo Komota et al Tokyo Medical and Dental University [Purpose] As part of the means for exerting quality control on Ganoderma lucidum 50% ethanol
More informationn Promotes a healthy mood 1 n Supports attention and learning 2 n Supports normal memory as we age 3
n Promotes a healthy mood 1 n Supports attention and learning 2 n Supports normal memory as we age 3 n Protects nerve and brain cells from oxidative damage 4 Only with adequate intake of essential fatty
More informationFATS The Facts. compiled by the Nestlé Research Center
FATS The Facts compiled by the Nestlé Research Center Dietary fats are a public health concern Dietary fats are necessary for ensuring optimal health. Recent dietary guidelines focus on fat quality and
More informationSCIENTIFIC OPINION. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA) 2, 3. European Food Safety Authority (EFSA), Parma, Italy
SCIENTIFIC OPINION Scientific Opinion on the substantiation of health claims related to linoleic acid and molecule precursors regulating cell functions (prostaglandins, leucotrienes) (ID 488, 4670), maintenance
More informationProstaglandins And Other Biologically Active Lipids
Prostaglandins And Other Biologically Active Lipids W. M. Grogan, Ph.D. OBJECTIVES After studying the material of this lecture, the student will: 1. Draw the structure of a prostaglandin, name the fatty
More informationFINAL REPORT "ACUTE ORAL TOXICITY IN RATS - FIXED DOSE" F R.1
grupo 4- ',.-,..., ec f::::::~~~yzer \.,\.. FNAL REPORT "ACUTE ORAL TOXCTY N RATS - FXED DOSE" Sponsor Address: of Study: Ecolyzer Protocol: Receipt of Subst. Test: Start of Trial: End of Trial: Emission
More informationResearch shows that the most reliable source of omega-3s is a high-quality fish oil supplement
n Helps the body naturally address occasional eye irritation n Promotes healthy eye moisture for occasional dry eyes n Promotes normal eye function as we age n Contains the fatty acid DHA, found in greatest
More informationOxidative stress in the latissimus dorsi muscle of diabetic rats
Diabetes, Brazilian Journal latissimus of Medical dorsi muscle and Biological and oxidative Research stress (2000) 33: 1363-1368 ISSN 0100-879X Short Communication 1363 Oxidative stress in the latissimus
More informationDAIRY COW RESPONSES TO SOURCES AND AMOUNTS OF SUPPLEMENTAL PROTEIN
DAIRY COW RESPONSES TO SOURCES AND AMOUNTS OF SUPPLEMENTAL PROTEIN Ignacio R. Ipharraguerre and Jimmy H. Clark TAKE HOME MESSAGES Milk production per unit of crude protein (CP) in the dietary dry matter
More informationPeroxisome Proliferator-activated Receptor Controls the Hepatic CYP4A Induction Adaptive Response to Starvation and Diabetes*
THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 47, Issue of November 20, pp. 31581 31589, 1998 1998 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. Peroxisome
More informationDo pigs benefit from omega-3 fatty acids?
Do pigs benefit from omega-3 fatty acids? Denise Beaulieu Assistant Professor Animal & Poultry Science Introduction What are omega-3 fatty acids? Outline Why would we consider augmenting the diet of growing
More informationyzer :f::::::\\ \\.~::::::: FINAL REPORT "ACUTE ORAL TOXICITY IN RATS - FIXED DOSE" F R.1 Unreported
grupo # yzer, ec. :f::::::\\ \\.~:::::::..... FNAL REPORT "ACUTE ORAL TOXCTY N RATS - FXED DOSE" Sponsor of Study: Address: Ecolyzer Protocol: Receipt of Subst. Test: Start of Trial: End of Trial: Emission
More informationThe Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies. By Logan Jenney & Lindsey Poynter
The Effect of Replacing Coconut Oil for Shortening in Chocolate Chip Cookies By Logan Jenney & Lindsey Poynter Abstract: Chocolate chip cookies are a popular baked good loved by consumers for several years
More information