Department of Laboratory Animal Research Support Team, Yeungnam University Hospital, Daegu, Korea

Transcription

1 Offiil Journl of Koren Continene Soiety / Koren Soiety of Urologil Reserh / The Koren Children s Continene nd Enuresis Soiety / The Koren Assoition of Urogenitl Trt Infetion nd Inflmmtion pissn eissn einj.org Moile We NEUROUROLOGY JOURNAL INTERNATIONAL Originl Artile pissn eissn Comprison of 5 Different Rt Models to Estlish Stndrd Animl Model for Reserh Into Interstitil Cystitis Phil Hyun Song 1, *, So Young Chun 2, *, Je-Wook Chung 3, Yeon Yong Kim 2, Hyo Jung Lee 2, Jun Nyung Lee 3, Yun-Sok H 3, Eun Sng Yoo 3, Te Gyun Kwon 3, Jeongshik Kim 4, De Hwn Kim 5, Bum Soo Kim 3 1 Deprtment of Urology, Yeungnm University College of Mediine, Degu, Kore 2 BioMedil Reserh Institute, Kyungpook Ntionl University Hospitl, Degu, Kore 3 Deprtment of Urology, Kyungpook Ntionl University Shool of Mediine, Degu, Kore 4 Deprtment of Pthology, Centrl Hospitl, Ulsn, Kore 5 Deprtment of Lortory Animl Reserh Support Tem, Yeungnm University Hospitl, Degu, Kore Purpose: We evluted 5 different rt models using different gents in order to estlish stndrd niml model for interstitil ystitis (IC) in terms of the funtionl nd pthologi hrteristis of the ldder. Methods: Five IC models were generted in 8-week-old femle Sprgue-Dwley rts vi trnsurethrl instilltion of.1m hydrogen hloride (HCl) or 3% eti id (), intrperitonel injetion of ylophosphmide () or lipopolyshride (), or suutneous injetion of uroplkin II (2). After generting the IC models, onsious ystometry ws performed on dys 3, 7, nd 14. All rts were euthnized on dy 14 nd their ldders were otined for histologil nd pro-inflmmtory-relted gene expression nlysis. Results: In the ystometri nlysis, ll experimentl groups showed signifintly deresed interontrtion intervls ompred with the ontrol group on dy 3, ut only the nd groups mintined signifintly shorter interontrtion intervls thn the ontrol group on dy 14. The histologil nlysis reveled tht res with severe urothelil erosion (HCl,, nd ) nd hyperplsi ( nd ), prtiulrly in the -treted ldders, showed mrkedly inresed infiltrtion of toluidine lue-stined mst ells nd inresed tissue firosis. In ddition, signifintly elevted expression of interleukin- 1, interleukin-6, myeloperoxidse, monoyte hemotti protein 1, nd Toll-like reeptors 2 nd 4 ws oserved in the group ompred to the other groups. Conlusions: Among the 5 different gents, the injetion of generted the most effetive IC niml model, showing onsequent urothelil rrier loss, inflmmtory retion, tissue firosis stimultion, nd persistent hypertive ldder. Keywords: Cystitis, Interstitil; Models, Animl; Rts; Immuniztion Grnt/Fund Support: This work ws supported y Ntionl Reserh Foundtion (NRF) of Kore grnt funded y the Kore government (MSIP) (NRF-215R1C1A1A15359). Additionl funding ws provided y the Ministry of Edution (215R1D1A3A32378) nd Ministry of Siene, ICT & Future Plnning under grnts (214R1A1A34946), (NRF-214M3A9D334164), nd (216R1C1B11118). Reserh Ethis: All rt protools were prepproved y the institutionl niml ethis ommittee of Yeungnm University College of Mediine (YUMC ). Conflit of Interest: No potentil onflit of interest relevnt to this rtile ws reported. HIGHLIGHTS - Injetion of uroplkin II generted the effetive interstitil ystitis niml model. - Uroplkin-indued interstitil ystitis rt model mintins ldder overtivity nd shows inresed expression of inflmmtory ftors nd firosis. Corresponding uthor: Bum Soo Kim This is n Open Aess rtile distriuted under the terms of the Cretive Deprtment of Urology, Kyungpook Ntionl University Hospitl, 13 Dongdeokro, Jung-gu, Degu 41944, Kore E-mil: uroks@knu..kr / Tel: / Fx: Commons Attriution Non-Commeril Liense ( ommons.org/lienses/y-n/4./) whih permits unrestrited non-ommeril use, distriution, nd reprodution in ny medium, provided the originl work is properly ited. Sumitted: April 23, 217 / Aepted fter revision: July 1, 217 * Phil Hyun Song nd So Young Chun ontriuted eqully to this study s o-first uthors. Copyright 217 Koren Continene Soiety

2 INTRODUCTION Interstitil ystitis (IC) is hroni inflmmtory ldder disorder hrterized y pelvi pin nd urinry symptoms, suh s frequeny, urgeny, nd noturi, without teril infetion or identifile pthology [1,2]. Owing to these vrious symptoms, ptients with IC typilly experiene sleep dysfuntion, hroni stress, nxiety, depression, nd sexul dysfuntion [3]. Epidemiologil studies hve reveled tht IC primrily ffets women, ut this disese n lso our in men nd dolesents, with femleto-mle rtio of 5:1 [4,5]. The etiology of IC is not ompletely understood; inflmmtory, neurogeni, utoimmune, vsulr, nd lymphti disorders hve een suggested s potentil uses. Further, loss of the glyosminoglyn lyer from superfiil urothelil ells nd the presene of toxi sustnes in the urine hve een proposed s pthophysiologil mehnisms [6]. This poor understnding of the pthophysiology of IC mkes it diffiult to develop effetive tretment modlities. Although orl mediines suh s pentosn polysulfte sodium nd mitriptyline, hydrodistention, nd intrvesil instilltion re urrently used in linil prtie, no stndrd tretment method yet exists for IC. Reently, severl studies hve proposed new potentil therpeuti options, suh s stem ell therpy, for IC [7,8]. In ddition, mny in vivo studies of IC hve een performed. To onfirm the effiy nd sfety of new tretment modlities, it is neessry to estlish proper niml model for in vivo evlution. Although more thn 2 existing niml models of IC hve een evluted, there is no stndrd niml model of IC with fetures similr to those of the disese in humns. Most niml models hve een generted y induing ldder inflmmtion with or without epithelil dmge vi the intrvesil instilltion of hemil toxins or irritnts or y the systemi injetion of hemil gents, viruses, or ntigens [8-16]. Although mny niml models generted y vrious methods hve een used to study IC over the lst severl dedes, reent studies hve ttempted to estlish more pproprite IC niml model, suggesting severl potentil ndidtes with hrteristis similr to those of the humn disese [8,9,14,16,17]. Although these niml models show severl phenotypes of IC, suh s frequent voiding, ltertion of ldder ells, nd higher expression of pro-inflmmtory genes, it hs not een onfirmed whether these hrteristis persist for long periods without nturl heling or whih models re the most similr to the humn disese. Therefore, we nlyzed nd ompred the 5 most ommonly used nd promising rt models to determine the optiml IC niml model in terms of the funtionl nd pthologi hrteristis of the ldder. MATERIALS AND METHODS Genertion of IC Rt Models All rt protools were prepproved y the institutionl niml ethis ommittee of Yeungnm University College of Mediine (YUMC ). To indue the IC models, thirty 8-week-old femle Sprgue-Dwley rts were sujeted to 5 different gents: hydrogen hloride (HCl), eti id (), ylophosphmide (), lipopolyshride (), nd uroplkin () II. Eh group inluded 5 rts, nd the remining 5 rts underwent shm opertion to onstitute the ontrol () group. All rts were nesthetized y the intrmusulr injetion of 16 mg/kg of Rompun nd.4 mg/kg of Zoletil, nd n dominl inision ws mde. The ldder ws exposed nd smll inision t the ldder dome re ws mde. Next, one of the ends of polyethylene-5 tue (Ntsume Seiskusho Co., Tokyo, Jpn) ws pled inside the ldder, nd the ldder ws losed to e wter-tight. The ontrlterl end of the polyethylene tue ws pssed through the suutneous lyer of the left flnk re nd pulled out t the posterior nek re. After onfirming tht the tue ws not ostruted nd tht urine drined well, without lekge, through the ldder inision site, the polyethylene-5 tue ws fixed nd the dominl wound ws losed. To prevent proedure-relted infetions, n intrmusulr injetion of 15 mg/kg of efprozil ws dministered, nd the nimls were oserved in wrm ges until they woke up ompletely. Three dys fter tue plement, IC rt models were indued. In the HCl group,.1m HCl (Sigm-Aldrih, St. Louis, MO, USA) ws slowly instilled vi the urethr, using 26-G ngiotheter (Sewoon Medil Co., Cheonn, Kore), followed y neutrliztion nd wshing with sline [8]. In the group, 5 μl of 3% (Sigm-Aldrih) ws trnsurethrlly infused [17]. In the group, 8 mg/kg of (Sigm-Aldrih) in sterile norml sline (.9% NCl) ws dministered intrperitonelly, nd the injetions were given 4 times every other dy [16]. In the group, 1 ml/kg of (Sigm-Aldrih) dissolved in sterile norml sline ws dministered vi intrperitonel injetion [14]. In the group, 2 μl of n emulsion of equl volumes of phosphte-uffered sline (PBS) nd glyerol with 2 μg of 2 (MyBiosoure, Sn Diego, CA, USA), whih is reominnt protein produed y Esherihi oli vi mouse se sequening, ws injeted suutneously into the domi

3 nl flnk re of the rts [9]. For the group, PBS ws instilled trnsurethrlly using n ngiotheter. The nimls were riefly oserved dily for signs of pin (norml ehvior or hunhed pperne). Cystometry After generting the IC models in eh group, onsious ystometry ws performed on dys 3, 7, nd 14. Rts were pled under restrition in speilly designed ge without nesthesi, nd the exposed polyethylene-5 tue ws onneted to pressure trnsduer. Sterile wrm sline ws infused t rte of 4 μl/min vi syringe pump for 3 minutes. Intrvesil pressure nd interontrtion intervls (or voiding intervls) were mesured nd nlyzed using the Power L system (AD Instruments Pty., Ltd., Bell Vist, NSW, Austrli). Histologil Anlysis For the histologil nlysis, hlf of eh ldder ws fixed in 4% prformldehyde 14 dys fter generting the niml models (the 5 rts in eh group were euthnized). The prffin-emedded smples were ut into 5-μm setions for hemtoxylin nd eosin (H&E), toluidine lue, nd Msson trihrome stining for histology nd nlyses of mst-ell infiltrtion nd firosis, respetively. For toluidine lue stining, ldder setions were wshed with xylene to remove the prffin, nd then the slides were treted with n ethnol series. The slides were stined with toluidine lue for 4 minutes, treted with n ethnol series, nd then mounted. Mst ells were mesured per squre millimeter, nd the lmin propri ws used s the oservtionl histologil position. For the Msson trihrome stining, deprffinized nd rehydrted setions were refixed in Bouin solution, stined in Weigert iron hemtoxylin working solution nd Bierih srlet-id fuhsin solution, nd differentited in phosphomolydi-phosphotungsti id solution until the ollgen ws red. The setions were trnsferred to niline lue solution nd differentited in 1% solution. The ollgen fiers were stined s lue olor. Gene Expression Anlysis The remining hlf of eh ldder ws prepred for rel-time polymerse hin retion (PCR) nlysis. Totl RNA ws isolted using the RNesy Mini Kit (QIAGEN, Vleni, CA, USA) nd omplementry DNA ws prepred using Reverse- Trnsription Regents (Applied Biosystems, Crlsd, CA, USA) ording to the mnufturer s instrutions. The following primers were used: glyerldehyde 3-phosphte dehydrogense (GAPDH): sense TGTGTCCGTCGTGGATCTGA nd ntisense CCTGCTTCACCACCTTCTTGA; interferon gmm (IFNG): sense CTCGCTTGGCGATGCTCA nd ntisense TCGTCGCACCTGATCACT; interleukin-1 (IL1B): sense CGTCATCATCCCACGAGTCA nd ntisense GAT- GAGGACCCGCACCTT; IL6: sense AGTCTCCTCTCC- GGACTTGT nd ntisense AGAGACTTCCAGCCAGTTGC; myeloperoxidse (MPO): sense CGCTTTGGTTCTGGC- GAT nd ntisense ACCTACCCCAGTACCGATCC; monoyte hemotti protein 1 (MCP-1): sense CAGCCGACT- CATTGGGATCA nd ntisense TAGCATCCACGTGCT- GTCTC; Toll-like reeptor 2 (TLR2): sense TGACGGCCTG- TATCCCTGTA nd ntisense CCCTGCTCTTTCTCACAG- CA; TLR4: sense CCAGAGCGGCTACTCAGA nd ntisense TCCACGAGCCGGAGTT; nd IL17A: sense AGAGTCCAGGGTGGTGGA nd ntisense CACGC- CGAGGCCTC. PCR ws rried out in rel-time PCR mhine nd nlyzed using 73 System SDS Softwre (Applied Biosystems). The onditions for PCR using the SYBR Green PCR Mster Mix (Bio-Rd, Herules, CA, USA) were 95 C for 1 minutes, followed y 45 yles of 95 C for 1 seonds, 58 C for 5 seonds, nd 72 C for 2 seonds. To nlyze the reltive hnges in gene expression, the Ct vlue for the trget gene ws normlized to its endogenous ontrol nd trnsformed to reltive gene expression vlue using the 2 ΔΔCt method. Sttistil Anlysis The dt were presented s the men±stndrd devition. Differenes in the ystometry, mst ell ount, nd rel-time quntittive PCR results were nlyzed y 1-wy nlysis of vrine (ANOVA). A P-vlue of <.5 ws onsidered to indite sttistil signifine. If the vlue ws found to e signifint y ANOVA, the Tukey post ho test ws onduted. RESULTS During the whole period fter generting the IC model, none of the nimls showed ny signs of severe pin, suh s norml ehvior or hunhed pperne. To ompre ldder funtion, suh s voiding frequeny nd nonvoiding ldder ontrtions, we performed onsious ystometri nlysis in ll niml models, inluding the group. In the ystometri nlysis, the intervls etween norml voiding events were mesured. On dy 3, the men interontrtion intervls of ll 165

4 experimentl groups were signifintly shorter thn tht of the group; 72.3 ±17.5, 57.3 ±1.1, 65. ±13.5, 87.7 ±9.8, 5.±5.2, nd 161.3±8.8 seonds in the HCl,,,,, nd groups, respetively (P=.3). However, on dy 7, the men interontrtion intervls of ll groups were prolonged; in prtiulr, those of the (117.7 ±4.3 seonds) nd (146.3±15.1 seonds) groups were signifintly longer thn those of the HCl (83.3 ±18.3 seonds) nd (84.3 ±11. seonds) groups (P =.12). Additionlly, on dy 14, the (67.6 ±6.9 seonds) nd (8.3±1.1 seonds) groups showed signifintly shorter voiding intervls thn the group (141.7±16.7 seonds) or the other experimentl groups (, 117.3±9.7 seonds;, ±17.2 seonds; nd HCl, ±21.6 seonds) (P =.9). Irregulr nonvoiding ldder ontrtions were only oserved in the nd HCl groups on dys 3, 7, nd 14 (Fig. 1). In the H&E histologil exmintion (Fig. 2A), the ldders were intt nd onsisted of 3 5 lyers (estimted y nuleus stining with hemtoxylin): the regulr trnsitionl epithelium, the norml sement memrne, the lmin propri, nd the smooth musle. Although the infiltrtion of inflmmtory ells ws rrely oserved, the experimentl groups showed signifint intrepithelil inflmmtion with severe dmge to the ldder tissues. The HCl,, nd groups showed urothelil thinning nd ellulr loss or erosion, while the nd groups showed inresed numers of urothelil ells nd normlly thik re-epitheliliztion (urothelil hyperplsi) fter denudtion. The numer of ellulr lyers of the reepithelilized groups inresed from 5 to 1. Mst ell infiltrtion ws oserved y toluidine lue stining (Fig. 2B). In the ldders, mst ells were rrely loted in the lmin propri, the men numer of oserved mst ells ws 31±6/mm 2, nd the ells ontined purple grnules. The experimentl groups showed greter inflmmtory response (mild to modertely dense mixed lymphoyti infiltrtion with mst ells nd eosinophils) ompred to the group euse of the loss of urothelil rrier funtion. The numers of mst ells in the lmin propri in the HCl,,,, nd groups ws 96.5 ±1.5, 39.5 ±1.5, 16.5 ±23.5, 12. ±11, nd ±13.5/ mm 2, respetively (Fig. 3). The,,, nd HCl groups showed signifintly greter mst ell infiltrtion thn the group (P<.1), with the lrgest numer of mst ells oserved in the group. Loss of the urothelil rrier nd the inflmmtory retion indued tissue firosis in the sement memrne, lmin propri, nd smooth musle lyer. Msson trihrome stining reveled modest inrese in ldder tissue firosis in mny of the experimentl groups in omprison to the group; the group showed roder nd more severe firoti density, s indited y lue oloring, thn the other experimentl groups (Fig. 2C). To evlute the inflmmtory retions, the expression of pro-inflmmtory genes ws nlyzed (Fig. 4). The expression of the IFNG, IL1B, IL6, MPO, MCP1, TLR2, TLR4, nd IL17A genes ws signifintly higher in the experimentl groups thn in the group. The group showed the highest expression of IL1B, IL-6, MPO, MCP1, nd TLR2, wheres TLR4 nd IL17A were the most highly expressed in the group nd IFNG ws the most highly expressed in the group Men interontrtion intervls (se) Dy 3 Dy 7 Dy 14 Dy 3 (se) Dy 7 (se) Dy 14 (se) Ctrl P-vlue 161.3± ± ± ± ±9.8 5.±5.2.3* 171.7± ± ± ± ± ±11..12* 141.7± ± ± ± ± ±6.9.9* Fig. 1. Comprison of the men interontrtion intervls mesured y onsious ystometri nlysis. The men interontrtion intervls of ll experimentl groups were signifintly shorter thn tht of the group t dy 3, nd the nd groups mintined shorter voiding intervls until dy 14. Vlues re presented s men±stndrd devition., ontrol; HCl, hydrogen hloride;, eti id;, ylophosphmide;, lipopolyshride;, uroplkin. The different letters on top of the rs (,, nd ) men signifint differenes etween the eh group t P<.5. *Sttistil nlysis ws performed for ll groups y nlysis of vrine, Tukey post ho test

5 2 2 2 A B C Fig. 2. Histologil nlysis of ldder tissue. (A) In H&E stining, the HCl,, nd groups showed urothelil erosions nd the nd groups showed urothelil hyperplsi (rrow). (B) The group showed the most severe mst ell infiltrtion (rrow) in the sumuosl onnetive tissue nd musle lyer. (C) The group showed the most severe umultion of firous tissue in the sumuos lyer (rrow) y Msson trihrome stining. Sle r, 1 μm., ontrol; HCl, hydrogen hloride;, eti id;, ylophosphmide;, lipopolyshride;, uroplkin

6 DISCUSSION The pthophysiology of IC is omplex nd not ompletely understood. This mkes it diffiult to develop definitive therpeuti modlities nd to estlish stndrd niml model for trnsltionl reserh. Current pprohes hve mostly emphsized merging linil prtie nd trnsltionl reserh; therefore, it is importnt to estlish proper trnsltionl models similr to the disese in humns. Approximtely 2 niml models with some similr hrteristis to the IC phenotype hve een generted over the pst severl dedes [15,18]. From 198 to 2, Mst ells (N/mm 2 ) Fig. 3. Comprison of the numer of mst ells. The numers of mst ells were quntified in the ldder setions (mm 2 ), nd the highest numer of mst ells ws oserved in the group., ontrol; HCl, hydrogen hloride;, eti id;, ylophosphmide;, lipopolyshride;, uroplkin. The different letters (,, nd ) on top of the rs men signifint differenes etween the eh group t P<.5. the models were typilly prepred y induing inflmmtory onditions in the ldder y intrvesil instilltion of hemil irritnts, suh s etone, rolein, id, turpentine, mustrd oil, or roton oil [19-22]. In the 2s, IC niml models were ommonly generted y injetion of teril, systemi dministrtion of, pseudories virus infetion, or systemi indution of utoimmunity [9,14,16,23,24]. Although these mterils ontriuted to the estlishment of IC niml models, eh gent hs severl limittions. Most intrvesil gents n nonseletively dmge the ldder muos nd glyosminoglyn lyer through vrious mehnisms tht my not e relevnt for humn IC [18]. Injetion of pseudories virus my use ontrtile ldder within 5 dys of virus injetion, nd therefore this model does not urtely reflet humn IC [24]. To generte suitle niml model, it is neessry to understnd the pthophysiology of the trget disese. Although the ext pthogenesis of IC remins unler, severl mehnisms, suh s n inresed numer of mst ells in the ldder, loss of the glyosminoglyn lyer in the ldder muos, nd utoimmunity, hve een suggested s ndidtes. Bsed on these theories, severl IC niml models with phenotypes similr to tht of the humn disese hve een generted. Some hve een reently generted y intrvesil instilltion of HCl or, injetion of or, or immuniztion with, onsidering the onveniene of generting nd mintining these niml models. The niml model generted y intrvesil instilltion using HCl showed most of the pthophysiologil , IFNγ, IL-1 d e IL-6 MPO 1,e ,, d,d 3 2 MCP1 12, 9, 6 3 TLR2 TLR4,,d 12, 12, 9, 9 6 6,d 3 3 IL-17α , d e 3 Fig. 4. Inflmmtory gene expression nlysis y rel-time polymerse hin retion. IL1B, IL6, MPO, MCP1, nd TLR2 showed the gretest expression in the group, while the group showed the highest expression of TLR4 nd IL17A nd the group showed the highest expression of IFNG., ontrol; HCl, hydrogen hloride;, eti id;, ylophosphmide;, lipopolyshride;, uroplkin; IL, interleukin; MPO, myeloperoxidse; MCP1, monoyte hemotti protein 1; TLR, Toll-like reeptor; IFN, interferon. The different letters on top of the rs (,, nd ) men signifint differenes etween the eh group t P<

7 mnifesttions oserved in humn IC ptients, suh s epithelil denudtion, n norml inrese in inflmmtion, neurl ell tivtion, nd ngiogenesis [8]. The -indued IC rodent model showed hnges in the expression of two proteins, 3 nd zonul oludens type I, whih re similr to hnges tht re found onsistently in ptients with IC [17]. Administrtion of n indue n inrese in pro-inflmmtory ytokine expression nd in the numer of mst ells in the ldder tissue of rodent niml models without signs of mssive inflmmtory infiltrtion, tissue hemorrhge, or urothelil dmge [16]. Systemi injetion or intrvesil instilltion of ws lso reported to indue n inflmmtory response medited y the tivtion of mst ells, the prodution of ytokines, nd the reruitment of leukoytes to the ldder muosl surfe, similr to wht is oserved in humn IC ptients [14]. Mie immunized with displyed signifintly inresed urinry frequeny, extensive perivsulr infiltrtion of inflmmtory response ells, nd elevted gene expression levels of inflmmtory ytokines in ldder tissue [9,24]. In our study, ll experimentl groups showed higher expression of severl inflmmtory ftors ompred to the group in the PCR nlysis, nd inresed infiltrtion of inflmmtory ells suh s lymphoytes nd mst ells in the histologil nlysis. In ddition, ldder hypertivity ws lso oserved in the erly period (dy 3) in the ystometri nlysis of ll groups. However, ldder overtivity did not persist for 1 or 2 weeks in the,, nd HCl groups, whih mens tht ldder funtion n e spontneously restored in niml models generted using these gents. H&E nd toluidine lue stining lso showed different results in terms of the numer of infiltrted inflmmtory ells nd the thikness of the sumuos lyer mong the experimentl groups. The gretest infiltrtion of mst ells nd the thikest sumuos lyer were oserved in the group. The most extensive firoti hnges were oserved in the group in Msson trihrome stining. Moreover, in the PCR nlysis, the group showed the highest expression of most inflmmtory ftors, suh s IL1B, IL6, MPO, MCP1, nd TLR2. For the IC niml model, it is importnt to mintin funtionl ldder overtivity nd inflmmtory onditions in the ldder for long period of time to onfirm the long-term therpeuti effet of new tretment modlities, nd to lrify whether ldder overtivity is resolved y tretment or spontneously. Tken together, mong the IC rt models prepred using 5 different gents, the IC model generted y n e regrded s the most fesile model for IC-relted trnsltionl reserh, nd utoimmunity should e further investigted s promising mehnism of this disese. An inresing numer of reports hve desried the reltionship etween IC nd utoimmune diseses, suh s rheumtoid rthritis, lupus erythemtosis, Sjogren syndrome, nd ulertive olitis, s well s inresed utontiodies in the serum of IC ptients [25-28]. The s (1, 2, nd 3) omprise fmily of integrl memrne proteins of the urothelium nd re highly expressed in ldder tissue [9]. It hs een demonstrted tht immuniztion with 2 indued ldderspeifi utoimmune response nd suffiient ldder inflmmtion in mie [9]. These mie displyed signifint evidene of frequent voiding nd deresed urine output per voiding episode. However, the niml model generted y 2 did not show hroni pin, one of the min symptoms of IC. Additionlly, more reent study demonstrted tht immuniztion with 3A indued ll predominnt IC phenotypi hrteristis, inluding inresed pelvi pin responses to stimultion with von Frey filments [24]. Considering these results, 3A n e used to generte n IC niml model. We used 2 to generte n utoimmune IC model in this study in order to mintin the generted niml models for t lest 2 weeks to ompre long-term ystometri outomes. Persistent hroni pin n use unwnted stressful onditions in niml models, nd it is lso not pproprite to expose the nimls to hroni pin for long time with respet to the ethis of niml studies. Although the results of this study suggest tht n IC rt model generted y immuniztion using is fesile for ICrelted reserh, suh model my not exhiit ll the phenotypes of IC euse there re severl proposls regrding the etiopthogenesis of IC, espeilly in light of the vrious sutypes of IC, suh s ulertive nd nonulertive IC. However, this niml model is suitle for IC-relted reserh into the ommon phenotypes of IC, suh s ldder overtivity, inflmmtory hnge of ldder muos, higher expression of inflmmtory genes in ldder tissue, nd the reltively long persistene of these phenotypes. Moreover, our results support utoimmunity s one of the min spets of the pthogenesis of IC, nd further studies of the reltionship etween utoimmunity nd IC will provide insight into the pthophysiology of IC nd filitte the development of new therpeuti modlities. In onlusion, this study demonstrted tht injetion of generted the most effetive IC niml model mong the 5 most ommonly used gents. This model mintined ldder overtivity nd showed inresed expression of inflmmtory 169

8 ftors nd firosis. Future studies of the reltionship etween utoimmunity nd the pthophysiology of IC my inrese our understnding of the pthogenesis of IC nd filitte the development of definitive therpeuti strtegies. REFERENCES 1. Bogrt LM, Berry SH, Clemens JQ. Symptoms of interstitil ystitis, pinful ldder syndrome nd similr diseses in women: systemti review. J Urol 27;177: Chnellor MB, Yoshimur N. Tretment of interstitil ystitis. Urology 24;63(3 Suppl 1): Kim A, Shin DM, Choo MS. Stem Cell Therpy for interstitil ystitis/ldder pin syndrome. Curr Urol Rep 216;17:1. 4. Clemens JQ, Meenn RT, O Keeffe Rosetti MC, Brown SO, Go SY, Clhoun EA. Prevlene of interstitil ystitis symptoms in mnged re popultion. J Urol 25;174: Se J, Teihmn JM. Peditri pinful ldder syndrome/interstitil ystitis: dignosis nd tretment. Drugs 29;69: Snd PK. Proposed pthogenesis of pinful ldder syndrome/interstitil ystitis. J Reprod Med 26;51(3 Suppl): Admowiz J, Pokrywzyńsk M, Drew T. Conditioned medium derived from mesenhyml stem ells ulture s intrvesil therpy for ystitis interstitils. Med Hypotheses 214;82: Song M, Lim J, Yu HY, Prk J, Chun JY, Jeong J, et l. mesenhyml stem ell therpy llevites interstitil ystitis y tivting Wnt signling pthwy. Stem Cells Dev 215;24: Altunts CZ, Dneshgri F, Sklr C, Goksoy E, Gulen MF, Kvrn M, et l. Autoimmunity to uroplkin II uses ystitis in mie: novel model of interstitil ystitis. Eur Urol 212;61: Birder LA, Wolf-Johnston A, Buffington CA, Roppolo JR, de Grot WC, Kni AJ. Altered induile nitri oxide synthse expression nd nitri oxide prodution in the ldder of ts with feline interstitil ystitis. J Urol 25;173: Bon K, Lihtensteiger CA, Wilson SG, Mogil J. Chrteriztion of ylophosphmide ystitis, model of viserl nd referred pin, in the mouse: speies nd strin differenes. J Urol 23;17: Frser MO, Chung YC, Lvelle JP, Yoshimur N, de Grot WC, Chnellor MB. A relile, nondestrutive niml model for interstitil ystitis: intrvesil low-dose protmine sulfte omined with physiologil onentrtions of potssium hloride. Urology 21;57(6 Suppl 1): Kirimoto T, Nkno K, Irimur K, Hyshi Y, Mtsuur N, Kiniw M, et l. Benefiil effets of supltst tosilte (IPD-1151T) in rt ystitis model indued y intrvesil hydrohlori id. BJU Int 27;1: Tmro S, Csu MA, Mstinu A, Lzzri P. Evlution of seletive nninoid CB(1) nd CB(2) reeptor gonists in mouse model of lipopolyshride-indued interstitil ystitis. Eur J Phrmol 214;729: Westropp JL, Buffington CA. In vivo models of interstitil ystitis. J Urol 22;167(2 Pt 1): Goluev AV, Zhdnov AV, Mllel G, Dinn TG, Cryn JF. The mouse ylophosphmide model of ldder pin syndrome: tissue hrteriztion, immune profiling, nd reltionship to metotropi glutmte reeptors. Physiol Rep 214;2:e Key S, Leitzell S, Ohrzin A, Clements G, Zhn M, Johnson D. A mouse model for interstitil ystitis/pinful ldder syndrome sed on APF inhiition of ldder epithelil repir: pilot study. BMC Urol 212;12: Bjorling DE, Wng ZY, Bushmn W. Models of inflmmtion of the lower urinry trt. Neurourol Urodyn 211;3: Elgely SA, Allm ME, Wlzk MP Jr, Oselinsky D, Gillies C, Ymse H. Urinry neutrophil hemotti ftors in interstitil ystitis ptients nd rit model of ldder inflmmtion. J Urol 1992;147: Kto K, Kitd S, Longhurst PA, Wein AJ, Levin RM. Time-ourse of ltertions of ldder funtion following etone-indued ystitis. J Urol 199;144: MMhon SB, Ael C. A model for the study of viserl pin sttes: hroni inflmmtion of the hroni deererte rt urinry ldder y irritnt hemils. Pin 1987;28: Skt T, Smith RA, Grlnd EM, Cohen SM. Rt urinry ldder epithelil lesions indued y rolein. J Environ Pthol Toxiol Onol 1989;9: Jsmin L, Jnni G, Ohr PT, Rkin SD. CNS indued neurogeni ystitis is ssoited with ldder mst ell degrnultion in the rt. J Urol 2;164(3 Pt 1): Izgi K, Altunts CZ, Bier F, Ozer A, Sklr C, Li X, et l. Uroplkin peptide-speifi utoimmunity initites interstitil ystitis/ pinful ldder syndrome in mie. PLoS One 213;8:e Key S, Zhng CO, Trifillis AL, Heel JR, Jos SC, Wrren JW. Urine utontiodies in interstitil ystitis. J Urol 1997;157: Ohs RL. Autontiodies nd interstitil ystitis. Clin L Med 1997;17: vn de Merwe JP. Interstitil ystitis nd systemi utoimmune diseses. Nt Clin Prt Urol 27;4: Lorenzo Gómez MF, Gómez Cstro S. Physiopthologi reltionship etween interstitil ystitis nd rheumti, utoimmune, nd hroni inflmmtory diseses. Arh Esp Urol 24;57: