Effects of exercise training on hepatic steatosis in high fat diet-induced obese mice
|
|
- Wilfrid Cox
- 5 years ago
- Views:
Transcription
1 Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University
2 Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid umultion in the sene of signifint lohol onsumption. (Soure: Wikipedi, the free enylopedi)
3 NAFLD Spetrum of Disese Stetosis Stetoheptitis (NASH) NASH with Firosis Cirrhosis
4 By 2020
5 Risk Ftors for NAFLD Oesity Type 2 DM Dyslipidemi Metoli syndrome Insulin Resistne (IR) (modified from J Clin Gstroenterol., 40: S1, 2006) NAFLD is hepti mnifesttion of insulin resistne
6 Current Guidelines for NAFLD Dietry restrition plus inresed physil tivity shows ler hepti enefits when weight loss pproximtely 3%-10% of ody weight is hieved (Sreenivs et l., 2006 J Gstroenterol Heptol; Lrson-Meyer et l., 2006 Dietes Cre). The poor sustinility of weight loss hllenges the urrent therpeuti fous on weight loss nd highlights the need for lterntive strtegies for NAFLD mngement. Epidemiologi dt show n independent reltionship etween ftty liver, physil tivity nd physil fitness (Churh et l., 2006 Gstroenterology; MMilln et l., 2007 Appy Physiol Nutr Met). A growing ody of longitudinl reserh demonstrtes tht inresed physil tivity per se signifintly redues hepti stetosis nd serum minotrnsferse in individuls with NAFLD, independent of weight loss (St George et l., 2009 Heptology; Kntrtzis et l., 2009 Gut).
7 Aims of the Study To study the role(s) of physil tivity per se s therpeuti mens ginst oesity-indued NAFLD. To delinete the mehnisti insights to explin the hepti enefits of inresed physil tivity.
8 Desription of Study Design Stndrd Chow (SC, n=20) SC+SED (n=10) C57BL/6 mie t 5-wk (N=60) HFD + SED (n=10) High-Ft Diet (HFD, n=40) 60% high-ft diet HFD+HIT (n=10) HFD + MIT (n=10) Adption First 8 weeks Seond 8 weeks **SED: sedentry; MIT: moderte-intensity trining; HIT: high-intensity trining
9 Exerise Trining Protool A. High-intensity trining (HIT) Wrm-up 17m/min Tredmill running Cool-down 8m/min 10m/min 5 min 1 min 2 min 1-yle Totl exerise time: 46 min Totl distne: 524 m 12 yles 8m/min 5 min B. Moderte-intensity trining (MIT) 8m/min 10m/min 8m/min 5 min 5 min 44 min Totl exerise time: 54 min Totl distne: 524 m Tredmill running
10 Primry Mesurements of the Study - Body mss - Immunostining (i.e., Oil-Red O, H & E, Trihome stining) - Gluose tolerne test (GTT) nd insulin tolerne test (ITT) - Blood lipoprotein lipids - Asprte minotrnsferse (AST) nd lnine minotrnsferse (ALT) - Adiponetins in serum nd dipose tissue - Rel time-pcr for mrnas nd Western lot for proteins
11 RESULTS
12 After the initil 8 weeks of High-Ft Diet
13 Gluose (mg/dl) Gluose (mg/dl) Weight (g) A. C57BL/6 mie B. Chnges in ody weight SC HFD * * * * * SC HFD Time (wk) C. Gluose tolerne test D. Insulin tolerne test * * * SC HFD SC HFD * Time (min) Time (min)
14 Serum AST(U/l) Serum ALT(U/l) A. H&E stining in hepti tissue mrovesiulr stetosis SC HFD B. Serum sprtte- nd lnine-minotrnsferse 70 p=1 60 p= SC HFD 0 SC HFD
15 Serum TC (mg/dl) Serum diponetin (μg/ml) A. Serum totl holesterol (TC) levels B. Serum totl diponetin levels 250 p = p = SC HFD SC HFD
16 A 60% HFD for 8 weeks results in : 1) n oese nd insulin resistne phenotype, 2) hepti stetosis nd injury, 3) elevted risk for rtheroslerosis, 4) hypodiponetinemi.
17 Effets of exerise trining intervened t the seond hlf of the 16-week highft diet regimen
18 Exerise trining ttenutes weight gins, hepti injury, nd rtherosleorosis seondry to HFD, with no signifint intensity-dependent differenes. Tle 1. Metoli profiles fter the 16-wk HFD nd/or exerise trining SC+SED HFD+SED HFD+HIT HFD+MIT Finl ody mss, g 32.5± ± ± ±1.7 ALT, U/l 31.5± ± ± ±19.9 AST, U/l 54.0± ± ± ±32.8 FFA, meq/l 2.1± ± ±9 2.0±0.18 TG, mg/dl 61.2± ± ± ±9.4 TC, mg/dl 88.2± ± ± ±12.5 d HDLC, mg/dl 43.6± ± ± ±17.5
19 Serum gluose (mg/dl) (Aritrry unit) Serum gluose (mg/dl) (Aritrry unit) Exerise trining ttenutes insulin resistne phenotype seondry to HFD, with no signifint intensity-dependent differenes. A. Gluose tolerne test (GTT) B. Are under the urve for GTT SC+SED HFD+SED HFD+HIT HFD+MIT 4,000 3,000 2,000 1, (min) 0 C. Insulin tolerne test (ITT) D. Are under the urve for the ITT SC+SED HFD+SED HFD+HIT HFD+MIT (min) 0
20 Liver TG (mg/mg) Exerise trining, espeilly t the high-intensity, llevites hepti stetosis seondry to HFD. A. Oil Red O stining C. TG ontents in the liver d 40 SC+SED HFD+SED HFD+HIT HFD+MIT B. H&E stining 0 SC+SED HFD+SED HFD+HIT HFD+MIT SC+SED HFD+SED SC+SED HFD+SED HFD+HIT HFD+MIT
21 Reltive to β-tin Exerise trining suppresses deresed mrna mrkers for ftty id ox./mrc pity s well s inresed mrna mrkers for lipogenesis seondry to HFD in the liver A. mrnas of FA OX/MRC tivity Pprα Cpt1α Cyp410 Cyp2e B. mrnas of de novo lipogenesis Srep Cd Lipin Irs
22 HMW diponetin (μg/ml) Reltive to β-tin Totl diponetin (μg/ml) Exerise trining, espeilly t the high-intensity, suppresses hypodiponetinemi seondry to HFD. A. Totl diponetin in serum IB: C. Adiponetin in dipose tissue 30 kd Adiponetin kd β-tin 0 SC+SED HFD+SED HFD+HIT HFD+MIT B. HMW diponetin in serum SC+SED HFD+SED HFD+HIT HFD+MIT 0 SC+SED HFD+SED HFD+HIT HFD+MIT
23 AdipoR2 mrna/18s rrna Reltive to β-tin AdipoR1 mrna/18s rrna Exerise trining, espeilly t the high-intensity, inreses diponetin reeptor-2 in the liver. A. Adiponetin reeptor 1 (AdipoR1) mrna C. AdipoR1/2 proteins IB 42 kd dipor kd dipor2 0.2 SC+SED HFD+SED HFD+HIT HFD+MIT 42 kd β-tin B. Adiponetin reeptor 2 (AdipoR2) mrna 1.5 AdipoR1 AdipoR SC+SED HFD+SED HFD+HIT HFD+MIT
24 Reltive to β-tin Exerise trining, espeilly t the high-intensity, reverses deresed expression of AMPK /SIRT1 proteins seondry to HFD in the liver. IB: 62 KD 62 KD 110 KD 105 KD 280 KD 280 KD 42KD pampkα (Thr172) AMPKα SIRT1 PGC1α pacc (Ser79) ACC β-tin d 0.5 pampk/ampk SIRT1 PGC1α pacc/acc
25 Exerise trining suppresses HFD-indued hypodiponetinemi while tivting diponetin/adipor2-medited AMPK/SIRT1 pthwy in the liver.
26 Reltive to β-tin Reltive to β-tin Exerise trining suppresses elevted mrna mrkers for inflmmtion nd firosis seondry to HFD in the liver. A. Msson s Trihome stining SC+SED HFD+SED HFD+HIT HFD+MIT B. mrnas of inflmmtory mrkers C. mrnas of firosis mrkers Cd68 Lgls3 Ly6d Timp Col11
27 Nuleuus NF-kB p65 TNF- (pg/ml) Exerise trining, espeilly t high-intensity, suppresses elevted TNF-α s well s tivted NF-kB proteins seondry to HFD in the liver. A. TNF- levels B. Nuleus NF-kB p d B 65 kd 40 kd IB: Nuleus NF-kB p65 IkBα kd LminB SC HFD HFD+INT HFD+MOD 42 kd β-tin SC HFD HFD+INT HFD+MOD
28 Exerise trining suppresses TNF-α-medited tivtion of the NF-kB pthwy seondry to HFD in the liver.
29 CONCLUSIONS - Exerise trining intervened t the seond hlf of 16-HFD regimen llevites hepti stetosis nd metoli omplitions ssoited with oesity. - Compred to moderte intensity, high-intensity trining indues greter enefits ginst oesity-indued NAFLD. - Hepti enefits of exerise trining ginst HFD-indued NAFLD re ssoited with diponetin/adipor2-medited tivtion of the AMPK/SIRT1 pthwy (i.e., ftty id oxidtion, MRC tivity, ipogenesis) s well s suppression of TNF- -medited tivtion of the NF-kB pthwy (i.e., inflmmtion, firosis).
30 Exerise Trining (Modified from Exp Biol Med 234: , 2009)
31 ACKNOWLEDGEMENT This study ws supported y the Koren Government Reserh Foundtion funded y the Koren Government (NRF- 2012R1A1A ) (NRF-2013S1A2A ).
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationChow KD CR HFD. Fed Fast Refed
Supplementry Figure 1 Control d/d Chow KD CR Fed Fst Refed Supplementry Figure 1: Liver expression in diet nd disese models. () expression in the livers of ontrol nd d/d mie. () expression in the livers
More informationHydrodynamic Delivery of mil10 Gene Protects Mice From High-fat Diet-induced Obesity and Glucose Intolerance
originl rtile The Amerin Soiety of Gene & Cell Therpy Hydrodynmi Delivery of mil Gene Protets Mie From High-ft Diet-indued Oesity nd Gluose Intolerne Mingming Go, Chuno Zhng, Yongjie M, Le Bu, Linn Yn
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationFXR controls CHOP expression in steatohepatitis
FXR ontrols CHOP expression in stetoheptitis Cludi D. Fuhs 1, Thierry Cludel 1, Huert Shrngl, Ttjn Stojkovi nd Mihel Truner 1 1 Hns Popper Lortory of Moleulr Heptology, Division of Gstroenterology nd Heptology,
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationIntervention with citrus flavonoids reverses obesity, and improves metabolic syndrome and
Intervention with itrus flvonoids reverses oesity, nd improves metoli syndrome nd theroslerosis in oese Ldlr -/- mie Authors: Amy C. Burke 1,2, Brin G. Sutherlnd 1, Dwn E. Telford 1,3, Mris R. Morrow 1,
More information* * * * * liver kidney ileum. Supplementary Fig.S1
Supplementry Fig.S1 liver kidney ileum Fig.S1. Orlly delivered Fexrmine is intestinlly-restricted Mice received vehicle or Fexrmine (100mg/kg) vi per os (PO) or intrperitonel (IP) injection for 5 dys (n=3/group).
More informationMesozeaxanthin protects the liver and reduces cardio-metabolic risk factors in an insulin resistant rodent model
FOOD & NUTRITION RESEARCH, 217 VOL. 61, 135336 https://doi.org/1.18/16546628.217.135336 ARTICLE Mesozexnthin protets the liver nd redues rdio-metoli risk ftors in n insulin resistnt rodent model Kzim Shin,
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationResearch Article Decaffeinated Green Coffee Bean Extract Attenuates Diet-Induced Obesity and Insulin Resistance in Mice
Hindwi Pulishing Corportion Evidene-Bsed Complementry nd Alterntive Mediine, Artile ID 718379, 14 pges http://dx.doi.org/1.1155/214/718379 eserh Artile Deffeinted Green Coffee Ben Extrt Attenutes Diet-Indued
More informationOb/ob mice are leptin deficient and become hyperphagic,
ORIGINL RTICLE Glyerol-3-Phosphte yltrnsferse 1 Defiieny in o/o Mie Diminishes Hepti Stetosis ut Does Not Protet ginst Insulin Resistne or Oesity ngel. Wendel, 1 Lei O. Li, 1 Yue Li, 1 Gry W. Cline, 2
More informationDietary advanced glycation end-products aggravate non-alcoholic fatty liver disease
Submit Mnusript: http://www.wjgnet.om/esps/ Help Desk: http://www.wjgnet.om/esps/helpdesk.spx DOI: 10.3748/wjg.v22.i35.8026 World J Gstroenterol 2016 September 21; 22(35): 8026-8040 ISSN 1007-9327 (print)
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationIrisin biomarker, TSH, Trygleceriads and High Density Lipoproteins in thyroid diesase patients
Interntionl Journl of ChemTeh Reserh CODEN (USA): IJCRGG, ISSN: 0974-4290, ISSN(Online):2455-9555 Vol.10 No.2, pp 674-678, 2017 Irisin biomrker, TSH, Trygleerids nd High Density Lipoproteins in thyroid
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationCB1 antagonism exerts specific molecular effects on visceral and subcutaneous fat and reverses liver steatosis in diet-induced obese mice.
CB1 ntgonism exerts speifi moleulr effets on viserl nd suutneous ft nd reverses liver stetosis in diet-indued oese mie. Tony Jourdn, Louiz Djouti, Lurent Demizieux, Joseph Gresti, Bruno Vergès, Psl Degre
More informationEffect of age and moderate food restriction on insulin sensitivity in Wistar rats: role of adiposity
131 Effet of ge nd moderte food restrition on insulin sensitivity in Wistr rts: role of diposity Fernndo Esrivá, M Luí Gvete, Ysmín Fermín 1, Corli Pérez 1, Nild Gllrdo 2, Crmen Alvrez, Antonio Andrés
More informationSupplemental epilactose prevents metabolic disorders through uncoupling protein-1 induction in the skeletal muscle of mice fed high-fat diets
British Journl of Nutrition (215), 114, 1774 1783 The Authors 215 doi:1.117/s7114515355 Supplementl epiltose prevents metoli disorders through unoupling protein-1 indution in the skeletl musle of mie fed
More informationSoy protein isolates prevent loss of bone quantity associated with obesity in rats through regulation of insulin signaling in osteoblasts
The FASE Journl Reserh ommunition Soy protein isoltes prevent loss of one quntity ssoited with oesity in rts through regultion of insulin signling in osteolsts JinRn hen,,,, Jin Zhng,,, Oxn P. Lzrenko,,
More informationAdipose tissue NAPE-PLD controls fat mass development by altering the browning process and gut microbiota
Reeived 11 Jul 1 Aepted Fe Pulished 11 Mr DOI: 1.138/nomms795 OPEN Adipose tissue NAPE-PLD ontrols ft mss development y ltering the rowning proess nd gut miroiot Luie Geurts 1, Amndine Everrd 1,, Mtthis
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationGarcinia cambogia Extract Ameliorates Visceral Adiposity in C57BL/6J Mice Fed on a High-Fat Diet
Biosi. Biotehnol. Biohem., 72 (7), 1772 1780, 2008 Grini mogi Extrt Ameliortes Viserl Adiposity in C57BL/6J Mie Fed on High-Ft Diet Keun-Young KIM, Hye Nm LEE, Yun Jung KIM, nd Tesun PARK y Deprtment of
More informationGLP-1 oestrogen attenuates hyperphagia and protects from beta cell failure in diabetes-prone New Zealand obese (NZO) mice
Dietologi () 8:64 614 DOI.7/s1-14-3478-3 ARTICLE GLP-1 oestrogen ttenutes hyperphgi nd protets from et ell filure in dietes-prone New Zelnd oese (NZO) mie Roert W. Shwenk & Christin Bumeier & Brin Finn
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationEffect of Diets Containing Sucrose vs. D-tagatose in Hypercholesterolemic Mice
nture pulishing group ARTICLES Effet of Diets Contining Surose vs. D-tgtose in Hyperholesterolemi Mie S r B. Poli e 1, J. C l y Hr r is 2, Roert A. Lodder 1, 2 nd Lis A. Cssis 1 Effets of funtionl sweeteners
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationMacrophage mtorc1 disruption reduces inflammation and insulin resistance in obese mice
Dietologi (1) 7:393 DOI 1.17/s-1-33- ARTICLE Mrophge mtorc1 isruption reues inflmmtion n insulin resistne in oese mie Hongfeng Jing & Mrit Westerterp & Chunjiong Wng & Yi Zhu & Ding Ai Reeive: 1 April
More informationLong-term dietary nitrite and nitrate deficiency causes the metabolic syndrome, endothelial dysfunction and cardiovascular death in mice
Dietologi (217) 6:1138 111 DOI 1.17/s12-17-429-6 ARTICLE Long-term dietry nitrite nd nitrte defiieny uses the metoli syndrome, endothelil dysfuntion nd rdiovsulr deth in mie Mik Kin-Tnd 1,2 & Myuko Sknshi
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationBeta-Glucan-Rich Extract from
Evidene-Bsed Complementry nd Alterntive Mediine Volume 2013, Artile ID 185259, 10 pges http://dx.doi.org/10.1155/2013/185259 Reserh Artile Bet-Glun-Rih Extrt from Pleurotus sjor-ju (Fr.) Singer Prevents
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nture11225 Numer of OTUs sed on 3% distnce Numer of 16s rrna-sed V2-V4 tg sequences LF MF PUFA Supplementry Figure 1. High-ft diets decrese the richness nd diversity
More informationWorld Journal of Gastroenterology
ISSN 7-97 (print) ISSN 9- (online) World Journl of Gstroenterology World J Gstroenterol Jnury ; (): - Published by Bishideng Publishing Group In S Contents Weekly Volume Number Jnury, MINIREVIEWS Drug-eluting
More informationc-abl inhibition mitigates diet-induced obesity through improving insulin sensitivity of subcutaneous fat in mice
Dietologi (7) :9 9 DOI.7/s--- ARTICLE -Al inhiition mitigtes iet-inue oesity through improving insulin sensitivity of suutneous ft in mie Rong Wu, & Jin-gung Sun, & Ji-qiu Wng & Binhu Li & Qingsong Liu
More informationInternational Journal of Pharma and Bio Sciences
Int J Phrm Bio Si 2013 Ot; 4(4): (B) 427-436 Reserh Artile BioChemistry Interntionl Journl of Phrm nd Bio Sienes ISSN 0975-6299 SILDENAFIL ALLEVIATES INSULIN SENSITIVITY VIA ATTENUATING OXIDATIVE STRESS
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationAncah Caesarina Novi Marchianti Emi Arimura Miharu Ushikai Masahisa Horiuchi
Environ Helth Prev Med (214) 19:339 347 DOI 1.17/s12199-14-4-z REGULAR ARTICLE Voluntry exerise under food restrition ondition dereses blood brnhed-hin mino id levels, in ddition to improvement of gluose
More informationFermented Barley Extract Supplementation Maintained Antioxidative Defense Suppressing Lipopolysaccharide-Induced Inflammatory Liver Injury in Rats
Biosi. Biotehnol. Biohem., 75 (1), 1971 1976, 211 Fermented Brley Extrt Supplementtion Mintined Antioxidtive Defense Suppressing Lipopolyshride-Indued Inflmmtory Liver Injury in Rts Puspo E. GIRIWONO,
More informationBritish Journal of Nutrition
British Journl of Nutrition (2014), 111, 445 451 q The Authors 2013 doi:10.1017/s0007114513002584 PUFA rtio is involved in regulting lipid metolism nd inflmmtion in pigs Yehui Dun 1,2, Fengn Li 1 *, Lili
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationChronic inflammation is a pathogenic factor in
ORIGINAL ARTICLE Dynmi, M2-Like Remodeling Phenotypes of CD11 Adipose Tissue Mrophges During High-Ft Diet Indued Oesity in Mie Merv E. Shul, Gre Bennett, Ktherine J. Strissel, Andrew S. Greenerg, nd Mrtin
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationPrimers used for real time qpcr
Supplementry Tble 1. Primers used for rel time qpcr Gene Accession number Forwrd/reverse primers Tgfα Tgfβ1 Hgf Cyclin A2 Cyclin B1 Cyclin D1 Cyclin E1 FoxM1 p21 Lrt Cyp26A1 CrbpI Rrβ Bcmo1 Bcmo2 NM_31199
More informationFood Research & Development, CJ Cheiljedang Corporation, Seoul , Korea; s: (H.-J.K.); (B.S.M.
Int. J. Mol. Si. 214, 15, 17778-17789; doi:1.339/ijms15117778 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms The Benefiil Effets of Comined Grpe Pome nd Omij
More informationA maternal junk food diet in pregnancy and lactation promotes an exacerbated taste for junk food and a greater propensity for obesity in rat offspring
British Journl of Nutrition (27), pge 1 of 9 q The uthors 27 doi: 1.117/S7114781237 mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity for oesity in rt
More informationWhite adipose tissue overproduces the lipid-mobilizing factor zinc a2-glycoprotein in chronic kidney disease
si reserh http://www.kidney-interntionl.org & 13 Interntionl Soiety of Nephrology White dipose tissue overprodues the lipid-moilizing ftor zin -glyoprotein in hroni kidney disese Croline C. Pelletier 1,,3,5,
More informationAnti-diabetic effect of Cyclo-His-Pro (CHP)-enriched yeast hydrolysate in streptozotocin-induced diabetic mice
Vol. 12(35), pp. 5473-5479, 28 August, 213 DOI: 1.5897/AJB12.1556 ISSN 1684-5315 213 Ademi Journls http://www.demijournls.org/ajb Afrin Journl of Biotehnology Full Length Reserh Pper Anti-dieti effet of
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationIntestine specific MTP deficiency with global ACAT2 gene ablation lowers acute cholesterol absorption with chylomicrons and high density lipoproteins
Intestine speifi MTP defiieny with glol ACAT2 gene ltion lowers ute holesterol sorption with hylomirons nd high density lipoproteins 1,2 Jhngir Iql, 1,2 Mohmed Boutjdir, 3 Lwrene L. Rudel, 1,2 M. Mhmood
More informationEpiphyseal growth plate growth hormone receptor signaling is decreased in chronic kidney disease related growth retardation
http://www.kidney-interntionl.org & 213 Interntionl Soiety of Nephrology Epiphysel growth plte growth hormone reeptor signling is deresed in hroni kidney disese relted growth retrdtion Ariel Troi 1, Dniel
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationThe effect of dietary α-linolenic acid levels on regulation of omega-3 lipid synthesis in rat
The effect of dietry α-linolenic cid levels on regultion of omeg-3 lipid synthesis in rt Wei-Chun Tu School of Agriculture Food nd Wine The University of Adelide Conversion of PUFA to LCPUFA PUFA LCPUFA
More informationBritish Journal of Nutrition
(1), 11, 8 87 q The Authors 1 doi:1.117/s711117x Chnges in plsm mino id profiles, growth performne nd intestinl ntioxidnt pity of piglets following inresed onsumption of methionine s its hydroxy nlogue
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationAdipocyte in vascular wall can induce the rupture of abdominal aortic aneurysm
Adipocyte in vsculr wll cn induce the rupture of dominl ortic neurysm Hiron Kugo 1 *, Nouhiro Zim 1 *, Hiroki Tnk 2 *, Youhei Mouri 1, Kenichi Yngimoto 3, Kohsuke Hymizu 3,4, Keisuke Hshimoto 1, Tkeshi
More informationSUPPLEMENTARY INFORMATION
X p -lu c ct ivi ty doi:.8/nture8 S CsA - THA + DAPI Merge FSK THA TUN Supplementry Figure : A. Ad-Xp luc ctivity in primry heptocytes exposed to FSK, THA, or TUN s indicted. Luciferse ctivity normlized
More informationToll-Like Receptor Activation during Cutaneous Allergen Sensitization Blocks Development of Asthma through IFN-Gamma-Dependent Mechanisms
ORIGINAL ARTICLE See relted ommentry on pg 874 Toll-Like Reeptor Ativtion during Cutneous Allergen Sensitiztion Bloks Development of Asthm through IFN-Gmm-Dependent Mehnisms Rit Hpkoski 1, Pii Krisol 1,
More informationTHE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS
THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS THE EVALUATION OF DEHULLED CANOLA MEAL IN THE DIETS OF GROWING AND FINISHING PIGS John F. Ptience nd Doug Gillis SUMMARY
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationAdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency
AdPLA AdPLA ablation increases lipolysis and prevents obesity induced by high fat feeding or leptin deficiency Kathy Jaworski, Maryam Ahmadian, Robin E. Duncan, Eszter Sarkadi-Nagy, Krista A. Va rady,
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationEffect of Prebiotics Inulin and Mannan on Lipid Profile and Intestinal Micro Flora of Hypercholesterolemic Rats
J. Appl. Environ. Biol. Si., 6(8)22-31, 216 216, TextRod Pulition ISSN: 29-4274 Journl of Applied Environmentl nd Biologil Sienes www.textrod.om Effet of Preiotis Inulin nd Mnnn on Lipid Profile nd Intestinl
More information2018 American Diabetes Association. Published online at
Supplementry Figure S1. Ft-1 mice exhibit reduced diposity when fed n HFHS diet. WT nd ft-1 mice were fed either control or n HFHS diet for 18 weeks. A: Representtive photogrphs for side-by-side comprison
More informationAcute and gradual increases in BDNF concentration elicit distinct signaling and functions in neurons
nd grdul increses in BDNF concentrtion elicit distinct signling nd functions in neurons Yunyun Ji,, Yun Lu, Feng Yng, Wnhu Shen, Tin Tze-Tsng Tng,, Linyin Feng, Shumin Dun, nd Bi Lu,.. - Grdul (normlized
More informationNephroprotective and Antioxidant Effects of Parsley Plant Parts Against Gentamicin-Induced Nephrotoxicity in Rats
Ademi Journl of Nutrition 4 (3): 113-122, 2015 IN 2309-8902 IDI Pulitions, 2015 DI: 10.5829/idosi.jn.2015.4.3.10417 Nephroprotetive nd Antioxidnt Effets of Prsley Plnt Prts Aginst Gentmiin-Indued Nephrotoxiity
More informationSupplementary information to accompany the manuscript entitled:
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementry informtion to ompny the mnusript entitled: A mternl junk food diet in pregnny nd lttion promotes n exerted tste for junk food nd greter propensity
More informationAlternative rapamycin treatment regimens mitigate the impact of rapamycin on glucose homeostasis and the immune system.
Aging Cell (216) 15, pp28 38 Doi: 1.1111/el.1245 Alterntive rpmyin tretment regimens mitigte the impt of rpmyin on gluose homeostsis nd the immune system Aging Cell Sestin I. Arriol Apelo, 1,2 Joshu C.
More informationARTICLE. Keywords Lipotoxicity. MicroRNA. Pancreatic beta cells. Stearic acid
Dietologi (6) 59:7 57 DOI.7/s5639 ARTICLE Elevted irulting steri id leds to mjor lipotoxi effet on mouse pnreti et ells in hyperlipidemi vi mir35pmedited PERK/p53dependent pthwy Huimin Lu & Liuyi Ho &
More informationOZONE TREATMENT REDUCES MARKERS OF OXIDATIVE AND ENDOTHELIAL DAMAGE IN AN EXPERIMENTAL DIABETES MODEL IN RATS
Phrmologil Reserh, Vol. 44, No. 5, 21 doi:1.16/phrs.21.867, ville online t http://www.idelirry.om on OZONE TREATMENT REDUCES MARKERS OF OXIDATIVE AND ENDOTHELIAL DAMAGE IN AN EXPERIMENTAL DIABETES MODEL
More informationThe Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease. Ekihiro Seki, M.D.,Ph.D. University of California San Diego
The Enhancement of Toxin-Induced Liver Fibrosis in Fatty Liver Disease Ekihiro Seki, M.D.,Ph.D. University of California San Diego - A manufactured chemical. - Does not exist naturally. Carbon tetrachloride
More informationBritish Journal of Nutrition
British Journl of Nutrition (2012), 108, 2166 2175 q The Authors 2012 doi:10.1017/s0007114512000347 Differentil effects of low-dose resvertrol on diposity nd heptic stetosis in diet-induced oese mice Su-Jung
More informationDietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationARTICLE. Keywords AMPK. Cholesterol. Insulin resistance. Intestine. Isoflavones. Liver. LXRα. LXRβ. Mice. Soy protein
Dietologi () 55:469 478 DOI.7/s5--599-9 ARTICLE Soy protein isoflvones ifferentilly regulte liver X reeptor isoforms to moulte lipi metolism n holesterol trnsport in the liver n intestine in mie M. González-Grnillo
More informationInvestigation the Effects of Curcumin on Serum Hepatic Enzymes Activity in a Rheumatoid Arthritis Model
Investigtion the Effets of Curumin on Serum Hepti Enzymes Ativity in Rheumtoid Arthritis Model Ftemeh Aghei Borshn 1,, Mino Ilkhnipoor 1, Mohmmd Hshemi 1, Frh Frrokhi 2 1 Deprtment of Biology, Fulty of
More informationNappHS. rrna. transcript abundance. NappHS relative con W+W 0.8. nicotine [µg mg -1 FM]
(A) W+OS 3 min 6 min con L S L S RNA loding control NppHS rrna (B) (C) 8 1 k NppHS reltive trnscript undnce 6 4.5 *** *** *** *** 3 k. + + + line 1 line (D) nicotine [µg mg -1 FM] 1..8.4. con W+W Supplementl
More informationCase Report INTRODUCTION CASE REPORT. pissn eissn X
pissn 2287-2728 eissn 2287-285X Cse Report Clinicl nd Moleculr Heptology 2018;24:424-429 Complete cure of dvnced heptocellulr crcinom with right drenl glnd metstsis nd portl vein thrombosis by multiple
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationEffect of Pumpkin (Cucurbita Moschata) and Pineapple (Ananas Comosus Linn) on Obese Hyperlipidemic Rats
Ademi Journl of Nutrition 4 (3): 90-98, 2015 ISSN 2309-8902 IDOSI Pulitions, 2015 DOI: 10.5829/idosi.jn.2015.4.3.101172 Effet of Pumpkin (Cuurit Mosht) nd Pinepple (Anns Comosus Linn) on Oese Hyperlipidemi
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationSystemic Insulin-like Growth Factor-1 Reverses Hypoalgesia and Improves Mobility in a Mouse Model of Diabetic Peripheral Neuropathy
originl rtile Systemi Insulin-like Growth Ftor-1 Reverses Hypolgesi nd Improves Moility in Mouse Model of Dieti Peripherl Neuropthy Qiuming Chu 1, Rod Morelnd 1, Nelson S Yew 1, Joseph Foley 1, Roin Ziegler
More informationMiR-29a Assists in Preventing the Activation of Human Stellate Cells and Promotes Recovery From Liver Fibrosis in Mice
originl rtile The Amerin Soiety of Gene & Cell Therpy MiR-9 Assists in Preventing the Ativtion of Humn Stellte Cells nd Promotes Reovery From Liver Firosis in Mie Yoshinri Mtsumoto,,3, Sori Itmi, Mshiko
More informationGut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
More informationAbstract ABSTRACT #69. Abstract. Introduction & Methods. Methods & Results. Results. Results & Conclusions
Effects of dietry β-glucn on Growth Performnce, Dirrhe, nd Gut Permeility of Wening Pigs Experimentlly Infected with Pthogenic E. coli Kwngwook Kim, Amy Ehrlich, Vivin Perng, Jennifer Chse, Helen Ryould,
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationHypothermia is better than ischemic preconditioning for preventing early hepatic ischemia/reperfusion in rats
11 ORIGINAL ARTICLE Jnury-Ferury, Vol. 15 No. 1, 216: 11-12 The Offiil Journl of the Mexin Assoition of Heptology, the Ltin-Amerin Assoition for Study of the Liver nd the Cndin Assoition for the Study
More informationDIETARY FOOD FORTIFIED WITH OROTIC ACID AND LIVER FUNCTION
MAKARA, SAINS, VOL. 15, NO. 2, NOVEMBER 211: 11-15 DIETARY FOOD FORTIFIED WITH OROTIC ACID AND LIVER FUNCTION Yohnes Bung Deprtment of Chemistry, Fculty of Science nd Engineering, Nus Cendn University,
More informationThe kinetics and stiffness characteristics of the lower extremity in older adults during vertical jumping
Journl of Sports Siene nd Mediine (2008) 7, 379-386 http://www.jssm.org Reserh rtile The kinetis nd stiffness hrteristis of the lower extremity in older dults during vertil jumping Li-I Wng Deprtment of
More informationSupplementary Information
Supplementry Informtion A new lss of plnt lipid is essentil for protetion ginst phosphorus depletion Yozo Okzki 1, Hitomi Otsuki 1, Tomoko Nrisw 1, Mkoto Koyshi 1, Storu Swi 2, Yukiko Kmide 1, Miyko Kusno
More informationEffect of kazunoko lipid on the concentrations of plasma glucose and lipids and liver lipids in mice
Effect of kzunoko lipid on the concentrtions of plsm glucose nd lipids nd liver lipids in mice Ntionl Food Reserch Institute Tomoyuki Higuchi, Nouy Shiri nd Hirmitsu Suzuki INTRODUCTION Kzunoko, which
More informationAyman Hyder 1, Sabrina Ehnert 2, Hebke Hinz 1, Andreas K Nüssler 2, Fred Fändrich 1 and Hendrik Ungefroren 1,3*
Hyder et l. Cell Communition nd Signling 212, 1:23 http://www.biosignling.om/ontent/1/1/23 RESEARCH Open Aess EGF nd HB-EGF enhne the prolifertion of progrmmble ells of monoyti origin (PCMO) through tivtion
More informationPPAR activation attenuates cold-induced upregulation of thyroid status and brown adipose tissue PGC-1 and D2
Am J Physiol Regul Integr Comp Physiol 33: R77 R85,. First pulished Otoer, ; doi:.5/jpregu.99.. PPAR tivtion ttenutes old-indued upregultion of thyroid sttus nd rown dipose tissue PGC- nd D Willim T. Festui,
More informationBritish Journal of Nutrition
British Journl of Nutrition (2013), 109, 394 401 q The Authors 2012 doi:10.1017/s0007114512001298 The ntioxidnt effet of -ryophyllene protets rt liver from ron tetrhloride-indued firosis y inhiiting hepti
More informationCAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY
CAUSES OF DIARRHEA, PNEUMONIA, AND ABORTION IN 1991 CATTLE SUBMISSIONS TO THE KSU VETERINARY DIAGNOSTIC LABORATORY 1 1 2 R. K. Frnk, M. W. Vorhies, nd M. M. Chengpp Summry Cuses of dirrhe, pneumoni, nd
More information