Targeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma

Transcription

1 Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn Offiil journl of the Amerin Soiety of Gene & Cell Therpy Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses Epithelil CCL17 in Murine Model of Asthm Yi-Lien Chen 1 nd Bor-Luen Ching 1 Airwy epithelium defends the invsion from miroorgnisms nd regultes immune responses in llergi sthm. Thymi stroml lymphopoietin (TSLP) from inflmed epithelium promotes mturtion of dendriti ells (DCs) to prime Th2 responses vi CCL17, whih indues hemotxis of CD4 + T ells to medite inflmmtion. However, few studies hve investigted the regultion of epithelil CCL17. In this study, we used shrna ginst TSLP to lrify the role of TSLP in the irwy inflmmtion nd whether TSLP ffets the irwy inflmmtion vi epithelil CCL17. Speifi ws delivered y lentivirus nd seleted y the knokdown effiieny. Allergi mie were intrtrhelly pretreted with the lentivirus nd followed y intrnsl ovlumin (OVA) hllenges. The ser ntiody levels, irwy inflmmtion, irwy hyper-responsiveness (AHR), ytokine levels in ronholveolr lvge fluids, nd CCL17 expressions in lungs were determined. In vivo, TSLP ttenution redued the AHR, deresed the irwy inflmmtion, inhiited the mturtions of DCs, nd suppressed the migrtion of T ells. Furthermore, the expression of CCL17 ws prtiulrly deresed in ronhil epithelium. In vitro, CCL17 indution ws regulted y TSLP. In onlusion, TSLP might oordinte irwy inflmmtion prtilly vi CCL17-medited responses nd this study provides the vitl utility of TSLP to develop the therpeuti pproh in llergi irwy inflmmtion. Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn ; pulished online 3 My 216 Sujet Ctegory: Therpeuti proof-of-onept Introdution Airwy epithelium protets the irwy from exposure to llergens nd prtiiptes in the initition nd progression of llergi inflmmtion. 1 The tivtion of irwy epithelium indues seretion of hemokines nd ytokines tht ttrt monoytes nd immture dendriti ells (DCs) to the inflmed lotion nd prime immune responses. 2 Therefore, mjor therpeuti pproh treting llergi sthm is to develop n effetive ttenution on epithelium-medited inflmmtory responses. Thymi stroml lymphopoietin (TSLP) is ritil for the development of llergi irwy inflmmtion, 3,4 inluding the genertion of Th2 differentition diretly or through DCs,,6 the enhnement of sophil nd eosinophil hemtopoiesis, 7,8 nd the inhiition of ntigen-speifi regultory T ells. 9 The funtionl reeptor is omposed of the TSLPR suunit nd the IL-7 reeptor α hin. 1 In the irwy of sthmti ptients, the TSLP mrna nd protein in the epithelium re expressed nd re highly orrelted with disese severity. 11,12 In the niml model, overexpression of TSLP in the lungs developed into n sthm-like disese. 13 Although lokge of the TSLP pthwy with speifi ntiodies ould redue the severity of llergi irwy inflmmtion, 14,1 the detiled effets of TSLP re still unler. CCL17 plys dominnt role in Th2-relted diseses, suh s topi dermtitis nd sthm. 16,17 The level of CCL17 is signifintly inresed in ronholveolr lvge (BAL) fluids 18,19 nd in the irwy of sthmti ptients. 2 It ws found tht CCL17 expressed in the ronhil epithelium during ovlumin (OVA) hllenges nd the tretment with nti-ccl17 ntiodies in sthmti mie redued irwy inflmmtion, eosinophil infiltrtion, nd irwy hyper-responsiveness (AHR). 21 The ronhil ells produed CCL17 fter the stimultion of proinflmmtory ftors nd llergens. 22,23 On DCs, TSLP inresed the expression of TSLP reeptors 24 nd enhned the expression of CCL17 to ugment Th2 responses in the inflmed lotion. 2,26 However, it remins unler whether the prodution of epithelil CCL17 is regulted y TSLP. In this study, irwy epithelium ws dministrted with lentivirus ontining the speifi smll hirpin RNA (shrna) tht trgeted TSLP to lrify the funtionl role of TSLP in the expression of epithelil CCL17 nd llergi inflmmtion. The results showed tht the ttenution of TSLP in the irwy of sthmti mie signifintly redued AHR nd irwy inflmmtion, whih might e medited y inhiiting the tivtion of DCs, reduing the prodution of CCL17 in ronhil epithelium nd BAL fluids, nd suppressing the migrtion of T ells. TSLP regulted the expression of CCL17 nd TSLPR in primry epithelil ells in vitro. Tken s whole, these dt demonstrted tht epithelium-derived TSLP modulted irwy inflmmtion might e prtilly through CCL17 xis. 1 Grdute Institute of Clinil Mediine, College of Mediine, Ntionl Tiwn University, Tipei, Tiwn. Correspondene: Bor-Luen Ching, Deprtment of Medil Reserh, Ntionl Tiwn University Hospitl, #7 Chung-Shn South Rod, Tipei 12, Tiwn. E-mil: gimor@ntu.edu.tw Keywords: irwy inflmmtion; sthm; CCL17; shrna; thymi stroml lymphopoietin Reeived 11 Novemer 21; epted 19 Mrh 216; pulished online 3 My 216. doi:1.138/mtn

2 TSLP-medited Inflmmtion Vi Epithelil CCL17 2 Results Lentivirus ontining onstruted-shrna ginst TSLP signifintly deresed TSLP seretion In our previous study, the primry lung ells were ultured nd lrified with the phenotype s lveolr type II ells. 27 Reently, RNAi is used s tool in niml models to study the detiled funtions of the trgeted gene. In order to otin useful shrna ginst TSLP, n indued-tslp ondition ws set-up nd used to determine the effiieny of lentivirus ontining the shrna in vitro. The expression of TSLP ws indued y different dosges of following time ourses. The dt showed tht TSLP ws oviously indued y high dosges of (2 nd 4 ng/ml) in 48 hours (Figure 1). As result, 4 ng/ml ws used s the stimultor in vitro system. Three shrnas ginst TSLP (-1, 2, nd 3) were onstruted nd pkged into lentivirus for gene silening. To determine the knokdown effiieny of, the mrna expressions of TSLP in epithelil ells were nlyzed y rel-time PCR during preinfetion with lentivirus nd the stimultion. In order to inrese infetive effiieny, the tretment of lentivirl infetion ws omined with polyrene, whih is tioni polymer. Compred with the result in, the mrna expression ws deresed y out % in the -2 group (Figure 1). Aording to this finding, lentivirus ontining -2 ws used s the therpeuti mteril. The levels of TSLP protein were mesured following the time-ourse protool. The results showed tht the knokdown of TSLP ould signifintly pper in 24 hours of postinfetion while the redution ws more ovious in 48 hours (Figure 1). Lol dministrtion with in OVA-sensitized mie redued the severity of AHR ut did not ffet the levels of ntigen-speifi ntiodies in ser Following the sensitiztion nd hllenge protool (Figure 2), well-estlished murine model of OVA-indued sthm ws used to evlute the therpeuti effet of. In our previous study, lentivirus during intrtrhel dministrtion ould infet the ronhus, lveoli, nd mrophges in the irwy. 27 In the OVA-indued sthmti mie treted with lentivirus or not, there ws no signifint differene in OVA-speifi IgG1, IgG2, nd IgE in OVA-sensitized groups mong the positive ontrol (PC) group, the, nd the group. The levels of OVA-speifi IgG1, IgG2, nd IgE in the negtive ontrol () group whih ws not reeived OVA sensitiztion were too low to e detetle (Figure 2). The treted mie were nlyzed for the degrees of onstrition in irwy fter methholine hllenges in two systems, inluding the whole-ody plethysmogrphy nd the invsive plethysmogrphy. The irwy onstritions in the OVA-sensitized nd hllenged mie were inresed during methholine hllenges. The severity of AHR ws signifintly redued in the -treted mie ut not in the -treted nd PC mie (Figure 2). The differene ould e oviously noted in the low dosge (6.2 mg/ml) of methholine hllenges. The similr trend ws lso presented in the results of irwy resistne (Figure 2). These dt suggested tht lol dministrtion of ffeted the progression of AHR ut did not swy the systemi immune response. TSLP (pg/ml) TSLP (pg/ml) TSLP expression (fold) 12 ng/ml 1 ng/ml 1 2 ng/ml 4 ng/ml Polyrene Figure 1 Lentivirus ontining shrna ginst thymi stroml lymphopoietin (TSLP) deresed the prodution of TSLP in vitro. () The indution of TSLP in primry lung ultures. Primry lung ells were stimulted y different doses of (, 1, 2, nd 4 ng/ml) nd the ulture superntnts were olleted following time ourse. *P <. nd **P <.1 versus no. The Knokdown effiieny of in mrna levels () nd proteins (). Cells were preinfeted with lentivirus ontining the or (multipliity of infetion = 1) for 48 hours nd stimulted y (4 ng/ml). RNA ws olleted fter stimultion for 4 hours nd the expression of mrna ws ssessed y rel-time polymerse hin retion. Proteins in the ulture superntnts were olleted t time ourse (12, 24, nd 48 hours) nd nlyzed y enzyme-linked immunosorent ssy. P <., P <.1, nd P <.1 versus. P <., P <.1, nd P <.1 versus the. Dt re shown s men ± stndrd error of the men nd representtive of six independent experiments. * Time (hours) Time (hours) * ** -3 Moleulr Therpy Nulei Aids

3 TSLP-medited Inflmmtion Vi Epithelil CCL17 3 Protool i.t. lentivirus AHR nlysis i.p. PBS / OVA + AI (OH) 3 (Sensitiztion phse) i.n. OVA (Chllenge phse) 44 * Srifie PC IgG1 (E.U.).7. IgG2 (E.U.).7. IgE (E.U.) ** PC PC 1. Penh 7.. Airwy resistne (RL) Methholine (mg/ml) Methholine (mg/ml) Figure 2 signifintly redued the degree of irwy hyperresponsiveness. The protool of the sthmti niml model is summrized in the figure. Mie were srified fter OVA sensitiztion nd OVA hllenges omining with or without lentivirl pretretment. () The expression of OVA speifi-as in the ser. Dt re presented s ELISA units (E.U.). Following protool, irwy funtion of the treted mie ws determined y () whole-ody plethysmogrphy or () invsive plethysmogrphy fter OVA hllenges. Results in wholeody plethysmogrphy were expressed s the seline Penh vlue nd results in invsive plethysmogrphy were expressed s the irwy resistne vlue. N = 6 8 per group. P <., P <.1, P <.1 versus the PC. P <., P <.1, P <.1 versus the. Dt re shown s men ± stndrd error of the men nd representtive of five independent experiments. Dt of invsive plethysmogrphy were representtive of three independent experiments. AHR, irwy hyper-responsiveness; i.t., intrtrhel;, negtive ontrol; OVA, ovlumin; PC, positive ontrol; TSLP, thymi stroml lymphopoietin. dministrtion redued the levels of Th2 ytokines nd the mturtion of irwy DCs lolly To evlute the effet of in the irwy inflmmtion, the ytokine profile ws nlyzed. The prodution of TSLP ws signifintly deresed in the lung homogeniztion of the -treted group ut oviously inresed in the PC group. The ytokine levels of IL-4 nd IL- in the sht- SLP-treted group were lower thn tht in the PC group. Menwhile, the level of eotxin, the key hemottrtnt of eosinophil, in the -treted group ws lower thn tht

4 4 TSLP-medited Inflmmtion Vi Epithelil CCL17 1 PC 6 3 TSLP (pg/1 µg protein) 1 Eotxin (pg/ml) 4 2 IL-4 (pg/ml) IL- (pg/ml) 1 IL-13 (pg/ml) 2 1 IFN-γ (pg/ml) CD4 expression (%) 1 CD8 expression (%) 2 1 * CD86 expression (%) 2 1 * DC ounts (1 4 ) 2 1 Figure 3 deresed the produtions of Th2 ytokines nd the expression of ostimultory moleules on lung dendriti ells (DCs). () The produtions of thymi stroml lymphopoietin (TSLP) nd proinflmmtory ytokines in lungs. Lungs were homogenized in lysis uffer nd the protein onentrtions of homogentes were mesured y iinhonini id ssy. The expressions of TSLP in lung homogentes (1 μg) nd the levels of ytokines in ronholveolr lvge fluids were mesured y enzyme-linked immunosorent ssy. () The expression of CD4, CD8, nd CD86 on irwy DCs. () The numer of irwy DCs. DCs were isolted from lungs nd the expressions of ostimultory moleules were determined y flow ytometry. N = 6 8 per group. P <., P <.1, P <.1 versus the PC. P <., P <.1, P <.1 versus the. *P <., **P <.1, P <.1 versus. Dt re shown s men ± stndrd error of the men nd representtive of five independent experiments., negtive ontrol; PC, positive ontrol. in the PC or -treted groups respetively. However, the levels of IFN-γ nd IL-13 mong ll groups were not sttistilly different (Figure 3). Mtured DCs ply very importnt role in the differentition of T ells vi the oopertion of ytokines nd surfe moleules. Following the proedure of the niml model, irwy DCs isolted from lungs were nlyzed for the expression of ostimultory moleules, inluding CD4, CD8, nd CD86 y flow ytometry. The results showed tht not only the expression of ostimultory moleules ut lso the numer of DCs in the -treted group ws oviously lower thn tht in the PC nd mok shrna-treted groups (Figure 3,). These findings suggested tht lol ttenution of TSLP in the irwy ffeted irwy inflmmtion through modulting the reruitment nd tivtion of DCs. dministrtion deresed eosinophil nd neutrophil reruitment in lungs To ssess the effet of in the degrees of inflmmtory infiltrtion, the ell numers from BAL fluids nd the Moleulr Therpy Nulei Aids

5 TSLP-medited Inflmmtion Vi Epithelil CCL17 PC 1 2 Cell numer ( 1) Cell popultion (%) Eosinophil Neutrophil Negtive ontrol Lymphoyte Mrophge Positive ontrol d Infiltrtion perentge Figure 4 deresed the infiltrtion of inflmmtory ells. After srifie, () the perentge of inflmmtory ells nd () totl ell ounts in the ronholveolr lvge fluids were nlyzed. N = 6 8 per group. P <., P <.1, P <.1 versus the PC. P <., P <.1, P <.1 versus the. Dt re shown s men ± SEM nd representtive of five independent experiments. () Histologil exmintion of lung tissue. (d) Quntittive nlysis of histologil setions. The prffin setions of the treted mie were prepred nd stined with hemtoxylin nd eosin. Br = 1 μm (mgnifition: 1)., negtive ontrol; PC, positive ontrol; TSLP, thymi stroml lymphopoietin. ell popultions in the irwy were nlyzed. The perentge of eosinophils in the PC or -treted group ws higher thn tht in the -treted nd groups (Figure 4). The deresed eosinophils proly resulted from the lower level of eotxin (Figure 3). Menwhile, the perentge of neutrophils in the -treted group ws lower thn the PC nd -treted groups. The tretment of enhned the perentge of mrophges in BAL fluids, ompred with those of the PC nd -treted groups. The ell n umers of the -treted nd groups were lower thn those of the PC nd -treted groups (Figure 4). In

6 TSLP-medited Inflmmtion Vi Epithelil CCL17 6 PC e CCL17 mrna expression (fold) 1 1 Negtive ontrol CCL17 (pg/ml) Positive ontrol * T ell migrtion (ells 13) * mok shrna d 9 T ell migrtion (ells 13) 6 3 PBS OVA Control As OVA αccl17 As Figure downregulted CCL17 in lungs nd T-ell migrtion. () The expression of CCL17 in lungs nd () ronholveolr lvge (BAL) fluids. The lungs were used for RNA preprtion nd mrna expressions of CCL17 were nlyzed y quntittive rel-time polymerse hin retion. The levels of CCL17 in BAL fluids were mesured y enzyme-linked immunosorent ssy. () The migrtion of T ells ws indued y BAL fluids. (d) The migrtion of T ells ws redued y CCL17 neutrliztion. BAL fluids were ultured with ontrol ntiodies or nti-ccl17 ntiodies ( ng/ml) for migrtion ssy. **P <.1, P <.1 versus the OVA plus ontrol ntiodies. (e) The expression of CCL17 in lung setions. The setions from the treted mie were prepred nd stined y immunofluoresent stining. The rrows pointed out CCL17 nd CD11-expressing ells. Br = 2 μm (mgnifition: 1). N = 6 8 per group. P <., P <.1, P <.1 versus the PC. P <., P <.1, P <.1 versus the. *P <. versus. Dt re shown s men ± stndrd error of the men nd representtive of five independent experiments., negtive ontrol; OVA, ovlumin; PC, positive ontrol; TSLP, thymi stroml lymphopoietin. the pthologil findings from the lung setion, the inflmmtory infiltrtion in the -treted nd PC groups ws muh more severe thn tht in the nd Moleulr Therpy Nulei Aids -treted groups (Figure 4,d). These dt suggested tht TSLP modulted the reruitment of inflmmtory ells in the irwy.

7 TSLP-medited Inflmmtion Vi Epithelil CCL TSL PR expression (fold) CCL17 expression (fold) * TSLP (ng/ml) TSLP (ng/ml) Isotype ontrol TSLP: 1 ng/ml d 2 1 TSLP: ng/ml TSLP: 2 ng/ml CCL17 (pg/ml) 1 Polyrene mok shrna TSLP: ng/ml e 6 Counts CCL17 (pg/ml) 4 2 TSLPR Isotype As Control As αtslp As Figure 6 Thymi stroml lymphopoietin (TSLP) regulted the expression of CCL17 in vitro. () mrna levels nd () expressions of TSLPR were indued y TSLP. () The expression of CCL17 ws TSLP depend on. Primry epithelil ells (1 /well) were stimulted y different doses of TSLP (,, 1, nd 2 ng/ml) or (4 ng/ml). RNA ws olleted fter TSLP stimultion for 6 hours nd the expression of mrna ws ssessed y rel-time polymerse hin retion. The TSLPR expressions on ells fter TSLP stimultion for 48 hours were nlyzed y flow ytometry. *P <., P <.1 versus medium only. (d) Attenuted TSLP redued the expression of CCL17. **P <.1, P <.1 versus polyrene plus. P <.1 versus the plus. (e) Neutrlizing TSLP deresed CCL17 indution. Dt representtive of three independent experiments re shown s mens ± SEM. Redued TSLP in the irwy diminished the expressions of CCL17 in ronhil epithelium nd the migrtion of T ells Not only the levels of proinflmmtory ytokines ut lso the expression of CCL17 ws ffeted during the shrna tretment. The dt showed tht the levels of CCL17 mrna nd protein in lungs nd in BAL fluids were inresed respetively y OVA hllenges ut deresed y the omintion with the tretment (Figure,). CCL17 is ruil for Th2 reruitment to sthmti irwys. To investigte whether the derese of TSLP ffets the T-ell migrtion, CD4 + T ells were oultured with BAL fluids from the treted mie. The results showed tht ttenuted TSLP deresed the T-ell migrtion (Figure ). To further onfirm whether the redued T-ell migrtion ws due to redued CCL17, the BAL fluids were supplied nti-ccl17 ntiodies in migrtion ssy. The result presented out % derese nd the trend ws similr to the results of shrna tretment ( Figure d). These results suggested tht CCL17 plyed mjor role in n infiltrtion of T ell nd CCL17 might e regulted y TSLP. To lrify the soure of CCL17 in sthmti irwys, immunofluoresent stining ws used to detet the distriution of CCL17. The results showed tht CCL17 signifintly expressed in the ronhil epithelium nd DCs (CD11 + ells) of sthmti mie fter irwy hllenges. The expression of CCL17 produing DCs in the group ws less thn

8 8 TSLP-medited Inflmmtion Vi Epithelil CCL17 tht in the PC nd groups (Figure e). These findings indited tht TSLP might modulte the prodution of CCL17 to regulte the inflmmtion nd ell infiltrtion. Attenuted the level of TSLP deresed the prodution of CCL17 Sine the level of CCL17 ws inresed in the sthmti irwys, we further exmined whether CCL17 ws diretly indued y TSLP in irwy epithelil ells. It is well known tht proinflmmtory ytokines indue the expression of CCL17 in irwy epithelium ells. 28 Therefore, the tretment of TNFα ws used s the positive ontrol. We found tht TSLPR expressed on primry epithelil ells nd TSLP nd ould enhne the expression (Figure 6,). After high dose of TSLP, the mrna expression of CCL17 ws indued (Figure 6). However, TSLP lone ould not indue detetle level of CCL17 protein (dt not shown). To lrify the orreltion etween TSLP nd CCL17 under n inflmmtory ondition, primry epithelil ells were pretreted with nd then stimulted with. CCL17 levels were redued in the group (Figure 6d). To further define whether TSLP medited in CCL17 indution, the stimultion ws treted with neutrlizing TSLP ntiodies. The results showed tht the indution of CCL17 ws regulted y TSLP-dependent pthwy (Figure 6e). In summry, these results demonstrted tht epithelil CCL17 ws regulted y TSLP in epithelil ells. Disussion This study investigted the therpeuti effet of shrna ginst TSLP in llergeni sthm nd the rosstlk etween TSLP nd CCL17 in irwy inflmmtion. The ttenution of TSLP derived from epithelium signifintly redued irwy inflmmtion y lessening the tivtion of DCs nd deresing the prodution of epithelil CCL17. For the omplited immune network, reserhers further investigted the mehnisms to develop n effetive therpy for llergi diseses. Monolonl ntiody is n effetive therpy to speifilly trget the moleulr pthwys involved in the pthogenesis of vrious inflmmtory disorders. Studies suggested tht TSLP endows DCs with n ility to prime nïve T ells to Th2 differentition nd to produe hemokines CCL17 nd CCL22, reruiting Th2 ells to the drining LNs. Lol lokge of TSLP reeptor efore ntigen sensitiztion or hllenges signifintly redued eosinophil infiltrtion, golet ell hyperplsi, nd Th2 ytokine prodution vi inhiition of mturtion nd migrtion of irwy DCs. 14,1,29 Neutrliztion of TSLP in infetion of RSV lso inhiited inflmmtion nd AHR. 3 These reports suggested tht TSLP plyed key role in irwy inflmmtion vi regulting the funtion of DCs. However, some hllenges of engineered monolonl ntiodies, prtiulrly in immunity-relted dverse effets nd llergy (rsh, infusion retions), suggested tht detiled understnding of moleulr mehnisms is ruil. 31,32 The dvntges of the RNAi tehnique inlude less immunologil responses nd etter penetrtion into tissues to ler the unique hrteristis of the speifi genes. In this study, we found the llevition in the degree of irwy inflmmtion, the severity of AHR, nd in the mturtion of DCs ws similr to those of ntiody tretment. Although the levels of IL-4 nd IL- in the irwys were redued y tretment, the level of IL-13 ws not. This might e resulted from IL-13 produed y irwy epithelil ells. In ddition to its expression in Th2 ells, IL-13 ws onsistently produed y the irwy epithelium nd ws enhned y TSLP. 33 In this study, the irwy epithelil ells were inresed the expression of TSLPR y TSLP nd stimultion (Figure 6,). Even though epithelil TSLP ws ttenuted, the effet of IL-13 indution y TSLP in epithelium proly would not ompletely e eliminted. Furthermore, we found tht TSLP ffeted the expression of epithelil CCL17 nd this regultion might ply mediting role in irwy inflmmtion. Mny studies hve suggested tht CCL17 ws involved in AHR, irwy inflmmtion, nd ell infiltrtion. 21,34 CCL17 ws not only relesed from DCs ut lso promoted the mturtion of DCs vi positive feedk to enhne the polriztion of Th2 ells. 3,36 Knok-down of CCL17 during the mturtion of DCs deresed the reruitment of CD4 + T ells nd Tregs. 37 Reports showed tht the intertion of RSV nd Th2 ytokines tends to indue the expression of CCL17 vi NF-κB nd STAT6 pthwy respetively. 38 In oopertion with IL-4, TGF-β nd Der p indued the expression of CCL17 in irwy epithelium. 23 This study found tht TSLP lone ould not indue detetle level of CCL17 ut ould do so in vitro. The results suggest tht more severe inflmmtion is required for the indution of CCL17, nd this might explin why in the literture no rtile hs reported the ility of TSLP in regulting epithelil CCL17. Reserh showed tht the eosinophil in the peripherl lood expressed CCR4 (the CCL17 reeptor) nd the reruitment of eosinophil indued y TSLP is dependent on CCL17 (ref. 39 ). This study found tht the ronhil epithelium ws the min soure of CCL17 during llergen hllenges nd ttenuted TSLP redued the prodution of CCL17 to derese the ell reruitment. Therefore, TSLP might regulte CCL17-medited inflmmtion. Trgeting Th2 response is the mjor therpeuti pproh for sthm ut the pthophysiologil role of Th2 ytokines in these omplex irwy diseses remins unler. Reent studies showed tht Th2 ytokines relesed from ntigen-speifi T ells ould enhne the seretions of epithelil TSLP nd prodution of CCL17 in DCs to ugment inflmmtion. 4 In ddition, Th2 ytokines ould rogte TSLP-medited indution of CCR7, whih plys key role in the migrtion of DCs from inflmed tissues to the drining lymph nodes nd retin tive DCs in the inflmed tissue to further exerte lol inflmmtion. 41 Furthermore, TSLP signling in CD4 + T ells ws required for the Th2 memory formtion nd rell response to lol ntigen hllenges. 42 The Elimintion of CCR4 + ells vi CCL17-PE38 tretment suffiiently redued irwy inflmmtion nd AHR. 34 This study further found tht TSLP regulted not only the produtions of Th2 ytokines ut lso the expression of epithelil CCL17 to modulte Th2 responses. These findings might provide the onnetions of omplited network in immune responses nd intensify the therpeuti poteny of TSLP in llergi sthm. In summry, the results of this study lrified the reltionship etween TSLP nd CCL17 in irwy inflmmtion. Epithelium-derived TSLP indued y llergens nd proinflmmtory ytokines ws found to regulte epithelil CCL17 Moleulr Therpy Nulei Aids

9 TSLP-medited Inflmmtion Vi Epithelil CCL17 9 whih medites Th2 reruitment in irwy inflmmtion. Overll, the dt provided further evidene of the vitl role of TSLP in irwy inflmmtion nd its therpeuti vlue in treting llergi sthm. Mterils nd methods Protool of CCL17 nd TSLP indution. Femle Bl/ mie were otined from the Ntionl Lortory Animl Center in Tiwn, Tiwn. Lungs were isolted from Bl/ mie nd ut into 2 3 mm 3 nd ground in Minimum Essentil Medium-α omplete medium (Thermo Fisher Sientifi, Wlthm, MA) ontining 1% fetl ovine serum (FBS), 2 mmol/l L-glutmine, 1 unit/ml peniillin, 1 mg/ml streptomyin, nd.2 mg/ ml mphoteriin (Biologil industries, Kiutz Beit Hemek, Isrel) nd 2 mmol/l 4-(2-hydroxyethyl)-1-piperzineethnesulfoni id (ph 7.2). After lood ell deletion, ells were inuted for 1 14 dys. The primry ells were hrvested nd prepred for ssy. The phenotypi determintion of primry epithelil ells hs een desried previously. 27 In the ulture system, ells (1 /well) were strved overnight in the FBS-free medium. CCL17 indution ws treted with different doses of TSLP ( ~ 2 ng/ml, R&D, Minnepolis, MN) nd (4 ng/ ml, R&D) for 4 hours in fresh FBS-free medium nd the RNA extrtions were olleted ordingly. TSLP indution ws treted with different doses of ( ~ 4 ng/ml, R&D) for 4 hours in fresh FBS-free medium nd the RNA extrtions were olleted ordingly. Totl RNA ws performed with rndom hexmer primers nd Super-Sript III RNse H - reverse trnsriptse (Invitrogen, Crlsd, CA) to onvert to DNA. The expression of mouse CCL17 nd TSLP ws mesured y quntittive rel-time polymerse hin retion with TqMn gene expression ssys (Applied Biosystems, Crlsd, CA) in ABI PRISM 74 Sequene Detetor (Applied Biosystems, Foster City, CA). All levels of reported mrna were normlized to the glyerldehyde-3-phosphte dehydrogense mrna level. For the protein ssy, ells were strved nd stimulted following time ourse (CCL17: 72 hours; TSLP: 12, 24, nd 48 hours). For TSLP neutrliztion, the primry epithelil ells were stimulted y (4 ng/ml) ontining ontrol ntiodies or nti-tslp ntiodies (1 μg/ml, R&D) for 72 hours. The level of CCL17 or TSLP in the ultured superntnt ws mesured y enzyme-linked immunosorent ssy (ELISA; R&D) ording to the mnufturer-reommended protools. Preprtion of lentivirus ontining onstruted shrna ginst TSLP. The trgeting sequenes of mouse tslp gene were -1: AAGATTGTGGTATTCCTTCAT, -2: AACTTCACGTCAATTACGAAA nd -3: AAACCTA- ACTGTAGTAGGAAG. The ontrol sequene of ws GTCAGACTGTGCCATGACTG. The ontrol shrna hd no homologous gene in ny mouse gene. The proedure of lentivirl preprtion nd the virl titer were onduted s previously desried. 27 Determintion of suppressed effiieny of shrna. For RNA expression, the primry epithelil ells were infeted with mixture, inluding polyrene (8 μg/ml, Sigm, St Louis, MO) nd lentiviruses ontining shrna (multipliity of infetion: 1) for 48 hours nd were stimulted y (4 ng/ml) for 4 hours. The RNA extrtions were olleted nd the mrna of TSLP ws nlyzed y rel-time PCR. For the protein ssy, ells were infeted with lentivirus nd stimulted y t different time intervls (12, 24, nd 48 hours). Estlishment of murine model of sthm. Femle BALB/ mie (6 weeks old, n = 6 8 mie/group) were otined from the Animl Center of the College of Mediine, Ntionl Tiwn University, mintined on 12 hours light/drk yle nd provided food nd wter d liitum. All niml studies were pproved y the College of Mediine of Institutionl Animl Cre nd Use Committee. The mie were intrperitonelly sensitized y injetion of 2 μl phosphte-uffered sline (PBS) ontining µg of OVA (Sigm) nd 2 mg of luminum hydroxide (Sigm) on dy. Following two times of oost with 2 μg OVA in the sme dosge of djuvnt on dys 14 nd 28. After eqully rnking in the levels of OVA-speifi IgE, OVA-sensitized mie were hllenged dily y intrnsl dministrtion with OVA (1 µg) in µl PBS for 3 dys. Lentivirus ontining or mok shrna (3 1 6 infetious units) ws intrtrhelly delivered into the nesthetized nimls 3 dys efore the first hllenge with OVA. The PBS (positive ontrol) nd lentivirus ontining were used s the ontrols. The protool ws desried in Figure 2. During the 3-dy OVA hllenges, irwy resistne nd inflmmtory inditions were nlyzed. Determintion of the irwy resistne nd funtion. After performing trheostomy, the irwy resistne of the treted mie ws mesured s n inrese in pulmonry resistne fter hllenges with erosolized β-methholine (MCh, Sigm). The setting nd prmeters were s previously desried. 27 The resistne of the orotrhel tue (.4 mh 2 O.s.ml 1 ) ws sutrted from ll irwy resistne mesurements. Dt were expressed s the pulmonry resistne (RL) of the five independent experiments. Airwy retivity ws expressed s Penh nd mesured in unrestrined nimls y rometri whole-ody plethysmogrphy (Buxo, Troy, NY). In the eginning, the mie were pled in the hmers respetively nd seline redings were tken nd verged for 3 minutes. Aerosolized PBS or β-methholine in inresing onentrtions (3.12 mg/ ml) ws dministrted for 3 minutes. The redings were tken nd verged for 3 minutes fter eh neuliztion. Airwy retivity ws expressed s enhned puse (Penh) of the five independent experiments. Determintion of irwy inflmmtion nd histologil exmintion. Cells were hrvested from the BAL fluids, depleted RBC with ACK regent. The ells (1 /ml) were resuspended in PBS ontining 1% ovine serum lumin nd performed y ytospin. The ell slides were stined with the Liu stining nd totl of 3 ells on the slides were distinguished on ytologi preprtions under mirosopes. The superntnts of BAL fluids were ssyed y the ELISA ssy. The lungs were fixed with 1% formlin-pbs uffer nd prffin setions were prepred nd stined with hemtoxylin nd eosin to evlute the degree of infiltrting inflmmtory ells under mirosopes. The photomirogrphs of lung setions were quntified y Imge J softwre (NIH, v1.4). The infiltrtion perentges were lulted ording to the formul:

10 1 TSLP-medited Inflmmtion Vi Epithelil CCL17 (%) = (the numer of pixels within the defined re of ell prtiles/the totl numer of pixels within the field of view) 1 The verge of the four fields (1 mgnifition) of view ws used to determine ell infiltrtion in eh lung nlyzed. Determintion of ytokine prodution. The levels of IL-4, IL-, IL-13, IFN-γ, CCL17, nd eotxin in the BAL fluids were determined y the ELISA ssys (R&D) ording to the mnufturer-reommended protools. The prtil lungs were frozen nd smples of the frozen lungs were olleted y homogeniztion in lysis uffer (Cell Signling Tehnology, Dnvers, MA). Protein onentrtions were mesured y iinhonini id kit (Thermo sientifi, Rokford, IL). The levels of TSLP nd CCL17 in lung homogentes were determined y the ELISA ssys (R&D). Determintion of surfe mrkers on DCs. The lungs were isolted form treted mie nd digested s desried. 43 Tissues were dissoited nd single ells suspensions were otined. The following ntiody ws purhsed from BD Phrmingen (Frnklin Lkes, NJ): purified CD16/CD32 (F lok). The following ntiodies were purhsed from ebiosiene (Sn Diego, CA): nti-cd11 APC, nticd4 PE, nti-cd8 PE, nti-cd86 PE, nd isotype ontrol ntiodies. Lung DCs were stined with ntiodies nd nlyzed on FACSCliur flow ytometer (BD Immunoytometry Systems). Migrtion ssy. CD4 + T ells were isolted from the spleens of Bl/ mie using mgneti eds (BD Biosiene, Sn Jose, CA). Migrtion ssy ws performed using 96-well Trnswell pltes with. µm polyronte memrne (Corning Life Sienes, Corning). The lower hmer ws filled with the ulture medium (2 μl) ontining 1 μl superntnts of BAL fluids. CD4 + T ells (1 1 ) in the 1 μl ulture medium were pled in triplite in the upper hmer. After inution t 37 C for 4 hours, migrted ells in the lower hmer were ounted y flow ytometry. For CCL17 neutrliztion, ontrol ntiodies or nti-ccl17 ntiodies ( ng/ml, R&D) were dded into the lower hmer whih ws filled with the ulture medium (2 μl) ontining 1 μl superntnts of BAL fluids. Immunofluoresent stining. Lungs were perfused with PBS, fixed in 4% prformldehyde nd emedded in OCT. The frozen setions of 8 μm thikness were prepred for stining. The slides were wshed with PBS following methnol fixtion for 1 minutes t 2 C nd rinsed with PBS. Slides were inuted in loking solution (Biogenex, Fremont, CA) for 2 hours nd permeilized y.3% Triton X-1 in PBS for 3 minutes t RT. During inution with polylonl rit nti-mouse CCL17 (Dilution: 1:1, Bioss, Wourn, MA) in humid hmer overnight t 4 C, the ntigen detetion ws rried out with Alex-488 got ntirit IgG (Invitrogen) nd nti-cd11 PE (ebiosiene) for 2 hours. Negtive ontrol setions were proessed y omitting the speifi primry ntiody. The setions were dded mounting medi with DAPI (Vetor Lortories) nd overslip. The Immunofluoresent lelings were nlyzed using fluoresene mirosope (Zeiss Axio Imger) nd were visulized with Axio Vision. Determintion of ntigen-speifi ntiody. The levels of nti- OVA ntiody in ser were determined y the ELISA ssy ording to the protools set in the previous study. 27 Sttistil nlysis. All vlues were the men ± stndrd error of the men using one-wy nlysis of vrine followed y the Fisher proteted lest signifint differene test. The miniml level of signifine ws P vlue <.. Aknowledgments We would like to knowledge the servie provided y the DNA Sequening Core of the First Core Lortory, Ntionl Tiwn University College of Mediine. The uthors delre no ompeting finnil interests. Author ontriutions Y-L.C. performed the experiments, nlyzed the dt, nd wrote the mnusript. B-L.C. direted the projet. 1. Lloyd, CM nd Sglni, S (21). Epithelil ytokines nd pulmonry llergi inflmmtion. Curr Opin Immunol 34: Hmmd, H nd Lmreht, BN (28). Dendriti ells nd epithelil ells: linking innte nd dptive immunity in sthm. Nt Rev Immunol 8: Zhou, B, Comeu, MR, De Smedt, T, Liggitt, HD, Dhl, ME, Lewis, DB et l. (2). Thymi stroml lymphopoietin s key inititor of llergi irwy inflmmtion in mie. Nt Immunol 6: Al-Shmi, A, Spolski, R, Kelly, J, Kene-Myers, A nd Leonrd, WJ (2). A role for TSLP in the development of inflmmtion in n sthm model. J Exp Med 22: Omori, M nd Ziegler, S (27). Indution of IL-4 expression in CD4(+) T ells y thymi stroml lymphopoietin. J Immunol 178: Soumelis, V, Rehe, PA, Knzler, H, Yun, W, Edwrd, G, Homey, B et l. (22). Humn epithelil ells trigger dendriti ell medited llergi inflmmtion y produing TSLP. Nt Immunol 3: Hui, CC, Rust-Sllehy, S, Asher, I, Heroux, D nd Denurg, JA (214). The effets of thymi stroml lymphopoietin nd IL-3 on humn eosinophil-sophil linege ommitment: Relevne to topi sensitiztion. Immun Inflmm Dis 2: Sirus, MC, Senz, SA, Hill, DA, Kim, BS, Hedley, MB, Doering, TA et l. (211). TSLP promotes interleukin-3-independent sophil hemtopoiesis nd type 2 inflmmtion. Nture 477: Lei, L, Zhng, Y, Yo, W, Kpln, MH nd Zhou, B (211). Thymi stroml lymphopoietin interferes with irwy tolerne y suppressing the genertion of ntigen-speifi regultory T ells. J Immunol 186: Ziegler, SF (212). Thymi stroml lymphopoietin nd llergi disese. J Allergy Clin Immunol 13: Ying, S, O Connor, B, Rtoff, J, Meng, Q, Mllett, K, Cousins, D et l. (2). Thymi stroml lymphopoietin expression is inresed in sthmti irwys nd orreltes with expression of Th2-ttrting hemokines nd disese severity. J Immunol 174: Nguyen, KD, Vnihsrn, C nd Ndeu, KC (21). TSLP diretly impirs pulmonry Treg funtion: ssoition with errnt tolerogeni immunity in sthmti irwy. Allergy Asthm Clin Immunol 6: Hedley, MB, Zhou, B, Shih, WX, Aye, T, Comeu, MR nd Ziegler, SF (29). TSLP onditions the lung immune environment for the genertion of pthogeni innte nd ntigen-speifi dptive immune responses. J Immunol 182: Zhng, F, Hung, G, Hu, B, Song, Y nd Shi, Y (211). A solule thymi stroml lymphopoietin (TSLP) ntgonist, TSLPR-immunogloulin, redues the severity of llergi disese y regulting pulmonry dendriti ells. Clin Exp Immunol 164: Cheng, DT, M, C, Niewoehner, J, Dhl, M, Tsi, A, Zhng, J et l. (213). Thymi stroml lymphopoietin reeptor lokde redues llergi inflmmtion in ynomolgus monkey model of sthm. J Allergy Clin Immunol 132: Seki, H nd Tmki, K (26). Thymus nd tivtion regulted hemokine (TARC)/ CCL17 nd skin diseses. J Dermtol Si 43: Romgnni, S (22). Cytokines nd hemottrtnts in llergi inflmmtion. Mol Immunol 38: Bohner, BS, Hudson, SA, Xio, HQ nd Liu, MC (23). Relese of oth CCR4-tive nd CXCR3-tive hemokines during humn llergi pulmonry lte-phse retions. J Allergy Clin Immunol 112: Ktoh, S, Fukushim, K, Mtsumoto, N, Mtsumoto, K, Ae, K, Oni, N et l. (23). Aumultion of CCR4-expressing CD4+ T ells nd high onentrtion of its lignds Moleulr Therpy Nulei Aids

11 TSLP-medited Inflmmtion Vi Epithelil CCL17 11 (TARC nd MDC) in ronholveolr lvge fluid of ptients with eosinophili pneumoni. Allergy 8: Pnin-Bordignon, P, Ppi, A, Mrini, M, Di Lui, P, Csoni, G, Bellettto, C et l. (21). The C-C hemokine reeptors CCR4 nd CCR8 identify irwy T ells of llergenhllenged topi sthmtis. J Clin Invest 17: Kwski, S, Tkizw, H, Yoneym, H, Nkym, T, Fujisw, R, Izumizki, M et l. (21). Intervention of thymus nd tivtion-regulted hemokine ttenutes the development of llergi irwy inflmmtion nd hyperresponsiveness in mie. J Immunol 166: Sekiy, T, Miymsu, M, Imnishi, M, Ymd, H, Nkjim, T, Ymguhi, M et l. (2). Induile expression of Th2-type CC hemokine thymus- nd tivtion-regulted hemokine y humn ronhil epithelil ells. J Immunol 16: Heijink, IH, Mrel Kies, P, vn Oosterhout, AJ, Postm, DS, Kuffmn, HF nd Velleng, E (27). Der p, IL-4, nd TGF-et oopertively indue EGFR-dependent TARC expression in irwy epithelium. Am J Respir Cell Mol Biol 36: Tnk, J, Wtne, N, Kido, M, Sg, K, Akmtsu, T, Nishio, A et l. (29). Humn TSLP nd TLR3 lignds promote differentition of Th17 ells with entrl memory phenotype under Th2-polrizing onditions. Clin Exp Allergy 39: Kitjim, M nd Ziegler, SF (213). Cutting edge: identifition of the thymi stroml lymphopoietin-responsive dendriti ell suset ritil for initition of type 2 ontt hypersensitivity. J Immunol 191: Blek, B, Kzeros, A, Bkl, K, Gri-Medin, L, Adms, A, Liu, M et l. (21). Coexpression of type 2 immune trgets in sputum-derived epithelil nd dendriti ells from sthmti sujets. J Allergy Clin Immunol 136: e. 27. Chen, YL, Hung, HY, Lee, CC nd Ching, BL (214). Smll interfering RNA trgeting nerve growth ftor llevites llergi irwy hyperresponsiveness. Mol Ther Nulei Aids 3: e Terd, N, Nomur, T, Kim, WJ, Otsuk, Y, Tkhshi, R, Kishi, H et l. (21). Expression of C-C hemokine TARC in humn nsl muos nd its regultion y ytokines. Clin Exp Allergy 31: Shi, L, Leu, SW, Xu, F, Zhou, X, Yin, H, Ci, L et l. (28). Lol lokde of TSLP reeptor llevited llergi disese y regulting irwy dendriti ells. Clin Immunol 129: Hn, J, Dkhm, A, Ji, Y, Wng, M, Zeng, W, Tked, K et l. (212). Responsiveness to respirtory synytil virus in neontes is medited through thymi stroml lymphopoietin nd OX4 lignd. J Allergy Clin Immunol 13: e Smrnyke, H, Wirth, T, Shenkwein, D, Räty, JK nd Ylä-Herttul, S (29). Chllenges in monolonl ntiody-sed therpies. Ann Med 41: Gun, M, Zhou, YP, Sun, JL nd Chen, SC (21). Adverse events of monolonl ntiodies used for ner therpy. Biomed Res Int 21: Semlli, A, Jques, E, Koussih, L, Gounni, AS nd Chkir, J (21). Thymi stroml lymphopoietin-indued humn sthmti irwy epithelil ell prolifertion through n IL-13-dependent pthwy. J Allergy Clin Immunol 12: Honjo, A, Ogw, H, Azum, M, Tezuk, T, Sone, S, Birgyn, A et l. (213). Trgeted redution of CCR4+ ells is suffiient to suppress llergi irwy inflmmtion. Respir Investig 1: Ait Yhi, S, Azzoui, I, Everere, L, Vorng, H, Chenivesse, C, Mrquillies, P et l. (214). CCL17 prodution y dendriti ells is required for NOD1-medited exertion of llergi sthm. Am J Respir Crit Cre Med 189: Qio, J, Li, A nd Jin, X (211). TSLP from RSV-stimulted rt irwy epithelil ells tivtes myeloid dendriti ells. Immunol Cell Biol 89: Kng, S, Xie, J, M, S, Lio, W, Zhng, J nd Luo, R (21). Trgeted knok down of CCL22 nd CCL17 y sirna during DC differentition nd mturtion ffets the reruitment of T susets. Immunoiology 21: Monik, MM, Powers, LS, Hssn, I, Groskreutz, D, Yrovinsky, TO, Brrett, CW et l. (27). Respirtory synytil virus synergizes with Th2 ytokines to indue optiml levels of TARC/CCL17. J Immunol 179: Xie, F, Liu, LB, Shng, WQ, Chng, KK, Meng, YH, Mei, J et l. (21). The infiltrtion nd funtionl regultion of eosinophils indued y TSLP promote the prolifertion of ervil ner ell. Cner Lett 364: Hui, CC, Murphy, DM, Neighour, H, Al-Syegh, M, O Byrne, S, Thong, B et l. (214). T ell-medited indution of thymi stroml lymphopoietin in differentited humn primry ronhil epithelil ells. Clin Exp Allergy 44: Melum, GR, Frks, L, Sheel, C, Vn Dieren, B, Grn, E, Liu, YJ et l. (214). A thymi stroml lymphopoietin-responsive dendriti ell suset medites llergi responses in the upper irwy muos. J Allergy Clin Immunol 134: e Wng, Q, Du, J, Zhu, J, Yng, X nd Zhou, B (21). Thymi stroml lymphopoietin signling in CD4(+) T ells is required for TH2 memory. J Allergy Clin Immunol 13: e Suer, KA, Sholtes, P, Krwot, R nd Finotto, S (26). Isoltion of CD4+ T ells from murine lungs: method to nlyze ongoing immune responses in the lung. Nt Proto 1: This work is liensed under Cretive Commons Attriution-NonCommeril-NoDerivs 4. Interntionl Liense. The imges or other third prty mteril in this rtile re inluded in the rtile s Cretive Commons liense, unless indited otherwise in the redit line; if the mteril is not inluded under the Cretive Commons liense, users will need to otin permission from the liense holder to reprodue the mteril. To view opy of this liense, visit YL Chen nd BL Ching (216)