... Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. immunology letters to nature

Transcription

1 Supplementry informtion is ville in Nture s World-Wide We site ( or s pper opy from the London editoril offie of Nture. Aknowledgements Supported in prt y grnts from the NIH (A.A., C.B.W. nd A.S.) nd from the ysti firosis foundtion (C.B.W. nd A.H.). D.M.U. is n Irvington Institute postdotorl fellow. Correspondene nd requests for mterils should e ddressed to A.A. (e-mil: derem@u.wshington.edu). Tle 1 Bone minerl density BMD in metphysis (mg m 3 ) BMD in diphysis (mg m 3 ) Groups Totl Treulr Totl Treulr rg1 / 363:3 14:5 39:5 18:5 644:4 3:6 ND tl4 +/ rg1 / 379:6 7:3 291:5 15:6 626:4 17: 462:8 19:6 tl4 / rg1 / 32:7 14:9* 29:5 44:9* 529:8 3:4* 353: 1:8* Bone minerl density (BMD) ws mesured y peripherl quntittive omputted tomogrphy of tiil ones from rg1 / (n ¼ 3) nd rg1 / mie reonstituted with tl4 +/ (n ¼ 3) or tl4 / (n ¼ 3) one mrrow ells eight weeks fter ell trnsfer. * Sttistilly signifint differene etween different groups (Student s t-test: P :5). Vlues re given s the men s:d: ND, not determined. Nture 42, 34 39; Ativted T ells regulte one loss nd joint destrution in djuvnt rthritis through osteoprotegerin lignd Young-Yun Kong*, Ulrih Feige, Iidiko Srosi, Brd Bolon, Ann Tfuri*, Sen Morony, Csey Cpprelli, Ji Lik, Roin Elliottk, Susn MCek, Thoms Wong, Giuseppe Cmpgnuolo, Erik Morn#, Erl R. Bogoh#, Gwyneth Vn, Linh T. Nguyen, Pmel S. Ohshi, Dvid L. Ley, Elenor Fish, Willim J. Boylek & Josef M. Penninger* * Amgen Institute, 62 University Avenue, Toronto, Ontrio M5G 2C1, Cnd Deprtment of Phrmology, Pthology, nd k Cell Biology, Amgen In., One Amgen Center Drive, Thousnd Oks, Cliforni , USA Deprtment of Medil Genetis & Miroiology, # St Mihel s Hospitl Ontrio Cner Institute nd the Deprtments of Medil Biophysis nd Immunology, University of Toronto, Toronto, Ontrio, Cnd These uthors ontriuted eqully to this work Bone remodelling nd one loss re ontrolled y lne etween the tumour nerosis ftor fmily moleule osteoprotegerin lignd () nd its deoy reeptor osteoprotegerin (OPG) 1 3. In ddition, regultes lymph node orgnogenesis, lymphoyte development nd intertions etween T ells nd dendriti ells in the immune system 3 5. The reeptor, RANK, is expressed on hondroytes, osteolst preursors nd mture osteolsts 4,6. expression in T ells is indued y ntigen reeptor enggement 7, whih suggests tht tivted T ells my influene one metolism through nd RANK. Here we report tht tivted T ells n diretly trigger osteolstogenesis through. Systemi tivtion of T ells in vivo leds to n -medited inrese in osteolstogenesis nd one loss. In T-ell-dependent model of rt djuvnt rthritis hrterized y severe joint inflmmtion, one nd rtilge destrution nd rippling, loking of through osteoprotegerin tretment t the onset of disese prevents one nd rtilge destrution ut not inflmmtion. These results show tht oth systemi nd lol T-ell tivtion n led to prodution nd susequent one loss, nd they provide novel prdigm for T ells s regultors of one physiology. Remodelling of one involves the synthesis of one mtrix y osteolsts nd one resorption y osteolsts 8. Exessive osteolst tivity is oserved in mny osteopeni disorders hrterized y inresed one resorption nd rippling one dmge, inluding post-menopusl osteoporosis 9, Pget s disese 1 nd lyti one metstses 11. Lol or generlized one loss hs lso een reported in hroni infetions (heptitis, HIV) 12, leukemis 13, utoimmune nd llergi diseses 14, nd rheumtoid rthritis 15, suggesting tht n tivted immune system n ffet one physiology. Although ytokines, suh s tumour nerosis ftor (TNF), interleukin (IL)- 1, IL-11 nd IL-17 16, tht regulte immune funtions hve een implited in the regultion of one homeostsis, the moleulr mehnism y whih the immune system ffets one metolism hs never een estlished. Consistent with previous reports 7,17, we oserved tht (lso known s TRANCE, RANK-L or ODF) messenger RNA expression ws upregulted in murine T ells following ntigen reeptor enggement (Fig. 1). Speifi inhiitor studies showed tht indution of ws dependent on protein kinse C (PKC), phosphoinositide 3-kinse (PI3K) nd lineurin-medited signlling pthwys (Fig. 1). Expression of protein ws deteted on the surfes of tivted, ut not resting, T ells (Fig. 1). Ativted T ells lso sereted solule into ulture medium (Fig. 1), nd solule ws deteted y enzyme-linked immunosorent ssy (ELISA) ( 2:2 :2ngml 1 of in the ulture superntnt of CD4 + T ells tivted for 4 dys with CD3 plus CD28). To determine whether the sereted nd/or surfe forms of were funtionlly tive, we ssessed the ility of oth moleules to indue osteolstogenesis in vitro. Hemtopoieti one mrrow preursors from wild-type mie were o-ultured with tivted CD4 + T ells fixed with prformldehyde or with ulture superntnts from tivted T ells. Both memrne-ound nd solule supported osteolst development in vitro (Fig. 1d). Osteolstogenesis ws loked in oth ses in the presene of the physiologil deoy reeptor osteoprotegerin (OPG) (Fig. 1d). As ertin T-ell-derived ytokines n regulte expression in stroml ells, we neutrlized mny different ytokines inluding IL-1, TNF, IL-6, interferon (INF), IL-3, nd grnuloyte/ mrophge olony-stimulting ftor (GM-CSF), nd none of these ytokines proved ritil for in vitro osteolstogenesis in this ulture system, onfirming tht T-ell-derived is the ruil meditor. To exlude the possiility tht nother surfe reeptor on fixed T ells tivtes stroml ells for expression, we used spleen ells from neworn opgl / mie s soure of hemtopoieti preursors nd fixed wild-type CD4 + T ells. In this ulture, the only soure of is memrne-ound on the T ells. Wild-type T ells indued the formtion of trtrteresistnt id phosphtse (TRAP) + osteolsts from opgl / progenitor ells, nd osteolstogenesis ws inhiited y ddition of OPG (Fig. 1d). Osteolstogenesis ws onfirmed y detetion of the osteolst-speifi mrkers litonin reeptor (CTR), RANK (Fig. 1e), thepsin K (Fig. 1f) nd 3 -integrin (Fig. 1g). Thus, T- ell-triggered osteolsts disply typil osteolst phenotype (TRAP +, CTR +, thepsin K +, 3 -integrin +, RANK + ). These results provide geneti evidene tht tivted T ells n diretly trigger osteolstogenesis through memrne-ound nd solule. To evlute whether T-ell tivtion nd expression of ffet one physiology in vivo, we explored the phenotype of tl4 / mie, in whih T ells re spontneously tivted 18. All tl4 / mie displyed severe osteoporosis ompred with heterozygote littermtes (Fig. 2 d). To further explore the effet of spontneously tivted T ells on one metolism, we doptively trnsferred tl4 +/ or tl4 / one mrrow ells into lymphoyte-defiient 43

2 rg1 / mie 19 nd exmined one struture eight weeks fter the ell grft. rg1 / mie hve norml numers of osteolsts, norml one morphology nd norml one minerl densities (dt not shown). Trnsfer of tl4 / ells into rg1 / mie used signifint derese in totl nd treulr one minerl densities ompred with ontrol tl4 +/ rg1 / himers nd rg1 / mie (Tle 1). Histologilly, tl4 / rg1 / himeri mie exhiited extended resorption of treulr one elow the growth pltes nd epiphyses of the femur nd tii (Fig. 2e h). In ddition to deresed minerl density, tul one loss ws oserved y histomorphometry (Tle 2). Wheres only few TRAP + osteolsts were detetle in tl4 +/ rg1 / mie, osteolst numers were signifintly inresed in tl4 / rg1 / mie (Tle 2, nd Fig. 2i, j). We oserved similr loss in one fter trnsfer of purified tl4 / T ells into rg1 / mie nd trnsfer of purified tl4 / T ells into opgl / mie (dt not shown), implying tht tivted T ells n diretly use one loss in vivo. Dily injetion of tl4 / mie with the deoy reeptor OPG, whih loks tion, inresed one density nd signifintly redued the numer of osteolsts t the growth pltes (Tle 2, nd Fig. 2k, l). These results show tht 3 Medium αcd28 αcd3 αcd3/28 ontrol CD25 ConA PMA/C αcd3/28+ro αcd3/28+wt αcd3/28+pd αcd3/28+csa β-tin CD4 CD4 Medium IgG OPGF e / 2ng αcd3/28 IgG OPGF /sup-t /OPG /sup-t/opg Sereted CTR RANK β-tin d lone / 2ng ml 1 /sup-t / 5ng ml 1 /OPG / 1ng / 1ng /OPG f / 1ng / 1ng g Figure 1 Ativted T ells indue osteolstogenesis through., Purified CD4 + lymph-node T ells were tivted for 16 h with the indited stimuli in the presene or sene of the signlling inhiitors RO, WT, PD nd CsA (see Methods). nd -tin mrna expression were deteted y RT-PCR., Expression of on the surfes of T ells stimulted with nti-cd3 plus nti-cd28 ntiodies for 4 dys. expression ws deteted y FACS. CD25 expression is shown to ontrol for tivtion., Expression of sereted protein in superntnts of ontrol T ells (left) or T ells stimulted with nti-cd3 plus nti-cd28 for 2 dys (right). d, In vitro osteolstogenesis. Bone mrrow preursors from wild-type mie (top six pnels) nd neworn opgl / mie (ottom two pnels) were ultured with lone; plus ; plus superntnt of tivted T ells (sf-1/sup-t); plus fixed + CD4 + T ells (sf-1/pr-t); or Csf- 1 plus fixed + CD4 + T ells plus OPG (5 ng ml 1 ) (sf-1/pr-t/opg). Arrowheds show TRAP + osteolsts. e g, Clitonin reeptor (CTR), RANK, thepsin K nd 3 - integrin expression. Hemtopoieti progenitors from opgl / mie were ultured s ove. CTR, RANK nd -tin mrna expression were deteted y RT-PCR (e). Expression of thepsin K (f) nd 3 -integrin (g) ws deteted y immunostining. Arrows indite osteolsts. 44

3 systemi tivtion of T ells leds to one loss in vivo through. Arthritis in humns is hrterized y synovil inflmmtion, erosion of one nd rtilge, severe joint pin nd ultimtely lifelong rippling 15. In Lewis rts, experimentl indution of djuvntindued rthritis (AdA) leds to severe inflmmtion in the one mrrow nd soft tissues surrounding joints ompnied y extensive lol one nd rtilge destrution, loss of one minerl density nd rippling 2. This ondition in rts mimis mny of the linil nd pthologil fetures of humn rheumtoid rthritis. Lesions in AdA re stritly dependent on T-ell tivtion 21. Thus, we tested the role of in the pthogenesis of AdA rthritis in Lewis rts. protein ws expressed on the surfe of tivted T ells isolted from rts showing linil onset of rthritis, nd mrna ould e deteted in oth synovil ells nd inflmmtory ells y in situ hyridiztion. At the onset of disese, rthriti rts were either left untreted or treted with OPG for seven dys. Inhiition of through OPG hd no effet on the severity of inflmmtion (Fig. 3); however, OPG tretment ompletely olished the loss of minerl one density (Fig. 3). Histologilly, OPG-treted rthriti rts exhiited miniml loss of ortil nd treulr one, wheres untreted AdA nimls developed severe one lesions hrterized y prtil to omplete destrution of ortil nd treulr one, erosion of the rtiulr rtilges nd linil rippling (Fig. 4 f). Bone destrution in untreted rthriti rts orrelted with drmti inrese in osteolst numers, wheres OPG tretment prevented the umultion of osteolsts (Figs 3 nd 4e, f). These results show tht is key meditor of joint destrution nd one loss in djuvnt rthritis. Altertion of rtilge strutures leding to rtilge ollpse Tle 2 Numers of osteolsts in the ortil one Groups Numer of osteolsts Numer of osteolsts BA%TA in one re in totl re tl4 +/ 7:69 2:3 1:82 :73 23:5 3:4 tl4 / 77:69 23:12* 11:63 3:85* 14:4 1:7* tl4 / /OPG 33:52 12:18 4: 1:37 ND rg1 / 6:86 3:43 2:58 1:33 35:9 5:6 tl4 +/ rg1 / 18:81 13:12 7:74 6:9 33:7 5:4 tl4 / rg1 / 167:6 32:59 26:43 1:8 16:6 1:7 Osteolst numers (men s:e:m:; see Methods) were ounted in tiil ones from tl4 +/ (n ¼ 3), tl4 / (n ¼ 3) nd tl4 / mie injeted suutneously dily with OPG (1 mg kg 1 ody weight in PBS) on dys fter irth; nd rg1 / (n ¼ 3) nd rg1 / mie reonstituted with tl4 +/ (n ¼ 3) or tl4 / (n ¼ 3) one mrrow ells eight weeks fter ell trnsfer. Histomorphometry ws performed on ortil one in the diphysis of tiil ones nd is shown s men s:d: of one re (BA) s perentge of totl tissue re (TA). ND, not determined. * Sttistilly signifint differenes etween tl4 +/ nd tl4 / groups. Sttistilly signifint differenes etween tl4 / nd OPG-treted tl4 / groups. Sttistilly signifint differenes etween tl4 +/ rg1 / nd tl4 / rg1 / groups (Student s t- test; P :5). onstitutes ritil step in rthriti joint destrution. There is ontroversy out whether rtilge destrution ours independently of one loss, or whether dmge to the suhondrl one indiretly uses rtilge deteriortion 22,23. Beuse OPG tretment prevented one loss ut not inflmmtion, we nlysed the struturl integrity of joint rtilge. In untreted rthriti rts, prtil or omplete erosion of the rtilge mtrix in oth the entrl nd peripherl regions of joint surfes ws oserved, s ssessed y loss of toluidine lue stining (Fig. 4h). These erosions ourred in ssoition with destrution of the underlying ony plte. In striking ontrst, the integrity of rtilge ws preserved in OPGtreted rthriti rts (Fig. 4i). Whether OPG protets the rtilge d g h e f i j k l Figure 2 Ativted T ells ffet one physiology in vivo. d, Histology of femur (, ) nd tii (, d) oftl4 +/ (, ) nd tl4 / (, d) mie. Note signifintly redued thikness of ortil one in tl4 / mie. e h, Histology of femur (e, f) nd tii (g, h) from rg1 / mie reonstituted with tl4 +/ (e, g) nd tl4 = (f, h) one mrrow ells. Smples were nlysed eight weeks fter ell trnsfer. tl4 / rg1 / mie show extended resorption of treulr one elow the growth plte (rrows) nd in the epiphysis (sterix) of oth femur nd tii. i, j, Inresed numer of TRAP + osteolsts in tl4 / rg1 / (j) ompred with tl4 +/ rg1 / himers ðiþ. k, l, OPG tretment redues osteolst numers in tl4 / mie. tl4 / mie were injeted suutneously dily with PBS (k) or OPG (1 mg kg 1 ody weight in PBS) (l) on dys fter irth. Note the deresed numer of TRAP + osteolsts in the femur growth plte of OPG-treted tl4 / mie (l) (TRAP, 2 ). Stining: HE ( h); TRAP (i l). 45

4 indiretly y mintin the underlying suhondrl one or hs diret role in rtilge mintenne needs to e determined. In ddition, we hve found tht T ells isolted from joints of ll humn rheumtoid rthritis (n ¼ 2) nd ll osteorthritis (n ¼ 1) ptients express (see Supplementry Informtion). The signifine of T ell-derived in humn rthritis needs to e determined. These dt show tht is key regultor of one metolism, nd tht inhiition of tivity y OPG n prevent rtilge destrution, ritil, irreversile step in the pthogenesis of rthritis. Our results show tht tivted T ells n regulte systemi nd lol one loss through. In summry, tivted T ells produe nd n diretly trigger osteolstogenesis in vitro; tivted T ells from tl4 / mie hve destrutive effet on one minerl density in vivo tht n e reversed through inhiition of ; nd inhiition of through OPG n ompletely prevent one nd rtilge loss in T-ell-dependent rthritis model. In ddition, we hve found tht six out of seven spontneously rising T-ell lymphoms in mie express high levels of on T-ell surfes, nd tht these lymphom ells n diretly support in vitro osteolstogenesis (dt not shown). As mutnt mie lking T nd B ells exhiit norml one morphology nd one minerl densities, T ells re proly not required for norml 2.5 Pw swelling (ml) AdA OPG + + Lne BMD (g per m 2 ) NOC per mm 2.16 AdA OPG Norml AdA vehile OPG (mg kg 1 ) Figure 3 OPG loks one loss in djuvnt-indued rthritis (AdA)., Severity of inflmmtion ws lulted y mesuring the volume of hind pw swelling on dy 16 fter initition of disese. Lne 1, untreted ontrols; lne 2, OPG (1 mg kg 1 dy 1 ) tretment ut no AdA; lne 3, AdA ut no OPG tretment; lne 4, AdA plus OPG vehile ontrol; lne 5, AdA plus OPG (1 mg kg 1 dy 1 ). Men vlues of swelling (wter displement (ml)) s.d. re shown (n ¼ 6 per group). Pw swelling ws similr etween AdA nd AdA plus OPG groups t ll time points (dys 9 15)., Bone minerl density (BMD) of the tiiotrsl region ws determined on dy 16. Lnes re s in (). Men vlues of BMD s.d. re shown (n ¼ 6 per group)., Numers of osteolsts (NOC) per mm 2 of totl one re in the nviulr trsl one were determined on dy 16. For indution of AdA in Lewis rts nd dily suutneous injetions with solule OPG from dy 9 (onset of disese) to dy 15, see Methods. Figure 4 OPG prevents one nd rtilge destrution even in the presene of severe inflmmtion., d, Bone nd joint struture in the norml hind pw showing dense ony pltes, intt rtiulr rtilges nd mrrow vities ontining sttered hemtopoieti preursor ells. Proximl (p) distl (d) intertrsl joints., e, Disrupted one nd joint struture in AdA rts (dy 16) with severe mononuler infiltrtion in the one mrrow (sterisk), nd pnnus (rrow); dvned destrution (rrowheds) of ortil (), suhondrl (s) nd treulr (t) one; nd erosion of the rtiulr rtilges. The mrrow vity ontins mrked mononuler ell infiltrtion (sterisk) ontining numerous osteolsts (o). These rts show severe linil rippling., f, Preserved one nd joint struture of AdA rts (dy 16) treted with OPG (1 mg kg 1 dy 1 ) on dys OPGtreted rts exhiit extensive mononuler ell infiltrtion of one mrrow (sterisk) nd pnnus formtion (rrow), ut ortil (), suhondrl (s) nd treulr (t) one nd rtiulr rtilges re intt. Note the sene of osteolsts s ompred with non- OPG-treted rts (e). These rts do not show ny linil signs of rippling. g, Norml rtilge integrity in ontrol rts s determined y toluidine lue stining. The mtrix of norml rtiulr rtilge is uniformly stined, nd the underlying ony pltes re dense. h, Crtilge mtrix degenertion in AdA rts (dy 16). Uniform pllor (smll rrow) in the upper hlf of rtiulr rtilges denotes extensive loss of mtrix proteoglyns. Suhondrl (s), ortil () nd treulr (t) one is extensively eroded, nd the mrrow vity is filled with inflmmtory ells (sterisks). i, OPG tretment preserves mtrix proteoglyns of rthriti rts (dy 16) treted with OPG (1 mg kg 1 dy 1 ) on dys Note modest redution of toluidine lue stining in peripherl rtilge regions tht re in diret ontt with inflmed synovil tissue (sterisks) or pnnus (rrows). Suhondrl (s), ortil () nd treulr (t) one is intt. Stining: HE ( f); toluidine lue (g i). Mgnifitions: 5 ( ); 25 (d f); 75 (g i). 46

5 one homeostsis. Lol inflmmtion within the one due to metstsis, infetions or frtures, or joint inflmmtion in rthritis, however, ttrts T ells whih pper to tively prtiipte in one remodelling through prodution of. To our knowledge, our results provide the first definitive linkge etween tivted T ells nd one homeostsis nd tht systemi or lol tivtion of T ells triggers one loss through expression of. These findings provide the moleulr explntion for one loss ssoited with diseses hving immune-system involvement, suh s dult nd hildhood leukemis, utoimmunity nd vrious virl infetions suh s heptitis nd HIV. Thus, inhiition of funtion might meliorte mny osteopeni onditions nd prevent the one destrution nd rtilge dmge tht ultimtely use rippling in rthritis. Methods T-ell tivtion nd osteolstogenesis Purified ( 98% CD3 + ) CD8 + nd CD4 + T ells (1 6 per well) were seeded in Isove s modified Duleo medium (IMDM) nd stimulted with nti-cd3 (2 gml 1 ) nd nti-cd28 (2 ng ml 1 ) ntiodies (PhrMingen) in the sene or presene of the MAPK/ERK inhiitor PD9859 (PD, 4 M), the lineurin inhiitor ylosporin A (CsA, 1 ng ml 1 ), the PKC inhiitor RO (RO, 2 M) or the P13K inhiitor wortmnnin (WT, 2 M) for vrious times. mrna expression ws deteted y RT-PCR s desried 17. Memrne-ound ws deteted y doule stining using OPGfluoresein isothioynte (FITC) nd nti-cd4-pe or nti-cd8-pe. For CD25 (IL-2R hin) expression, ells were stined with nti-cd25-fitc nd nti-cd4-pe or nti-cd8- PE. Vile ells were olleted y FACS nlysis. For detetion of sereted protein, T ells (5 1 5 ) were stimulted with nti-cd3 (2 gml 1 ) plus nti-cd28 (2 ng ml 1 ) for 2 dys nd metolilly lelled with 1 Ci ml 1 of [ 35 S]methionine for the lst 1 min of inution. Lelled ws immunopreipitted from superntnts using either 1 gml 1 of humn OPG-F 1 or 1 g of isotype-mthed ontrol IgG. In ddition, sereted protein ws determined in superntnts of nti-cd3 nd nti-cd28 stimulted T ells (4 dys) y ELISA. expression on the surfe of T ells ws detetle 2 dys fter stimultion with nti-cd3 nd nti-cd28, nd mximum expression ws oserved t dy 4 of stimultion. Throughout the whole time of the o-ulture, expression of on fixed T ells ws stle (dt not shown). For in vitro osteolstogenesis, purified CD4 + T ells were stimulted for 4 dys with nti-cd3 plus nti-cd28 nd fixed with 2.5% prformldehyde. Fixed T ells (1 6 ells per well) were o-ultured with non-dherent hemtopoieti progenitors (1 5 ells well 1 ) from one mrrow ells of wild-type mie or spleen ells of neworn opgl / mie in the presene of 3 ng ml 1 olony-stimulting ftor-1 (; Genzyme) in flt-ottom 96-well plte. The solule deoy reeptor OPG (5 ng ml 1 ) ws dded to ontrol o-ultures to onfirm tht the oserved effets were medited y. OPG ws used s desried 1. Osteolst differentition ws evluted on dy 4 y ytohemil stining for TRAP, whih speifilly lels osteolsts with red dye, immunohistohemistry to detet Cthepsin K nd 3 -integrin, nd y RT-PCR for litonin reeptor (CTR) nd RANK expression. PCR primers were -tin sense; CACTGCCGCATCCTCTTCCTC; -tin ntisense, GCTGTCGCCTTCACCGTTCCA; litonin reeptor sense, ACAACTGCTGG CTGAGTG; litonin reeptor ntisense, GAAGCAGTAGATAGTCGCCAC; RANK sense, GCAACCTCCAGTCAGCA; RANK ntisense, GAAGTCACAGCCCTCAGAATC. To detet expression of 3 -integrin nd thepsin K protein, opgl / spleen ells were ultured with wild-type T ells for 4 dys, nd the expression ws deteted s desried 24. In vivo one remodelling tl4 / nd rg1 / gene-trgeted mie were k-rossed onto C57BL/6 kground for t lest eight genertions 18,19. For himers, one mrrow ells or purified lymph-node T ells from tl4 +/ nd tl4 / littermte mie were trnsferred into 6-week-old irrdited (3 rd) rg1 / nd into 6-week-old irrdited (5 rd) opgl / mie. Chimerism ws monitored y FACS stining for lelled monolonl ntiodies retive to surfe mrkers on T ells (nti-cd4, nti-cd8, nti-tcr) or B ells (nti-cd19, nti-b22, ntisigm) (ll from PhrMingen). In ll experiments, himerism of these mie ws more thn 9%. RAG-himeri mie were neropsied 8 1 weeks fter ell trnsfer. tl4 / T ell opgl / himers were neropsied 12 dys fter ell trnsfer. Bone minerl density ws determined s desried 2. Histology nd histomorphometry were done s desried 2. Osteolst numers were determined in :5 1: mm retngle re distl to the growth plte in the tii. The field of mesurement strted djent to the growth plte, in the entre of the mrrow vity not inluding the rtilge or ortil one. Adjuvnt-indued rthritis (AdA) Eight- to nine-week mle Lewis rts were given suutneous (s..) injetions of Myoterium tuerulosis (.5 mg emulsified in 5 l of prffin oil) into the se of the til (Difo Lortories, Detroit). At the onset of linil inflmmtion (dy 9 fter inoultion), nimls were injeted s.. with solule OPG (.16,.625 nd 1mgkg 1 dy 1 ) 1 on eh of dys On dy 16, nimls were killed nd one minerl density (BMD) of the tiiotrsl region ws determined y DexSn of the hind pws using dul-energy X-ry sorptiometer (Hologi QDR 45). Severity of inflmmtion ws monitored dily on dys 8 16 y mesuring the volume of hind pws y wter displement. Pws were proessed into prffin s desried ove, nd seril setions were stined with hemtoxylin nd eosin (HE) (to grde inflmmtory nd one destrutive hnges) nd toluidine lue (to ssess the integrity of rtilge y visulizing mtrix proteoglyns). Criteri for soring the extent of inflmmtion nd rtilge mtrix integrity hve een defined 2. Numers of osteolsts were ounted in the nviulr trsl one using histomorphometri mesurements y tring the setion imge onto digitizing plte with the id of mer luid nd Osteomesure (Osteometris In., Detur, GA) one nlysis softwre. Two seprte m regions of the tlus one were mesured for eh individul setion. Osteolsts inluded in the mesurement were identified morphologilly nd hd to e in ontt with one surfe. Experimentl results re reported s the verge numer of osteolsts (NOC) per mm 2 tissue of oth left nd right nkles. Animl experiments were in ordne with institutionl guidelines. Reeived 6 August; epted 23 Septemer Simonet, W. S. et l. Osteoprotegerin: novel sereted protein involved in the regultion of one density. Cell 89, (1997). 2. Ley, D. L. et l. Osteoprotegerin lignd is ytokine tht regultes osteolst differentition nd tivtion. Cell 93, (1998). 3. Kong, Y. Y. et l. is key regultor of osteolstogenesis, lymphoyte development nd lymphnode orgnogenesis. Nture 397, (1999). 4. Anderson, D. M. et l. A homologue of the TNF reeptor nd its lignd enhne T-ell growth nd dendriti-ell funtion. Nture 39, (1997). 5. Wong, B. r. et l. TRANCE (tumor nerosis ftor [TNF]-relted tivtion-indued ytokine), new TNF fmily memer predominntly expressed in T ells, is dendriti ell-speifi survivl ftor. J. Exp. Med. 186, (1997). 6. Hsu, H. et l. Tumor nerosis ftor reeptor fmily memer RANK medites osteolst differentition nd tivtion indued y osteoprotegerin lignd. Pro. Ntl Ad. Si. USA 96, (1999). 7. Wong, B. R. et l. TRANCE is novel lignd of the tumor nerosis ftor reeptor fmily tht tivtes -Jun N-terminl kinse in T ells. J. Biol. Chem. 272, (1997). 8. Felix, R., Hofstetter, W. & Cehini, M. G. Reent developments in the understnding of the pthophysiology of osteopetrosis. Eur. J. Endorinol. 134, (1996). 9. Roodmn, G. D. Advnes in one iology: the osteolst. Endor. Rev. 17, (1996). 1. Roodmn, G. D. Pget s disese nd osteolst iology. Bone 19, (1996). 11. Colemn, R. E., Smith, P. & Ruens, R. D. Clinil ourse nd prognosti ftors following one reurrene from rest ner. Br. J. Cner 77, (1998). 12. Stellon, A. J., Dvies, A., Compston, J. & Willims, R. Bone loss in utoimmune hroni tive heptitis on mintenne ortiosteroid therpy. Gstroenterology 89, (1985). 13. Oliveri, M. B., Mutlen, C. A., Rodriguez Fuhs, C. A. & Romnelli, M. C. Verterl ompression frtures t the onset of ute lympholsti leukemi in hild. Henry Ford Hosp. Med. J. 39, (1991). 14. Piepkorn, B. et l. Bone minerl density nd one metolism in dietes mellitus. Horm. Met. Res. 29, (1997). 15. Feldmnn, M., Brennn, F. M. & Mini, R. N. Role of ytokines in rheumtoid rthritis. Annu. Rev. Immunol. 14, (1996). 16. Kotke, S. et l. IL-17 in synovil fluids from ptients with rheumtoid rthritis is potent stimultor of osteolstogenesis. J. Clin. Invest. 13, (1999). 17. Josien, R., Wong, B. R., Li, H. L., Steinmn, R. M. & Choi, Y. TRANCE, TNF fmily memer, is differentilly expressed on T ell susets nd indues ytokine prodution in dendriti ells. J. Immunol. 162, (1999). 18. Wterhouse, P. et l. Lymphoprolifertive disorders with erly lethlity in mie defiient in Ctl-4. Siene 27, (1995). 19. Momerts, P. et l. RAG-1-defiient mie hve no mture B nd T lymphoytes. Cell 68, (1992). 2. Bendele, A. et l. Effiy of sustined lood levels of interleukin-1 reeptor ntgonist in niml models of rthritis: omprison of effiy in niml models with humn linil dt. Arthritis Rheum. 42, (1999). 21. Pnyi, G. S., Lnhury, J. S. & Kingsley, G. H. The importne of the T ell in inititing nd mintining the hroni synovitis of rheumtoid rthritis. Arthritis Rheum. 35, (1992). 22. Muller-Ldner, U., Gy, R. E. & Gy, S. Moleulr iology of rtilge nd one destrution. Curr. Opin. Rheumtol. 1, (1998). 23. Conwy, J. G. et l. Inhiition of rtilge nd one destrution in djuvnt rthritis in the rt y mtrix metlloproteinse inhiitor. J. Exp. Med. 182, (1995). 24. Fust, J. et l. Osteolst mrkers umulte on ells developing from humn peripherl lood mononuler preursors. J. Cell. Biohem. 72, 67 8 (1999). Supplementry informtion is ville on Nture s World-Wide We site ( nture.om) or s pper opy from the London editoril offie of Nture. Aknowledgements We thnk E. C. Keystone for providing ptient smples nd C. Dunstn for ritil omments. Tehnil ssistne ws provided y Y. Cheng, E. Julin, C. Burgh, A. Shhinin nd D. Durye. We re grteful to M. E. Sunders for sientifi editing nd A. Hessel, A. Oliveir dos Sntos, K. Bhmier, T. Sski nd ll other memers of the lortory for omments. Correspondene nd requests for mterils should e ddressed to J.M.P. (e-mil: jpenning@mgen.om). 47