... Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. immunology letters to nature
|
|
- Barnard Owens
- 5 years ago
- Views:
Transcription
1 Supplementry informtion is ville in Nture s World-Wide We site ( or s pper opy from the London editoril offie of Nture. Aknowledgements Supported in prt y grnts from the NIH (A.A., C.B.W. nd A.S.) nd from the ysti firosis foundtion (C.B.W. nd A.H.). D.M.U. is n Irvington Institute postdotorl fellow. Correspondene nd requests for mterils should e ddressed to A.A. (e-mil: derem@u.wshington.edu). Tle 1 Bone minerl density BMD in metphysis (mg m 3 ) BMD in diphysis (mg m 3 ) Groups Totl Treulr Totl Treulr rg1 / 363:3 14:5 39:5 18:5 644:4 3:6 ND tl4 +/ rg1 / 379:6 7:3 291:5 15:6 626:4 17: 462:8 19:6 tl4 / rg1 / 32:7 14:9* 29:5 44:9* 529:8 3:4* 353: 1:8* Bone minerl density (BMD) ws mesured y peripherl quntittive omputted tomogrphy of tiil ones from rg1 / (n ¼ 3) nd rg1 / mie reonstituted with tl4 +/ (n ¼ 3) or tl4 / (n ¼ 3) one mrrow ells eight weeks fter ell trnsfer. * Sttistilly signifint differene etween different groups (Student s t-test: P :5). Vlues re given s the men s:d: ND, not determined. Nture 42, 34 39; Ativted T ells regulte one loss nd joint destrution in djuvnt rthritis through osteoprotegerin lignd Young-Yun Kong*, Ulrih Feige, Iidiko Srosi, Brd Bolon, Ann Tfuri*, Sen Morony, Csey Cpprelli, Ji Lik, Roin Elliottk, Susn MCek, Thoms Wong, Giuseppe Cmpgnuolo, Erik Morn#, Erl R. Bogoh#, Gwyneth Vn, Linh T. Nguyen, Pmel S. Ohshi, Dvid L. Ley, Elenor Fish, Willim J. Boylek & Josef M. Penninger* * Amgen Institute, 62 University Avenue, Toronto, Ontrio M5G 2C1, Cnd Deprtment of Phrmology, Pthology, nd k Cell Biology, Amgen In., One Amgen Center Drive, Thousnd Oks, Cliforni , USA Deprtment of Medil Genetis & Miroiology, # St Mihel s Hospitl Ontrio Cner Institute nd the Deprtments of Medil Biophysis nd Immunology, University of Toronto, Toronto, Ontrio, Cnd These uthors ontriuted eqully to this work Bone remodelling nd one loss re ontrolled y lne etween the tumour nerosis ftor fmily moleule osteoprotegerin lignd () nd its deoy reeptor osteoprotegerin (OPG) 1 3. In ddition, regultes lymph node orgnogenesis, lymphoyte development nd intertions etween T ells nd dendriti ells in the immune system 3 5. The reeptor, RANK, is expressed on hondroytes, osteolst preursors nd mture osteolsts 4,6. expression in T ells is indued y ntigen reeptor enggement 7, whih suggests tht tivted T ells my influene one metolism through nd RANK. Here we report tht tivted T ells n diretly trigger osteolstogenesis through. Systemi tivtion of T ells in vivo leds to n -medited inrese in osteolstogenesis nd one loss. In T-ell-dependent model of rt djuvnt rthritis hrterized y severe joint inflmmtion, one nd rtilge destrution nd rippling, loking of through osteoprotegerin tretment t the onset of disese prevents one nd rtilge destrution ut not inflmmtion. These results show tht oth systemi nd lol T-ell tivtion n led to prodution nd susequent one loss, nd they provide novel prdigm for T ells s regultors of one physiology. Remodelling of one involves the synthesis of one mtrix y osteolsts nd one resorption y osteolsts 8. Exessive osteolst tivity is oserved in mny osteopeni disorders hrterized y inresed one resorption nd rippling one dmge, inluding post-menopusl osteoporosis 9, Pget s disese 1 nd lyti one metstses 11. Lol or generlized one loss hs lso een reported in hroni infetions (heptitis, HIV) 12, leukemis 13, utoimmune nd llergi diseses 14, nd rheumtoid rthritis 15, suggesting tht n tivted immune system n ffet one physiology. Although ytokines, suh s tumour nerosis ftor (TNF), interleukin (IL)- 1, IL-11 nd IL-17 16, tht regulte immune funtions hve een implited in the regultion of one homeostsis, the moleulr mehnism y whih the immune system ffets one metolism hs never een estlished. Consistent with previous reports 7,17, we oserved tht (lso known s TRANCE, RANK-L or ODF) messenger RNA expression ws upregulted in murine T ells following ntigen reeptor enggement (Fig. 1). Speifi inhiitor studies showed tht indution of ws dependent on protein kinse C (PKC), phosphoinositide 3-kinse (PI3K) nd lineurin-medited signlling pthwys (Fig. 1). Expression of protein ws deteted on the surfes of tivted, ut not resting, T ells (Fig. 1). Ativted T ells lso sereted solule into ulture medium (Fig. 1), nd solule ws deteted y enzyme-linked immunosorent ssy (ELISA) ( 2:2 :2ngml 1 of in the ulture superntnt of CD4 + T ells tivted for 4 dys with CD3 plus CD28). To determine whether the sereted nd/or surfe forms of were funtionlly tive, we ssessed the ility of oth moleules to indue osteolstogenesis in vitro. Hemtopoieti one mrrow preursors from wild-type mie were o-ultured with tivted CD4 + T ells fixed with prformldehyde or with ulture superntnts from tivted T ells. Both memrne-ound nd solule supported osteolst development in vitro (Fig. 1d). Osteolstogenesis ws loked in oth ses in the presene of the physiologil deoy reeptor osteoprotegerin (OPG) (Fig. 1d). As ertin T-ell-derived ytokines n regulte expression in stroml ells, we neutrlized mny different ytokines inluding IL-1, TNF, IL-6, interferon (INF), IL-3, nd grnuloyte/ mrophge olony-stimulting ftor (GM-CSF), nd none of these ytokines proved ritil for in vitro osteolstogenesis in this ulture system, onfirming tht T-ell-derived is the ruil meditor. To exlude the possiility tht nother surfe reeptor on fixed T ells tivtes stroml ells for expression, we used spleen ells from neworn opgl / mie s soure of hemtopoieti preursors nd fixed wild-type CD4 + T ells. In this ulture, the only soure of is memrne-ound on the T ells. Wild-type T ells indued the formtion of trtrteresistnt id phosphtse (TRAP) + osteolsts from opgl / progenitor ells, nd osteolstogenesis ws inhiited y ddition of OPG (Fig. 1d). Osteolstogenesis ws onfirmed y detetion of the osteolst-speifi mrkers litonin reeptor (CTR), RANK (Fig. 1e), thepsin K (Fig. 1f) nd 3 -integrin (Fig. 1g). Thus, T- ell-triggered osteolsts disply typil osteolst phenotype (TRAP +, CTR +, thepsin K +, 3 -integrin +, RANK + ). These results provide geneti evidene tht tivted T ells n diretly trigger osteolstogenesis through memrne-ound nd solule. To evlute whether T-ell tivtion nd expression of ffet one physiology in vivo, we explored the phenotype of tl4 / mie, in whih T ells re spontneously tivted 18. All tl4 / mie displyed severe osteoporosis ompred with heterozygote littermtes (Fig. 2 d). To further explore the effet of spontneously tivted T ells on one metolism, we doptively trnsferred tl4 +/ or tl4 / one mrrow ells into lymphoyte-defiient 43
2 rg1 / mie 19 nd exmined one struture eight weeks fter the ell grft. rg1 / mie hve norml numers of osteolsts, norml one morphology nd norml one minerl densities (dt not shown). Trnsfer of tl4 / ells into rg1 / mie used signifint derese in totl nd treulr one minerl densities ompred with ontrol tl4 +/ rg1 / himers nd rg1 / mie (Tle 1). Histologilly, tl4 / rg1 / himeri mie exhiited extended resorption of treulr one elow the growth pltes nd epiphyses of the femur nd tii (Fig. 2e h). In ddition to deresed minerl density, tul one loss ws oserved y histomorphometry (Tle 2). Wheres only few TRAP + osteolsts were detetle in tl4 +/ rg1 / mie, osteolst numers were signifintly inresed in tl4 / rg1 / mie (Tle 2, nd Fig. 2i, j). We oserved similr loss in one fter trnsfer of purified tl4 / T ells into rg1 / mie nd trnsfer of purified tl4 / T ells into opgl / mie (dt not shown), implying tht tivted T ells n diretly use one loss in vivo. Dily injetion of tl4 / mie with the deoy reeptor OPG, whih loks tion, inresed one density nd signifintly redued the numer of osteolsts t the growth pltes (Tle 2, nd Fig. 2k, l). These results show tht 3 Medium αcd28 αcd3 αcd3/28 ontrol CD25 ConA PMA/C αcd3/28+ro αcd3/28+wt αcd3/28+pd αcd3/28+csa β-tin CD4 CD4 Medium IgG OPGF e / 2ng αcd3/28 IgG OPGF /sup-t /OPG /sup-t/opg Sereted CTR RANK β-tin d lone / 2ng ml 1 /sup-t / 5ng ml 1 /OPG / 1ng / 1ng /OPG f / 1ng / 1ng g Figure 1 Ativted T ells indue osteolstogenesis through., Purified CD4 + lymph-node T ells were tivted for 16 h with the indited stimuli in the presene or sene of the signlling inhiitors RO, WT, PD nd CsA (see Methods). nd -tin mrna expression were deteted y RT-PCR., Expression of on the surfes of T ells stimulted with nti-cd3 plus nti-cd28 ntiodies for 4 dys. expression ws deteted y FACS. CD25 expression is shown to ontrol for tivtion., Expression of sereted protein in superntnts of ontrol T ells (left) or T ells stimulted with nti-cd3 plus nti-cd28 for 2 dys (right). d, In vitro osteolstogenesis. Bone mrrow preursors from wild-type mie (top six pnels) nd neworn opgl / mie (ottom two pnels) were ultured with lone; plus ; plus superntnt of tivted T ells (sf-1/sup-t); plus fixed + CD4 + T ells (sf-1/pr-t); or Csf- 1 plus fixed + CD4 + T ells plus OPG (5 ng ml 1 ) (sf-1/pr-t/opg). Arrowheds show TRAP + osteolsts. e g, Clitonin reeptor (CTR), RANK, thepsin K nd 3 - integrin expression. Hemtopoieti progenitors from opgl / mie were ultured s ove. CTR, RANK nd -tin mrna expression were deteted y RT-PCR (e). Expression of thepsin K (f) nd 3 -integrin (g) ws deteted y immunostining. Arrows indite osteolsts. 44
3 systemi tivtion of T ells leds to one loss in vivo through. Arthritis in humns is hrterized y synovil inflmmtion, erosion of one nd rtilge, severe joint pin nd ultimtely lifelong rippling 15. In Lewis rts, experimentl indution of djuvntindued rthritis (AdA) leds to severe inflmmtion in the one mrrow nd soft tissues surrounding joints ompnied y extensive lol one nd rtilge destrution, loss of one minerl density nd rippling 2. This ondition in rts mimis mny of the linil nd pthologil fetures of humn rheumtoid rthritis. Lesions in AdA re stritly dependent on T-ell tivtion 21. Thus, we tested the role of in the pthogenesis of AdA rthritis in Lewis rts. protein ws expressed on the surfe of tivted T ells isolted from rts showing linil onset of rthritis, nd mrna ould e deteted in oth synovil ells nd inflmmtory ells y in situ hyridiztion. At the onset of disese, rthriti rts were either left untreted or treted with OPG for seven dys. Inhiition of through OPG hd no effet on the severity of inflmmtion (Fig. 3); however, OPG tretment ompletely olished the loss of minerl one density (Fig. 3). Histologilly, OPG-treted rthriti rts exhiited miniml loss of ortil nd treulr one, wheres untreted AdA nimls developed severe one lesions hrterized y prtil to omplete destrution of ortil nd treulr one, erosion of the rtiulr rtilges nd linil rippling (Fig. 4 f). Bone destrution in untreted rthriti rts orrelted with drmti inrese in osteolst numers, wheres OPG tretment prevented the umultion of osteolsts (Figs 3 nd 4e, f). These results show tht is key meditor of joint destrution nd one loss in djuvnt rthritis. Altertion of rtilge strutures leding to rtilge ollpse Tle 2 Numers of osteolsts in the ortil one Groups Numer of osteolsts Numer of osteolsts BA%TA in one re in totl re tl4 +/ 7:69 2:3 1:82 :73 23:5 3:4 tl4 / 77:69 23:12* 11:63 3:85* 14:4 1:7* tl4 / /OPG 33:52 12:18 4: 1:37 ND rg1 / 6:86 3:43 2:58 1:33 35:9 5:6 tl4 +/ rg1 / 18:81 13:12 7:74 6:9 33:7 5:4 tl4 / rg1 / 167:6 32:59 26:43 1:8 16:6 1:7 Osteolst numers (men s:e:m:; see Methods) were ounted in tiil ones from tl4 +/ (n ¼ 3), tl4 / (n ¼ 3) nd tl4 / mie injeted suutneously dily with OPG (1 mg kg 1 ody weight in PBS) on dys fter irth; nd rg1 / (n ¼ 3) nd rg1 / mie reonstituted with tl4 +/ (n ¼ 3) or tl4 / (n ¼ 3) one mrrow ells eight weeks fter ell trnsfer. Histomorphometry ws performed on ortil one in the diphysis of tiil ones nd is shown s men s:d: of one re (BA) s perentge of totl tissue re (TA). ND, not determined. * Sttistilly signifint differenes etween tl4 +/ nd tl4 / groups. Sttistilly signifint differenes etween tl4 / nd OPG-treted tl4 / groups. Sttistilly signifint differenes etween tl4 +/ rg1 / nd tl4 / rg1 / groups (Student s t- test; P :5). onstitutes ritil step in rthriti joint destrution. There is ontroversy out whether rtilge destrution ours independently of one loss, or whether dmge to the suhondrl one indiretly uses rtilge deteriortion 22,23. Beuse OPG tretment prevented one loss ut not inflmmtion, we nlysed the struturl integrity of joint rtilge. In untreted rthriti rts, prtil or omplete erosion of the rtilge mtrix in oth the entrl nd peripherl regions of joint surfes ws oserved, s ssessed y loss of toluidine lue stining (Fig. 4h). These erosions ourred in ssoition with destrution of the underlying ony plte. In striking ontrst, the integrity of rtilge ws preserved in OPGtreted rthriti rts (Fig. 4i). Whether OPG protets the rtilge d g h e f i j k l Figure 2 Ativted T ells ffet one physiology in vivo. d, Histology of femur (, ) nd tii (, d) oftl4 +/ (, ) nd tl4 / (, d) mie. Note signifintly redued thikness of ortil one in tl4 / mie. e h, Histology of femur (e, f) nd tii (g, h) from rg1 / mie reonstituted with tl4 +/ (e, g) nd tl4 = (f, h) one mrrow ells. Smples were nlysed eight weeks fter ell trnsfer. tl4 / rg1 / mie show extended resorption of treulr one elow the growth plte (rrows) nd in the epiphysis (sterix) of oth femur nd tii. i, j, Inresed numer of TRAP + osteolsts in tl4 / rg1 / (j) ompred with tl4 +/ rg1 / himers ðiþ. k, l, OPG tretment redues osteolst numers in tl4 / mie. tl4 / mie were injeted suutneously dily with PBS (k) or OPG (1 mg kg 1 ody weight in PBS) (l) on dys fter irth. Note the deresed numer of TRAP + osteolsts in the femur growth plte of OPG-treted tl4 / mie (l) (TRAP, 2 ). Stining: HE ( h); TRAP (i l). 45
4 indiretly y mintin the underlying suhondrl one or hs diret role in rtilge mintenne needs to e determined. In ddition, we hve found tht T ells isolted from joints of ll humn rheumtoid rthritis (n ¼ 2) nd ll osteorthritis (n ¼ 1) ptients express (see Supplementry Informtion). The signifine of T ell-derived in humn rthritis needs to e determined. These dt show tht is key regultor of one metolism, nd tht inhiition of tivity y OPG n prevent rtilge destrution, ritil, irreversile step in the pthogenesis of rthritis. Our results show tht tivted T ells n regulte systemi nd lol one loss through. In summry, tivted T ells produe nd n diretly trigger osteolstogenesis in vitro; tivted T ells from tl4 / mie hve destrutive effet on one minerl density in vivo tht n e reversed through inhiition of ; nd inhiition of through OPG n ompletely prevent one nd rtilge loss in T-ell-dependent rthritis model. In ddition, we hve found tht six out of seven spontneously rising T-ell lymphoms in mie express high levels of on T-ell surfes, nd tht these lymphom ells n diretly support in vitro osteolstogenesis (dt not shown). As mutnt mie lking T nd B ells exhiit norml one morphology nd one minerl densities, T ells re proly not required for norml 2.5 Pw swelling (ml) AdA OPG + + Lne BMD (g per m 2 ) NOC per mm 2.16 AdA OPG Norml AdA vehile OPG (mg kg 1 ) Figure 3 OPG loks one loss in djuvnt-indued rthritis (AdA)., Severity of inflmmtion ws lulted y mesuring the volume of hind pw swelling on dy 16 fter initition of disese. Lne 1, untreted ontrols; lne 2, OPG (1 mg kg 1 dy 1 ) tretment ut no AdA; lne 3, AdA ut no OPG tretment; lne 4, AdA plus OPG vehile ontrol; lne 5, AdA plus OPG (1 mg kg 1 dy 1 ). Men vlues of swelling (wter displement (ml)) s.d. re shown (n ¼ 6 per group). Pw swelling ws similr etween AdA nd AdA plus OPG groups t ll time points (dys 9 15)., Bone minerl density (BMD) of the tiiotrsl region ws determined on dy 16. Lnes re s in (). Men vlues of BMD s.d. re shown (n ¼ 6 per group)., Numers of osteolsts (NOC) per mm 2 of totl one re in the nviulr trsl one were determined on dy 16. For indution of AdA in Lewis rts nd dily suutneous injetions with solule OPG from dy 9 (onset of disese) to dy 15, see Methods. Figure 4 OPG prevents one nd rtilge destrution even in the presene of severe inflmmtion., d, Bone nd joint struture in the norml hind pw showing dense ony pltes, intt rtiulr rtilges nd mrrow vities ontining sttered hemtopoieti preursor ells. Proximl (p) distl (d) intertrsl joints., e, Disrupted one nd joint struture in AdA rts (dy 16) with severe mononuler infiltrtion in the one mrrow (sterisk), nd pnnus (rrow); dvned destrution (rrowheds) of ortil (), suhondrl (s) nd treulr (t) one; nd erosion of the rtiulr rtilges. The mrrow vity ontins mrked mononuler ell infiltrtion (sterisk) ontining numerous osteolsts (o). These rts show severe linil rippling., f, Preserved one nd joint struture of AdA rts (dy 16) treted with OPG (1 mg kg 1 dy 1 ) on dys OPGtreted rts exhiit extensive mononuler ell infiltrtion of one mrrow (sterisk) nd pnnus formtion (rrow), ut ortil (), suhondrl (s) nd treulr (t) one nd rtiulr rtilges re intt. Note the sene of osteolsts s ompred with non- OPG-treted rts (e). These rts do not show ny linil signs of rippling. g, Norml rtilge integrity in ontrol rts s determined y toluidine lue stining. The mtrix of norml rtiulr rtilge is uniformly stined, nd the underlying ony pltes re dense. h, Crtilge mtrix degenertion in AdA rts (dy 16). Uniform pllor (smll rrow) in the upper hlf of rtiulr rtilges denotes extensive loss of mtrix proteoglyns. Suhondrl (s), ortil () nd treulr (t) one is extensively eroded, nd the mrrow vity is filled with inflmmtory ells (sterisks). i, OPG tretment preserves mtrix proteoglyns of rthriti rts (dy 16) treted with OPG (1 mg kg 1 dy 1 ) on dys Note modest redution of toluidine lue stining in peripherl rtilge regions tht re in diret ontt with inflmed synovil tissue (sterisks) or pnnus (rrows). Suhondrl (s), ortil () nd treulr (t) one is intt. Stining: HE ( f); toluidine lue (g i). Mgnifitions: 5 ( ); 25 (d f); 75 (g i). 46
5 one homeostsis. Lol inflmmtion within the one due to metstsis, infetions or frtures, or joint inflmmtion in rthritis, however, ttrts T ells whih pper to tively prtiipte in one remodelling through prodution of. To our knowledge, our results provide the first definitive linkge etween tivted T ells nd one homeostsis nd tht systemi or lol tivtion of T ells triggers one loss through expression of. These findings provide the moleulr explntion for one loss ssoited with diseses hving immune-system involvement, suh s dult nd hildhood leukemis, utoimmunity nd vrious virl infetions suh s heptitis nd HIV. Thus, inhiition of funtion might meliorte mny osteopeni onditions nd prevent the one destrution nd rtilge dmge tht ultimtely use rippling in rthritis. Methods T-ell tivtion nd osteolstogenesis Purified ( 98% CD3 + ) CD8 + nd CD4 + T ells (1 6 per well) were seeded in Isove s modified Duleo medium (IMDM) nd stimulted with nti-cd3 (2 gml 1 ) nd nti-cd28 (2 ng ml 1 ) ntiodies (PhrMingen) in the sene or presene of the MAPK/ERK inhiitor PD9859 (PD, 4 M), the lineurin inhiitor ylosporin A (CsA, 1 ng ml 1 ), the PKC inhiitor RO (RO, 2 M) or the P13K inhiitor wortmnnin (WT, 2 M) for vrious times. mrna expression ws deteted y RT-PCR s desried 17. Memrne-ound ws deteted y doule stining using OPGfluoresein isothioynte (FITC) nd nti-cd4-pe or nti-cd8-pe. For CD25 (IL-2R hin) expression, ells were stined with nti-cd25-fitc nd nti-cd4-pe or nti-cd8- PE. Vile ells were olleted y FACS nlysis. For detetion of sereted protein, T ells (5 1 5 ) were stimulted with nti-cd3 (2 gml 1 ) plus nti-cd28 (2 ng ml 1 ) for 2 dys nd metolilly lelled with 1 Ci ml 1 of [ 35 S]methionine for the lst 1 min of inution. Lelled ws immunopreipitted from superntnts using either 1 gml 1 of humn OPG-F 1 or 1 g of isotype-mthed ontrol IgG. In ddition, sereted protein ws determined in superntnts of nti-cd3 nd nti-cd28 stimulted T ells (4 dys) y ELISA. expression on the surfe of T ells ws detetle 2 dys fter stimultion with nti-cd3 nd nti-cd28, nd mximum expression ws oserved t dy 4 of stimultion. Throughout the whole time of the o-ulture, expression of on fixed T ells ws stle (dt not shown). For in vitro osteolstogenesis, purified CD4 + T ells were stimulted for 4 dys with nti-cd3 plus nti-cd28 nd fixed with 2.5% prformldehyde. Fixed T ells (1 6 ells per well) were o-ultured with non-dherent hemtopoieti progenitors (1 5 ells well 1 ) from one mrrow ells of wild-type mie or spleen ells of neworn opgl / mie in the presene of 3 ng ml 1 olony-stimulting ftor-1 (; Genzyme) in flt-ottom 96-well plte. The solule deoy reeptor OPG (5 ng ml 1 ) ws dded to ontrol o-ultures to onfirm tht the oserved effets were medited y. OPG ws used s desried 1. Osteolst differentition ws evluted on dy 4 y ytohemil stining for TRAP, whih speifilly lels osteolsts with red dye, immunohistohemistry to detet Cthepsin K nd 3 -integrin, nd y RT-PCR for litonin reeptor (CTR) nd RANK expression. PCR primers were -tin sense; CACTGCCGCATCCTCTTCCTC; -tin ntisense, GCTGTCGCCTTCACCGTTCCA; litonin reeptor sense, ACAACTGCTGG CTGAGTG; litonin reeptor ntisense, GAAGCAGTAGATAGTCGCCAC; RANK sense, GCAACCTCCAGTCAGCA; RANK ntisense, GAAGTCACAGCCCTCAGAATC. To detet expression of 3 -integrin nd thepsin K protein, opgl / spleen ells were ultured with wild-type T ells for 4 dys, nd the expression ws deteted s desried 24. In vivo one remodelling tl4 / nd rg1 / gene-trgeted mie were k-rossed onto C57BL/6 kground for t lest eight genertions 18,19. For himers, one mrrow ells or purified lymph-node T ells from tl4 +/ nd tl4 / littermte mie were trnsferred into 6-week-old irrdited (3 rd) rg1 / nd into 6-week-old irrdited (5 rd) opgl / mie. Chimerism ws monitored y FACS stining for lelled monolonl ntiodies retive to surfe mrkers on T ells (nti-cd4, nti-cd8, nti-tcr) or B ells (nti-cd19, nti-b22, ntisigm) (ll from PhrMingen). In ll experiments, himerism of these mie ws more thn 9%. RAG-himeri mie were neropsied 8 1 weeks fter ell trnsfer. tl4 / T ell opgl / himers were neropsied 12 dys fter ell trnsfer. Bone minerl density ws determined s desried 2. Histology nd histomorphometry were done s desried 2. Osteolst numers were determined in :5 1: mm retngle re distl to the growth plte in the tii. The field of mesurement strted djent to the growth plte, in the entre of the mrrow vity not inluding the rtilge or ortil one. Adjuvnt-indued rthritis (AdA) Eight- to nine-week mle Lewis rts were given suutneous (s..) injetions of Myoterium tuerulosis (.5 mg emulsified in 5 l of prffin oil) into the se of the til (Difo Lortories, Detroit). At the onset of linil inflmmtion (dy 9 fter inoultion), nimls were injeted s.. with solule OPG (.16,.625 nd 1mgkg 1 dy 1 ) 1 on eh of dys On dy 16, nimls were killed nd one minerl density (BMD) of the tiiotrsl region ws determined y DexSn of the hind pws using dul-energy X-ry sorptiometer (Hologi QDR 45). Severity of inflmmtion ws monitored dily on dys 8 16 y mesuring the volume of hind pws y wter displement. Pws were proessed into prffin s desried ove, nd seril setions were stined with hemtoxylin nd eosin (HE) (to grde inflmmtory nd one destrutive hnges) nd toluidine lue (to ssess the integrity of rtilge y visulizing mtrix proteoglyns). Criteri for soring the extent of inflmmtion nd rtilge mtrix integrity hve een defined 2. Numers of osteolsts were ounted in the nviulr trsl one using histomorphometri mesurements y tring the setion imge onto digitizing plte with the id of mer luid nd Osteomesure (Osteometris In., Detur, GA) one nlysis softwre. Two seprte m regions of the tlus one were mesured for eh individul setion. Osteolsts inluded in the mesurement were identified morphologilly nd hd to e in ontt with one surfe. Experimentl results re reported s the verge numer of osteolsts (NOC) per mm 2 tissue of oth left nd right nkles. Animl experiments were in ordne with institutionl guidelines. Reeived 6 August; epted 23 Septemer Simonet, W. S. et l. Osteoprotegerin: novel sereted protein involved in the regultion of one density. Cell 89, (1997). 2. Ley, D. L. et l. Osteoprotegerin lignd is ytokine tht regultes osteolst differentition nd tivtion. Cell 93, (1998). 3. Kong, Y. Y. et l. is key regultor of osteolstogenesis, lymphoyte development nd lymphnode orgnogenesis. Nture 397, (1999). 4. Anderson, D. M. et l. A homologue of the TNF reeptor nd its lignd enhne T-ell growth nd dendriti-ell funtion. Nture 39, (1997). 5. Wong, B. r. et l. TRANCE (tumor nerosis ftor [TNF]-relted tivtion-indued ytokine), new TNF fmily memer predominntly expressed in T ells, is dendriti ell-speifi survivl ftor. J. Exp. Med. 186, (1997). 6. Hsu, H. et l. Tumor nerosis ftor reeptor fmily memer RANK medites osteolst differentition nd tivtion indued y osteoprotegerin lignd. Pro. Ntl Ad. Si. USA 96, (1999). 7. Wong, B. R. et l. TRANCE is novel lignd of the tumor nerosis ftor reeptor fmily tht tivtes -Jun N-terminl kinse in T ells. J. Biol. Chem. 272, (1997). 8. Felix, R., Hofstetter, W. & Cehini, M. G. Reent developments in the understnding of the pthophysiology of osteopetrosis. Eur. J. Endorinol. 134, (1996). 9. Roodmn, G. D. Advnes in one iology: the osteolst. Endor. Rev. 17, (1996). 1. Roodmn, G. D. Pget s disese nd osteolst iology. Bone 19, (1996). 11. Colemn, R. E., Smith, P. & Ruens, R. D. Clinil ourse nd prognosti ftors following one reurrene from rest ner. Br. J. Cner 77, (1998). 12. Stellon, A. J., Dvies, A., Compston, J. & Willims, R. Bone loss in utoimmune hroni tive heptitis on mintenne ortiosteroid therpy. Gstroenterology 89, (1985). 13. Oliveri, M. B., Mutlen, C. A., Rodriguez Fuhs, C. A. & Romnelli, M. C. Verterl ompression frtures t the onset of ute lympholsti leukemi in hild. Henry Ford Hosp. Med. J. 39, (1991). 14. Piepkorn, B. et l. Bone minerl density nd one metolism in dietes mellitus. Horm. Met. Res. 29, (1997). 15. Feldmnn, M., Brennn, F. M. & Mini, R. N. Role of ytokines in rheumtoid rthritis. Annu. Rev. Immunol. 14, (1996). 16. Kotke, S. et l. IL-17 in synovil fluids from ptients with rheumtoid rthritis is potent stimultor of osteolstogenesis. J. Clin. Invest. 13, (1999). 17. Josien, R., Wong, B. R., Li, H. L., Steinmn, R. M. & Choi, Y. TRANCE, TNF fmily memer, is differentilly expressed on T ell susets nd indues ytokine prodution in dendriti ells. J. Immunol. 162, (1999). 18. Wterhouse, P. et l. Lymphoprolifertive disorders with erly lethlity in mie defiient in Ctl-4. Siene 27, (1995). 19. Momerts, P. et l. RAG-1-defiient mie hve no mture B nd T lymphoytes. Cell 68, (1992). 2. Bendele, A. et l. Effiy of sustined lood levels of interleukin-1 reeptor ntgonist in niml models of rthritis: omprison of effiy in niml models with humn linil dt. Arthritis Rheum. 42, (1999). 21. Pnyi, G. S., Lnhury, J. S. & Kingsley, G. H. The importne of the T ell in inititing nd mintining the hroni synovitis of rheumtoid rthritis. Arthritis Rheum. 35, (1992). 22. Muller-Ldner, U., Gy, R. E. & Gy, S. Moleulr iology of rtilge nd one destrution. Curr. Opin. Rheumtol. 1, (1998). 23. Conwy, J. G. et l. Inhiition of rtilge nd one destrution in djuvnt rthritis in the rt y mtrix metlloproteinse inhiitor. J. Exp. Med. 182, (1995). 24. Fust, J. et l. Osteolst mrkers umulte on ells developing from humn peripherl lood mononuler preursors. J. Cell. Biohem. 72, 67 8 (1999). Supplementry informtion is ville on Nture s World-Wide We site ( nture.om) or s pper opy from the London editoril offie of Nture. Aknowledgements We thnk E. C. Keystone for providing ptient smples nd C. Dunstn for ritil omments. Tehnil ssistne ws provided y Y. Cheng, E. Julin, C. Burgh, A. Shhinin nd D. Durye. We re grteful to M. E. Sunders for sientifi editing nd A. Hessel, A. Oliveir dos Sntos, K. Bhmier, T. Sski nd ll other memers of the lortory for omments. Correspondene nd requests for mterils should e ddressed to J.M.P. (e-mil: jpenning@mgen.om). 47
SUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationBATF regulates collagen-induced arthritis by regulating T helper cell differentiation
Prk et l. Arthritis Reserh & Therpy (218) 2:161 https://doi.org/1.1186/s1375-18-1658- RESEARCH ARTICLE Open Aess BATF regultes ollgen-indued rthritis y regulting T helper ell differentition Sng-Heon Prk
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationInhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity
2 Nture Pulishing Group http://www.nture.om/nturemediine Inhiiting Stt3 signling in the hemtopoieti system eliits multiomponent ntitumor immunity Mrin Kortylewski 1,4, Miej Kujwski 1,4, Tinhong Wng 2,
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationARTICLES. Host-reactive CD8 + memory stem cells in graft-versushost. Yi Zhang, Gerard Joe, Elizabeth Hexner, Jiang Zhu & Stephen G Emerson
Host-retive CD8 + memory stem ells in grft-versushost disese Yi Zhng, Gerrd Joe, Elizeth Hexner, Jing Zhu & Stephen G Emerson Grft-versus-host disese (GVHD) is used y lloretive donor T ells tht trigger
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationEssential role of NKT cells producing IL-4 and IL-13 in the development of allergen-induced airway hyperreactivity
Essentil role of NKT ells produing IL-4 nd IL-13 in the development of llergen-indued irwy hyperretivity OMID AKBARI 1, PHILIPPE STOCK 1, EVERETT MEYER 1, MITCHELL KRONENBERG 2, STEPHANE SIDOBRE 2, TOSHINORI
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationInsulin-like Growth Factor-binding Protein-7 (IGFBP7): A Promising Gene Therapeutic for Hepatocellular Carcinoma (HCC)
originl rtile The Amerin Soiety of Gene & Cell Therpy Insulin-like Growth Ftor-inding Protein-7 (IGFBP7): A Promising Gene Therpeuti for Heptoellulr Crinom (HCC) Dong Chen 1, Ayesh Siddiq 2, Luni Emdd
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationThe Effect of Curcumin on T Helper 1/T Helper 17 Balance in Rat Collagen-Induced Arthritis Model
Glol Journl of Phrmology 9 (1): 87-96, 2015 ISSN 1992-0075 IDOSI Pulitions, 2015 DOI: 10.5829/idosi.gjp.2015.9.1.92120 The Effet of Curumin on T Helper 1/T Helper 17 Blne in Rt Collgen-Indued Arthritis
More informationOPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis
OPGL is key regultor of osteolstogenesis, lymphoyte evelopment n lymph-noe orgnogenesis Young-Yun Kong*, Hiroki Yoshi*, Iliko Srosi², Hong-Lin Tn², Emm Timms³, Csey Cpprelli², Sen Morony², Antonio J. Oliveir-os-Sntos*,
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationANGPTL binding ANGPTL binding ANGPTL4 GST ANGPTL5 ANGPTL6 ANGPTL7. A5+LILRB2 Fc. A5+Tie-2 Fc 10,000 7,500. Tie-2 Fc LILRB2 Fc. 5,000 K d = 5.
doi:1.138/nture1195 ; Inhiitory reeptors ind ANGPTLs nd support < lood stem ells nd leukemi development Junke Zheng 1,2, Msto Umikw 1,3, Chngho Cui 1, Jiyun Li 1, Xioli Chen 1, Chozheng Zhng 1, HongDinh
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationSupplementary information for: Low bone mass and changes in the osteocyte network in mice lacking autophagy in the osteoblast lineage
Supplementry informtion for: Low one mss nd chnges in the osteocyte network in mice lcking utophgy in the osteolst linege Mrilin Piemontese, Meld Onl, Jinhu Xiong, Li Hn, Jeff D. Thostenson, Mri Almeid,
More informationAutocrine IL-2 is required for secondary population expansion of CD8 + memory T cells
Autorine IL-2 is required for seondry popultion expnsion of CD8 + memory T ells Soni Feu, Rmon Arens,2, Susn Togher & Stephen P Shoenerger 2 Nture Ameri, In. All rights reserved. Two ompeting theories
More informationPathogenesis of NSAID-induced gastric damage: Importance of cyclooxygenase inhibition and gastric hypermotility
Online Submissions: http://www.wjgnet.om/7-9327offie wjg@wjgnet.om doi:.3748/wjg.v18.i18.2147 World J Gstroenterol 12 My 14; 18(18): 2147-21 ISSN 7-9327 (print) ISSN 2219-28 (online) 12 Bishideng. All
More informationThioredoxin-interacting protein links oxidative stress to inflammasome activation
A rt i l e s Thioredoxin-interting protein links oxidtive stress to inflmmsome tivtion Rongin Zhou 1, Aury Trdivel 1, Bernrd Thorens 2, Inpyo Choi 3 & Jürg Tshopp 1 29 Nture Ameri, In. All rights reserved.
More informationOsteoblasts secrete Cxcl9 to regulate angiogenesis in bone
Reeived 2 De 215 Aepted 9 Nov 216 Pulished 14 De 216 DOI: 1.138/nomms13885 OPEN Osteolsts serete to regulte ngiogenesis in one Bin Hung 1,, Wenho Wng 1,, Qinghu Li 1,, Zhenyu Wng 1,BoYn 1, Zhongmin Zhng
More informationType II monocytes modulate T cell-mediated central nervous system autoimmunity
Type II monocytes modulte T cell-medited centrl nervous system utoimmunity Mrtin S. Weer, Thoms Prod homme, Swsn Youssef, Shnnon E. Dunn, Cynthi D. Rundle, Lind Lee, Jun C. Ptrroyo, Olf Stüve, Rymond A.
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More informationInvestigation the Effects of Curcumin on Serum Hepatic Enzymes Activity in a Rheumatoid Arthritis Model
Investigtion the Effets of Curumin on Serum Hepti Enzymes Ativity in Rheumtoid Arthritis Model Ftemeh Aghei Borshn 1,, Mino Ilkhnipoor 1, Mohmmd Hshemi 1, Frh Frrokhi 2 1 Deprtment of Biology, Fulty of
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nture07679 Emryonic Stem (ES) cell Hemngiolst Flk1 + Blst Colony 3 to 3.5 Dys 3-4 Dys ES differentition Sort of Flk1 + cells Supplementry Figure 1. Chrcteristion of lst colony development.
More informationRegulatory T cells prevent catastrophic autoimmunity throughout the lifespan of mice
Regultory T ells prevent tstrophi utoimmunity throughout the lifespn of mie Jeong M Kim 1, Jeffrey P Rsmussen 1 & Alexnder Y Rudensky 1,2 Mie lking the trnsription ftor ( ) lk regultory T (T reg ) ells
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationBTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1
BTLA is lymphoyte inhiitory reeptor with similrities to CTLA-4 nd PD-1 Norihiko Wtne 1,5, My Gvrieli 1, John R Sedy 1, Jinfei Yng 1,5, Frnes Fllrino 2, Susn K Loftin 1, Mihelle A Hurhl 1, Ntlie Zimmermn
More informationCombined AGE inhibition and ACEi decreases the progression of established diabetic nephropathy in B6 db/db mice
http://www.kidney-interntionl.org & 26 Interntionl Soiety of Nephrology originl rtile Comined AGE inhiition nd ACEi dereses the progression of estlished dieti nephropthy in B6 d/d mie F Zheng 1,2, Y-j
More informationTargeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma
Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn.216.29 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses
More informationOrigin of Triple hi and Triple lo T reg cells Triple hi and Triple lo T reg cells present in the thymus (Fig. 2a) could represent CD4 + GITR CD4 PD-1
Affinity for self ntigen selets with distint funtionl properties Len Wyss 1,2, Brin D Stdinski 3, Crolyn G King 1, Sonj Shllenerg 4, Nihols I MCrthy, Jun Young Lee 6,7, Krsten Kretshmer 4,8, Luigi M Terrino
More informationActivation of Akt as a Mechanism for Tumor Immune Evasion
The Amerin Soiety of Gene Therpy originl rtile Ativtion of Akt s Mehnism for Tumor Immune Evsion Kyung Hee Noh 1, Te Heung Kng 1, Jin Hee Kim 1, Sr I Pi 2, Ken Y Lin 3, Chien-Fu Hung 4, T-C Wu 4 7 nd Te
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1794 BR EPFs BRI1? ERECTA TMM BSKs YDA PP2A BSU1 BIN2 pbzr1/2 BZR1/2 MKK4/5/7/9 MPK3/6 SPCH Cell growth Stomtl production Supplementry Figure 1. The model of BR nd stomtl signling pthwys.
More informationChloride Nutrition Regulates Water Balance in Plants
XII Portuguese-Spnish Symposium on Plnt Wter Reltions Chloride Nutrition Regultes Wter Blne in Plnts Frno-Nvrro JD 1, Brumós J, Rosles MA 1, Vázquez-Rodríguez A 1, Sñudo BJ 1, Díz- Rued P 1, Rivero C 1,
More informationAlteration of peripheral blood lymphocyte subsets in acute pancreatitis
PO Box 2345, Beijing 123, Chin World J Gstroenterol 26 September 7; 12(33): 5344-5351 www.wjgnet.om World Journl of Gstroenterology ISSN 17-9327 wjg@wjgnet.om 26 The WJG Press. All rights reserved. CLINICAL
More informationA2A adenosine receptor protects tumors from antitumor T cells
A2A denosine reeptor protets tumors from ntitumor T ells Akio Oht*, Elieser Gorelik, Simon J. Prsd, Frn Ronhese, Dmitriy Lukshev*, Mihel K. K. Wong, Xiojun Hung, Sheil Cldwell**, Kein Liu**, Ptrik Smith*,
More informationSupplementary Information
Supplementry Informtion Cutneous immuno-surveillnce nd regultion of inflmmtion y group 2 innte lymphoid cells Ben Roediger, Ryn Kyle, Kwok Ho Yip, Nitl Sumri, Thoms V. Guy, Brin S. Kim, Andrew J. Mitchell,
More informationA1/Bfl-1 expression is restricted to TCR engagement in T lymphocytes
(3) 1, 19 17 & 3 Nture Pulishing Group All rights reserved 13-97/3 $. www.nture.om/dd /Bfl-1 expression is restrited to TCR enggement in T lymphoytes C Vershelde 1, T Wlzer, P Gli 1, M-C Biémont 1, L Quemeneur
More informationRegulation of NKT cell-mediated immune responses to tumours and liver inflammation by mitochondrial PGAM5-Drp1 signalling
Reeive Mr Aepte Aug Publishe 8 Sep DOI:.8/nomms97 Regultion of NKT ell-meite immune responses to tumours n liver inflmmtion by mitohonril PGAM-Drp signlling Young Jun Kng, Bo-Rm Bng, Kyung Ho Hn, Lixin
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationSpecific Immunotherapy in Atopic Dermatitis Four- Year Treatment in Different Age and Airborne Allergy Type Subgroups
At Dermtovenerol Crot 2006;14(4):230-240 CLINICAL ARTICLE Speifi Immunotherpy in Atopi Dermtitis Four- Yer Tretment in Different Age nd Airorne Allergy Type Sugroups Mgdlen Czrnek-Operz, Wojieh Silny Deprtment
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationToll-Like Receptor Activation during Cutaneous Allergen Sensitization Blocks Development of Asthma through IFN-Gamma-Dependent Mechanisms
ORIGINAL ARTICLE See relted ommentry on pg 874 Toll-Like Reeptor Ativtion during Cutneous Allergen Sensitiztion Bloks Development of Asthm through IFN-Gmm-Dependent Mehnisms Rit Hpkoski 1, Pii Krisol 1,
More informationFAK integrates growth-factor and integrin signals to promote cell migration
integrtes growth-ftor nd integrin signls to promote ell migrtion rtiles Dvid J. Sieg*, Christof R. Huk*, Dusko Ili, Cndie K. Klingeil*, Erik Shefer, Croline H. Dmsky nd Dvid D. Shlepfer* *Deprtment of
More informationEpiphyseal growth plate growth hormone receptor signaling is decreased in chronic kidney disease related growth retardation
http://www.kidney-interntionl.org & 213 Interntionl Soiety of Nephrology Epiphysel growth plte growth hormone reeptor signling is deresed in hroni kidney disese relted growth retrdtion Ariel Troi 1, Dniel
More informationPDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis
Supplementry Informtion PDGF-BB secreted y preosteoclsts induces ngiogenesis during coupling with osteogenesis Hui Xie, Zhung Cui, Long Wng, Zhuying Xi, Yin Hu, Lingling Xin, Chngjun Li, Ling Xie, Jnet
More informationEffects of Plant Sphingolipids on Inflammatory Stress in Differentiated Caco-2 Cells
Journl of Oleo Siene Copyright 2017 y Jpn Oil Chemists Soiety doi : 10.5650/jos.ess17171 J. Oleo Si. 66, (12) 1337-1342 (2017) NOTE Effets of Plnt Sphingolipids on Inflmmtory Stress in Differentited Co-2
More informationStable reprogrammed heterokaryons form spontaneously in Purkinje neurons after bone marrow transplant
Stle reprogrmmed heterokryons form spontneously in Purkinje neurons fter one mrrow trnsplnt Jmes M. Weimnn 1,2,Cls B. Johnsson 1,Angeli Trejo 1 nd Helen M. Blu 1,2 Heterokryons re the produt of ell fusion
More informationAUTHOR COPY ONLY. Glycogen synthase kinase 3b mediates high glucose-induced ubiquitination and proteasome degradation of insulin receptor substrate 1
Glyogen synthse kinse 3 medites high gluose-indued uiquitintion nd protesome degrdtion of insulin reeptor sustrte 1 171 Snhu Leng, Wenshuo Zhng, Ynin Zheng, Ziv Liermn 1, Christopher J Rhodes, Hgit Eldr-Finkelmn
More informationDepartment of Animal Resource and Science, Dankook University, Cheonan, Choongnam, , Republic of Korea
British Journl of Nutrition (1), 115, 57575 The Authors 1 doi:1.117/s711515857 Ltoillus idophilus modultes inflmmtory tivity y regulting the TLR nd NF-κB expression in porine peripherl lood mononuler ells
More informationnestin ironetin p75 s1 CNS SKPs Dermo-1 +ve SKPs CNS H2O SCGs Skin Di. SKPs TH SHOX2 GAPDH NCAM D H Figure S1, Immunoytohemil nlysis o SKP spheres ulture rom neontl mouse (nestin, ironetin, S-1) or rt
More informationInvolvement of thioredoxin-interacting protein (TXNIP) in glucocorticoid-mediated beta cell death
Dietologi (12) 55:148 157 DOI 1.7/s125-11-2422-z ARTICLE Involvement of thioredoxin-interting protein (TXNIP) in gluoortioid-medited et ell deth E. Reih & A. Tmry & R. Vogt Sionov & D. Melloul Reeived:
More informationResearch Article A Comparison of Inflammatory and Oxidative Stress Markers in Adipose Tissue from Weight-Matched Obese Male and Female Mice
Hindwi Pulishing Corportion Experimentl Dietes Reserh Volume 1, Artile ID 859395, 8 pges doi:1.1155/1/859395 Reserh Artile A Comprison of Inflmmtory nd Oxidtive Stress Mrkers in Adipose Tissue from Weight-Mthed
More informationLETTER. Impaired hydroxylation of 5-methylcytosine in myeloid cancers with mutant TET2
doi:.8/nture98 Impired hydroxyltion of -methylytosine in myeloid ners with mutnt TET Myunggon Ko {, Yun Hung {, Ann M. Jnkowsk, Utz J. Ppe,, Mmt Thilini, Hozef S. Bndukwl, Jungeun An {, Edwrd D. Lmperti,
More informationRNAi Targeting CXCR4 Inhibits Tumor Growth Through Inducing Cell Cycle Arrest and Apoptosis
originl rtile RNAi Trgeting CXCR4 Inhiits Tumor Growth Through Induing Cell Cyle Arrest nd Apoptosis To Yu 1,2, Yingying Wu 2, Yi Hung 1,2, Chorn Yn 1, Ying Liu 1, Zongsheng Wng 3, Xioyi Wng 1, Yuming
More informationIntervention with citrus flavonoids reverses obesity, and improves metabolic syndrome and
Intervention with itrus flvonoids reverses oesity, nd improves metoli syndrome nd theroslerosis in oese Ldlr -/- mie Authors: Amy C. Burke 1,2, Brin G. Sutherlnd 1, Dwn E. Telford 1,3, Mris R. Morrow 1,
More informationOocytes determine cumulus cell lineage in mouse ovarian follicles
133 Reserh tile Ooytes determine umulus ell linege in mouse ovrin folliles Frniso J. Diz, Kren Wigglesworth nd John J. Eppig* The Jkson Lortory, 6 Min Street, Br Hror, ME 469, USA *Author for orrespondene
More informationHydrodynamic Delivery of mil10 Gene Protects Mice From High-fat Diet-induced Obesity and Glucose Intolerance
originl rtile The Amerin Soiety of Gene & Cell Therpy Hydrodynmi Delivery of mil Gene Protets Mie From High-ft Diet-indued Oesity nd Gluose Intolerne Mingming Go, Chuno Zhng, Yongjie M, Le Bu, Linn Yn
More informationAntitumor Effects of Chimeric Receptor Engineered Human T Cells Directed to Tumor Stroma
The Amerin Soiety of Gene & Cell Therpy originl rtile Antitumor Effets of Chimeri Reeptor Engineered Humn T Cells Direted to Tumor Strom Sunith Kkrl 1,2,3, Kevin KH Chow 1,2,3, Melind Mt 1,2,4, Donld R
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationEffects of exercise training on hepatic steatosis in high fat diet-induced obese mice
Effets of exerise trining on hepti stetosis in high ft diet-indued oese mie Hyunsik Kng, PhD Sungkyunkwn University Non-Aloholi Ftty Liver Disese (NAFLD) A reversile ondition tht is hrterized y hepti lipid
More informationTNF-α (pg/ml) IL-6 (ng/ml)
Xio, et l., Supplementry Figure 1 IL-6 (ng/ml) TNF-α (pg/ml) 16 12 8 4 1,4 1,2 1, 8 6 4 2 med Cl / Pm3CSK4 zymosn curdln Poly (I:C) LPS flgelin MALP-2 imiquimod R848 CpG TNF-α (pg/ml) IL-6 (ng/ml) 2 1.6
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationRESEARCH COMMUNICATION. Interactions Between MTHFR C677T - A1298C Variants and Folic Acid Deficiency Affect Breast Cancer Risk in a Chinese Population
OI:http://dx.doi.org/1.71/PJP.2.1.5.21 Intertions etween MTHFR 77T - nd Foli id efiieny in rest ners in hin RSRH OMMUNITION Intertions etween MTHFR 77T - Vrints nd Foli id efiieny ffet rest ner Risk in
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationMiR-29a Assists in Preventing the Activation of Human Stellate Cells and Promotes Recovery From Liver Fibrosis in Mice
originl rtile The Amerin Soiety of Gene & Cell Therpy MiR-9 Assists in Preventing the Ativtion of Humn Stellte Cells nd Promotes Reovery From Liver Firosis in Mie Yoshinri Mtsumoto,,3, Sori Itmi, Mshiko
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More informationARTICLE. Keywords ACE-2. Akita mice. Angiotensinogen. Diabetes. Heterogeneous nuclear ribonucleoprotein F. Hypertension. Renal fibrosis.
Dietologi (5) 58:44 454 DOI.7/s5-5-7-y ARTICLE Overexpression of heterogeneous nuler rionuleoprotein F stimultes renl Ae- gene expression nd prevents TGF-β-indued kidney injury in mouse model of dietes
More informationLETTERS. Novel mutant-selective EGFR kinase inhibitors against EGFR T790M
Vol 462 24/31 Deemer 29 doi:1.138/nture8622 ovel mutnt-seletive kinse inhiitors ginst T79M Wenjun Zhou 1,2 *, Dli Ern 3,4 *, Ling Chen 3,4 *, Ci-Hong Yun 1,2 *, Dnn Li 3,4, Mrzi Cpelletti 3,4, Alexis B.
More informationOne-year Treatment of Morpholino Antisense Oligomer Improves Skeletal and Cardiac Muscle Functions in Dystrophic mdx Mice
originl rtile The Amerin Soiety of Gene & Cell Therpy One-yer Tretment of Morpholino Antisense Oligomer Improves Skeletl nd Crdi Musle Funtions in Dystrophi mdx Mie Bo Wu 1, Bin Xio 2,3, Cryn Cloer 1,
More informationMinimum effective dose of chenic acid for gallstone patients: reduction with bedtime administration and
Gut, 1982, 23, 28-284 Minimum effetive dose of heni id for gllstone ptients: redution with bedtime dministrtion nd low holesterol diet D P MUDGL, R M KUPFER, ND T C NORTHFIELD* From the Normn Tnner Gstroenterology
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationIntroduction to Study Designs II
Introdution to Study Designs II Commonly used study designs in publi helth & epidemiologi reserh Benjmin Rihrd H. Muthmbi, DrPH, MPH Stte HIV Epidemiologist HIV Epidemiology Investigtion Setion PA Deprtment
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nture1228 Totl Cell Numer (cells/μl of lood) 12 1 8 6 4 2 d Peripherl Blood 2 4 7 Time (d) fter nti-cd3 i.p. + TCRβ + IL17A + cells (%) 7 6 5 4 3 2 1 Totl Cell Numer (x1 3 ) 8 7 6 5 4 3 2 1 %
More informationRoles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells
ritish Journl of Cner (23) 89, 18 191 & 23 Cner Reserh UK All rights reserved 7 92/3 $2. www.jner.om Roles of the PI-3K nd MEK pthwys in Rs-medited hemoresistne in rest ner ells W Jin 1,LWu 1, K Ling 1,
More informationBacterial Pili exploit integrin machinery to promote immune activation and efficient blood-brain barrier penetration
Reeived Jun Aepted Aug Pulished 6 Sep DOI:.8/nomms7 Bteril Pili exploit integrin mhinery to promote immune tivtion nd effiient lood-rin rrier penetrtion Anirn Bnerjee, Brndon J. Kim,, Ellese M. Crmon,,
More informationEffect of lipopolysaccharide derived from surabaya isolates of Actinobacillus actinomycetemcomitans on alveolar bone destruction
Veterinry World, EISSN: 2231-0916 Aville t www.veterinryworld.org/vol.11/ferury-2018/11.pdf RESEARCH ARTICLE Open Aess Effet of lipopolyshride derived from sury isoltes of Atinoillus tinomyetemomitns on
More information