Adaptive phylogeography: functional divergence between haemoglobins derived from different glacial refugia in the bank vole
|
|
|
- Roger Holmes
- 5 years ago
- Views:
Transcription
1 Electronic supplementary material for: Adaptive phylogeography: functional divergence between haemoglobins derived from different glacial refugia in the bank vole Petr Kotlík, Silvia Marková, Libor Vojtek, Antonín Stratil, Vlastimil Šlechta, Pavel Hyršl and Jeremy B. Searle Supplementary figures Rodent phylogeny Rattus Mus Peromyscus Clethrionomys Coding sequence Rattus HBB-T3 87 Rattus HBB-T4 99 Rattus HBB-T2 85 Rattus HBB-T1 Mus HBB-T1 95 Mus HBB-T2 100 Peromyscus HBB-T Peromyscus HBB-T2 Clethrionomys HBB-T1 Clethrionomys HBB-T ' Untranslated region Rattus HBB-T1 99 Rattus HBB-T3 100 Rattus HBB-T2 97 Mus HBB-T1 Peromyscus HBB-T1 82 Clethrionomys HBB-T1 87 Rattus HBB-T4 97 Mus HBB-T2 82 Peromyscus HBB-T2 Clethrionomys HBB-T Figure S1. Orthologous relationships of the two bank vole (Clethrionomys) β-globin genes with those of house mouse (Mus), rat (Rattus) and deer mouse (Peromyscus). Separate maximum likelihood trees were constructed for the coding region sequences and for the sequences of the 3 untranslated region. While the phylogeny of the 3 untranslated region of each gene reflects the relationships between the species, the coding region sequences group together the paralogous genes from each species to the exclusion of the orthologous genes from the other species, likely due to a history of interparalog gene conversion. The HBB-T4 gene of rat is orthologous to HBB-T2 genes of house mouse, deer mouse and bank vole, while the HBB-T2 and HBB-T3 genes of rat are duplicates specific to this species [1]. Numbers along branches indicate the percent bootstrap frequencies. 1
2 Figure S2. Protein analysis of bank vole haemoglobin. (a) Precipitated globin polypeptides separated by urea-cellulose acetate electrophoresis demonstrating the β-globin polymorphism underlying Hb S and Hb F. Polypeptides encoded by HBA-T3 are not visible on this gel due to the low expression level. (b) Disulphide-mediated polymerization of Hb F, but not of Hb S, following thiol oxidation by diamide. The formation of the high-molecular-weight smear during starch-gel electrophoresis of the Hb F haemolysate, accompanied by a loss of the major band corresponding to tertrameric Hb, is reversed by 2-mercaptoethanol (2-ME), a disulphide-reducing agent. 2
3 Northern Cline Southern Devon Haplotype with conversion tract Ser52Cys Ser52Cys HBB-T1 HBB-T2 HBA-T1 HBA-T2 HBA-T3 Figure S3. Haplotype relationships for each bank vole α- and β-globin gene. Circle area is proportional to haplotype frequency, and circles are coded according to the presence of each haplotype at localities north of, south of, and within the haemoglobin frequency cline (figures 1 and S4), with Devon coded separately from other southern localities. Loops in the networks represent homoplasies, including possible recombination events. The Ser52Cys change is shown as black boxes and all other amino acid replacements as open boxes across branches. The Ser52Cys mutation is homoplasious in the HBB-T1 network and the dotted line connects its alternative occurrences. 3
4 1 0.8 Hb S frequency NYK YOR DNC Latitude ( N) Figure S4. Geographic cline of haemoglobin frequency plotted along latitude. The cline shape was estimated by fitting an asymmetric stepped model in ClineFit (for details see main text). The three localities in the cline are labelled according to table 1 and figure 1. 4
5 Supplementary tables Table S1. The origin of the samples and the frequency of the haemoglobin Hb F at each locality. code county/city country latitude longitude n Hb F frequency ABD Aberdeenshire Scotland HLD Highland Scotland AGB Argyll and Bute Scotland MLN Midlothian Scotland NYK North Yorkshire England YOR York England DNC Doncaster England CAM Cambridgeshire England GLS Gloucestershire England CON1 Cornwall England DEV Devon England CON2 Cornwall England
6 Table S2. Conserved mammalian primers used for PCR amplification from cdna. genes primer sequence reference α-globin PIKAHbA-F CTTCCCCACCACCAAGACCTAC [2] PIKAHbA-R TTAACGGTRTTTGGAGGTCAGC [2] β-globin PIKAHbB-F GAGGCCCTGGGCAGGCTGCTGG [2] PIKAHbB-R CCAGGAGCCTGAAGTTCTCAGG [2] Table S3. Bank vole primers used for RACE PCR. genes end primer sequence reference α-globin 5 RACE GSP4HBA AACGGTACTTGGAGGTCAGCACGGT this study 3 RACE GSP6HBA TGCGTGTGGACCCTGTSAACTTCAAGCTC this study β-globin 5 RACE GSP1_1HBB TGTCCAGGTGTTTCAGGCCGTCACCAAAGG this study 3 RACE GSP2_1HBB AGGTTCTTTGAACACTTTGGGGACCTG this study 6
7 Table S4. Paralogous gene-specific primer pairs used for PCR amplification and sequencing of bank vole globin genes from genomic DNA. genes paralog primer sequence reference α-globin HBA_T1 HBA1F20mis ACACACTTCTGATTCTGAGA this study D-2387R CAAAGACCAAGAGGTACAG [3] HBA_T2 D-1518 CTTGCTCTGCAGCGCACC [3] D-2387R CAAAGACCAAGAGGTACAG [3] HBA_T3 HBA17F21 CGGACTCAGGAAGGAATTCAT this study D-2387R CAAAGACCAAGAGGTACAG [3] β-globin HBB_T1 BT1F1 ACAYTTGCTTCTGACATAGT this study BT1R593 TGAAAGTAAATGCCTTTTATTAGT this study HBB_T2 MUS_BG_3'_F2 CTAGATGCCCAAAGGTCTTC [4] MUS_BG_3'_R2 GCCTGTGCCATAGCCACC [4] HBB10U19 ATGCACACCCTGGAATTGG this study HBB1266L21 GTGCATAAACACGAGCAAGAA this study 7
8 Table S5. Composite genotype frequencies for β-globin variants segregating at the HBB-T1 and HBB-T2 genes. HBB-T1 (site 52-site 58) HBB-T2 (site 52) ABD HLD AGB MLN NYK YOR DNC CAM GLS CON1 DEV CON2 Total Ser-Ala/Ser-Ala Ser/Ser Ser-Ala/Ser/Val Ser/Ser 1 1 Ser-Ala/Cys-Ala Ser/Ser Ser-Ala/Cys-Ala Ser/Cys 1 1 Ser-Ala/Cys-Val Ser/Ser 1 1 Ser-Val/Cys-Ala Ser/Ser Cys-Ala/Cys-Ala Ser/Ser Cys-Ala/Cys-Ala Ser/Cys Cys-Ala/Cys-Ala Cys/Cys Cys-Ala/Cys-Val Ser/Ser Cys-Ala/Cys-Val Ser/Cys Cys-Ala/Cys-Val Ser/Cys 1 1 Cys-Val/Cys-Val Ser/Ser
9 Table S6. RNA-seq expression levels of the two β-globin genes for three bank voles possessing different haemoglobin variants. haemoglobin variant HBB-T1 RPKM a HBB-T2 RPKM fold difference Z-test statistics p-value Hb S 1,528,574 80, <0.001 Hb F 1,558,147 51, <0.001 b Hb F/Hb S min 1,543,012 66, <0.001 a reads per kilobase per million mapped reads b individual with HBB-T2 encoding a minor β-chain isoform structurally identical to Hb S References 1. Hoffmann FG, Opazo JC, Storz JF New genes originated via multiple recombinational pathways in the β-globin gene family of rodents. Mol Biol. Evol. 25, Yingzhong Y YC, Guoen J, Zhenzhong B, Lan M, Haixia Y, Rili G Molecular cloning and characterization of hemoglobin alpha and beta chains from plateau pika (Ochotona curzoniae) living at high altitude. J. Biochem. Mol. Biol. 40, Storz JF, Sabatino SJ, Hoffmann FG, Gering EJ, Moriyama H, Ferrand N, Monteiro B, Nachman MW The molecular basis of high-altitude adaptation in deer mice. PLOS Genet. 3, Storz JF, Baze M, Waite JL, Hoffmann FG, Opazo JC, Hayes JP Complex signatures of selection and gene conversion in the duplicated globin genes of house mice. Genetics 177,
Biology 2C03: Genetics What is a Gene?
Biology 2C03: Genetics What is a Gene? September 9 th, 2013 Model Organisms - E. coli - Yeast - Worms - Arabodopsis - Fruitflie - Mouse What is a Gene? - Define, recognize, describe and apply Mendel s
Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference October 2017
Haemoglobinopathies case studies 11 th Annual Sickle Cell and Thalassaemia Conference 11 13 October 2017 Chris Lambert Haematology Service Delivery Manager Viapath Laboratories Kings College Hospital HUMAN
The unstable haemoglobins and haemolysis. Name Robin Carrell Haematology Department, University of Cambridge.
The unstable haemoglobins and haemolysis Name Robin Carrell Haematology Department, University of Cambridge. The unstable haemoglobins and haemolysis 1966-2016 : and the lessons they have taught us Köln
doi: /s
doi: 10.1007/s10528-008-9185-3 Lack of association of the HbE variant with protection from cerebral malaria in Thailand Izumi Naka 1, Jun Ohashi 1, Pornlada Nuchnoi 2, Hathairad Hananantachai 2, Sornchai
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.
Supplementary Figure 1 Preparation, crystallization and structure determination of EpEX. (a), Purified EpEX and EpEX analyzed on homogenous 12.5 % SDS-PAGE gel under reducing and non-reducing conditions.
In adults, the predominant Hb (HbA) molecule has four chains: two α and two β chains. In thalassemias, the synthesis of either the α or the β chains
Thalassaemias Thalassemia Thalassemia is an inherited autosomal recessive blood disease. Associated with absence or reduction in a or b globin chains. Reduced synthesis of one of the globin chains can
Report of Beta Thalassemia in Newar Ethnicity
Report of Beta Thalassemia in Newar Ethnicity Rajendra Dev Bhatt 1*, Surendra Koju 2, Prabodh Risal 1 Affiliations: 1 Department of Clinical Biochemistry, Dhulikhel Hospital, Kathmandu University Hospital
Haemoglobin BY: MUHAMMAD RADWAN WISSAM MUHAMMAD
Haemoglobin BY: MUHAMMAD RADWAN WISSAM MUHAMMAD Introduction is the iron-containing oxygen transport metalloprotein in the red blood cells Hemoglobin in the blood carries oxygen from the respiratory organs
Cahn - Ingold - Prelog system. Proteins: Evolution, and Analysis Lecture 7 9/15/2009. The Fischer Convention (1) G (2) (3)
Chapter 4 (1) G Proteins: Evolution, and Analysis Lecture 7 9/15/2009 A V L I M P F W Chapter 4 (2) S (3) T N Q Y C K R H D E The Fischer Convention Absolute configuration about an asymmetric carbon related
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:
Comprehensive Hemoglobin Analysis HBA1/2 (
Comprehensive Hemoglobin Analysis HBA1/2 ( α-globin) and HBB (β-globin) mutation and deletion/duplication analysis and HBD (δ-globin) and HBG1/2 (γ-globin) mutation analysis Description: Hemoglobin (Hb)
HbF Warm-Up. Describe an example of a mutation which is beneficial for the individual but deleterious for the individual s offspring.
Warm-Up Describe an example of a mutation which is beneficial for the individual but deleterious for the individual s offspring. Yesterday s Picture Aa AA aa Some variations (= mutations) are bad for the
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters
Next Generation Sequencing as a tool for breakpoint analysis in rearrangements of the globin-gene clusters XXXth International Symposium on Technical Innovations in Laboratory Hematology Honolulu, Hawaii
HEMOGLOBIN ELECTROPHORESIS DR ARASH ALGHASI SHAFA HOSPITAL-AHWAZ
HEMOGLOBIN ELECTROPHORESIS DR ARASH ALGHASI SHAFA HOSPITAL-AHWAZ Hemoglobin Hemoglobin (Hb), protein constituting 1/3 of the red blood cells Each red cell has 640 million molecules of Hb sites in the cells:
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
READ THIS FIRST. Your Name
Introduction to Biochemistry Final Examination - Individual (Part I) Monday, 24 May 2010 7:00 8:45 PM H. B. White Instructor 120 Points Your Name "Ability is what you're capable of doing. Motivation determines
Mouse Clec9a ORF sequence
Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
Haemoglobinopathy Case Studies. Dr Jill Finlayson Department of Haematology Pathwest Laboratory Medicine
Haemoglobinopathy Case Studies Dr Jill Finlayson Department of Haematology Pathwest Laboratory Medicine Case 1 KB, 36y M Refugee Afghanistan Screening bloods Hb 101 g/l RCC 3.75 x10 12 /L MCV 90 fl MCH
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular
Supplementary Figure-1. SDS PAGE analysis of purified designed carbonic anhydrase enzymes. M1-M4 shown in lanes 1-4, respectively, with molecular weight markers (M). Supplementary Figure-2. Overlay of
Diagnostic difficulties in prevention and control program for thalassemia in Thailand: atypical thalassemia carriers
Diagnostic difficulties in prevention and control program for thalassemia in Thailand: atypical thalassemia carriers Pranee Winichagoon Fucharoen Thalassemia Research Center Institute of Molecular Biosciences
Significance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
SUPPLEMENTARY INFORMATION
Supplementary text Collectively, we were able to detect ~14,000 expressed genes with RPKM (reads per kilobase per million) > 1 or ~16,000 with RPKM > 0.1 in at least one cell type from oocyte to the morula
1 Supplementary Figures
Supplementary Figures D. simulans (dsim) D. sechellia (dsec) D. melanogaster (dmel) S. cerevisiae (scer) S. paradoxus (spar) S. mikatae (smik) S. bayanus (sbay) S. castellii (scas) C. glabrata (cgla) K.
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research Shoude Jin Harbin Medical University, China Background COPD ------ a silent killer Insidious,
Article Preimplantation diagnosis and HLA typing for haemoglobin disorders
RBMOnline - Vol 11. No 3. 2005 362-370 Reproductive BioMedicine Online; www.rbmonline.com/article/1853 on web 20 July 2005 Article Preimplantation diagnosis and HLA typing for haemoglobin disorders Dr
Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.
SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock
Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
4 Fahed Al Karmi Sufian Alhafez Dr nayef karadsheh
4 Fahed Al Karmi Sufian Alhafez Dr nayef karadsheh Genetic variants of hemoglobin Hemoglobinopathies (abnormal variants of hemoglobin) are divided into: 1. Structural abnormalities: Any change in the genes
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in
Drug Metabolism Disposition
Drug Metabolism Disposition The CYP2C19 intron 2 branch point SNP is the ancestral polymorphism contributing to the poor metabolizer phenotype in livers with CYP2C19*35 and CYP2C19*2 alleles Amarjit S.
Practice Problems 3. a. What is the name of the bond formed between two amino acids? Are these bonds free to rotate?
Life Sciences 1a Practice Problems 3 1. Draw the oligopeptide for Ala-Phe-Gly-Thr-Asp. You do not need to indicate the stereochemistry of the sidechains. Denote with arrows the bonds formed between the
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
Antigen Presentation to T lymphocytes
Antigen Presentation to T lymphocytes Immunology 441 Lectures 6 & 7 Chapter 6 October 10 & 12, 2016 Jessica Hamerman jhamerman@benaroyaresearch.org Office hours by arrangement Antigen processing: How are
RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
SUPPLEMENTARY INFORMATION. Divergent TLR7/9 signaling and type I interferon production distinguish
SUPPLEMENTARY INFOATION Divergent TLR7/9 signaling and type I interferon production distinguish pathogenic and non-pathogenic AIDS-virus infections Judith N. Mandl, Ashley P. Barry, Thomas H. Vanderford,
Dr. Ayman Mohsen Mashi, MBBS Consultant Hematology & Blood Transfusion Department Head, Laboratory & Blood Bank King Fahad Central Hospital, Gazan,
Dr. Ayman Mohsen Mashi, MBBS Consultant Hematology & Blood Transfusion Department Head, Laboratory & Blood Bank King Fahad Central Hospital, Gazan, KSA amashi@moh.gov.sa 24/02/2018 β-thalassemia syndromes
This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points.
MBB 407/511 Molecular Biology and Biochemistry First Examination - October 1, 2002 Name Social Security Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is
Thalassemias:general aspects and molecular pathology
Thalassemias:general aspects and molecular pathology Prof. Renzo Galanello Pediatric Clinic 2 University of Cagliari Ospedale Regionale Microcitemie-ASL8 HEMOGLOBINOPATHIES CLASSIFICATION Structurally
EXTERNAL QUALITY ASSESSMENT FOR HAEMOGLOBIN A 2
EXTERNAL QUALITY ASSESSMENT FOR HAEMOGLOBIN A 2 Dr Barbara abaawild The importance of Hb A 2 measurement Accurate and reliable measurement of Hb A 2 is essential for the diagnosis of beta thalassaemia
3.1 Carbon is Central to the Living World
BIOL 100 Ch. 3 1 3.1 Carbon is Central to the Living World Carbon Central element to life Most biological molecules are built on a carbon framework. Organic molecules Humans 18.5% Carbon Why is Carbon
All mutations are alterations in the nucleotide sequence of DNA. At the molecular level, we can divide mutations into two categories:
Mutations Accurate DNA replication, transcription, and translation all depend on the reliable pairing of complementary bases. Errors occur, though infrequently, in all three processes least often in DNA
Anemia s. Troy Lund MSMS PhD MD
Anemia s Troy Lund MSMS PhD MD lundx072@umn.edu Hemoglobinopathy/Anemia IOM take home points. 1. How do we identify the condtion? Smear, CBC Solubility Test (SCD) 2. How does it present clincally? 3. How
6.1 Extended family screening
CHAPTER 6 CONCLUSION Cost benefit analysis of thalassemia screening programs have shown that the single years treatment for a β-thalassemia major patient was much higher than a total cost per case prevented.
Nature Genetics: doi: /ng.3731
Supplementary Figure 1 Circadian profiles of Adarb1 transcript and ADARB1 protein in mouse tissues. (a) Overlap of rhythmic transcripts identified in the previous transcriptome analyses. The mouse liver
SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice
SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,
SUPPLEMENTARY INFORMATION
Testing the accuracy of ancestral state reconstruction The accuracy of the ancestral state reconstruction with maximum likelihood methods can depend on the underlying model used in the reconstruction.
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
Introduction reduction in output alter the amino acid sequence combination
Sickle cell anemia. Introduction Mutations in the globin genes can cause a quantitative reduction in output from that gene or alter the amino acid sequence of the protein produced or a combination of the
Organic Chemistry 3540
rganic Chemistry 3540 December 8, 2004 (8 Pages, 13 Parts) ame 1. (8%) Many organic compounds found in living systems are complex molecules which can be characterized, in part, by simply listing the chemical
Multiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL
Multiple-Choice Questions Answer ALL 20 multiple-choice questions on the Scantron Card in PENCIL For Questions 1-10 choose ONE INCORRECT answer. 1. Which ONE of the following statements concerning the
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
Genetic Modulation on the Phenotypic Diversity of Sickle Cell Disease
Genetic Modulation on the Phenotypic Diversity of Sickle Cell Disease Malay B. Mukherjee Abstract Sickle cell hemoglobin is a β chain structural variant where valine is substituted for glutamic acid in
The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
Project Title: Study of molecular mechanisms to preserve codling moth control agents
FINAL PROJECT REPORT Project Title: Study of molecular mechanisms to preserve codling moth control agents PI: Stephen F. Garczynski Organization: USDA-ARS YARL Telephone: 509-454-6572 Email: steve.garczynski@ars.usda.gov
Sequencing in Newborn Screening Introduction and Background
Sequencing in Newborn Screening Introduction and Background Suzanne Cordovado, PhD Newborn Screening and Molecular Biology Branch Division of Laboratory Sciences Centers for Disease Control and Prevention
AP BIOLOGY: READING ASSIGNMENT FOR CHAPTER 5
1) Complete the following table: Class Monomer Functions Carbohydrates 1. 3. Lipids 1. 3. Proteins 1. 3. 4. 5. 6. Nucleic Acids 1. 2) Circle the atoms of these two glucose molecules that will be removed
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Corporate Medical Policy
Corporate Medical Policy Genetic Testing for Alpha Thalassemia File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_alpha_thalassemia 9/2013 7/2017 7/2018 7/2017 Description
Genotype analysis by Southern blots of nine independent recombinated ES cell clones by
Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with
CS612 - Algorithms in Bioinformatics
Spring 2016 Protein Structure February 7, 2016 Introduction to Protein Structure A protein is a linear chain of organic molecular building blocks called amino acids. Introduction to Protein Structure Amine
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Hemolytic anemias (2 of 2)
Hemolytic anemias (2 of 2) Sickle Cell Anemia The most common familial hemolytic anemia in the world Sickle cell anemia is the prototypical (and most prevalent) hemoglobinopathy Mutation in the β-globin
SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
Bio Factsheet. Proteins and Proteomics. Number 340
Number 340 Proteins and Proteomics Every living thing on the planet is composed of cells, and cells in turn are made of many types of molecules, including the biological molecules carbohydrates, lipids,
Genetic Modifiers of Sickle Cell Disease Severity. Kunle Adekile, MD, PhD Professor Department of Pediatrics Kuwait University
Genetic Modifiers of Sickle Cell Disease Severity Kunle Adekile, MD, PhD Professor Department of Pediatrics Kuwait University Outline Hb Molecule and Genetic control of globin synthesis Pathophysiology
Multi-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
The Basics: A general review of molecular biology:
The Basics: A general review of molecular biology: DNA Transcription RNA Translation Proteins DNA (deoxy-ribonucleic acid) is the genetic material It is an informational super polymer -think of it as the
Inference of Isoforms from Short Sequence Reads
Inference of Isoforms from Short Sequence Reads Tao Jiang Department of Computer Science and Engineering University of California, Riverside Tsinghua University Joint work with Jianxing Feng and Wei Li
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
HLA and antigen presentation. Department of Immunology Charles University, 2nd Medical School University Hospital Motol
HLA and antigen presentation Department of Immunology Charles University, 2nd Medical School University Hospital Motol MHC in adaptive immunity Characteristics Specificity Innate For structures shared
National Haemoglobinopathy Reference Laboratory. Information for Users
National Haemoglobinopathy Reference Laboratory Information for Users Summary The NHRL offers a service for the identification of haemoglobinopathy genotypes by the molecular analysis of DNA and haematological
(1373 Aspartic Acid >Asparagine)
J. med. Genet. (1968). 5, 107. Haemoglobin Korle-Bu (1373 Aspartic Acid >Asparagine) Showinga One of the Two Amino Acid Substitutions of Haemoglobin C Harlem F. I. D. KONOTEY-AHULU, E. GALLO*, H. LEHMANN,
Introduction to Biochemistry Midterm exam )ومن أحياها(
Introduction to Biochemistry Midterm exam 2016-2017 )ومن أحياها( 1. Which of the following amino (in a peptide chain) would probably be found at a beta bend or turn? a. lysine * b. Gly c. arg d. asn 2.
The Meaning of Genetic Variation
Activity 2 The Meaning of Genetic Variation Focus: Students investigate variation in the beta globin gene by identifying base changes that do and do not alter function, and by using several CD-ROM-based
1. What substance could be represented by the letter X in the diagram below?
1. What substance could be represented by the letter X in the diagram below? A) carbohydrates B) ozone C) carbon dioxide D) water 2. Base your answer to the following question on the diagram below. For
Clinical, haematological, and genetic studies of type 2
Journal of Medical Genetics 1988, 25, 195-199 Clinical, haematological, and genetic studies of type 2 normal Hb A2 thalassaemia ANNA METAXOTOU-MAVROMATI, CHRISTOS KATTAMIS, LILIAN MATATHIA, MARIA TZETIS,
LECTURE 32 GENETICS OF INVERSIONS. A. Pairing of inversion genotypes:
LECTURE 32 GENETICS OF INVERSIONS A. Pairing of inversion genotypes: 1. Characteristic inversion loops form only in chromosomal heterozygotes of both para- and pericentric inversions. Based on the inversion
HEMOLYTIC ANEMIA DUE TO ABNORMAL HEMOGLOBIN SYNTHESIS
Hemolytic Anemia Due to Abnormal Hemoglobin Synthesis MODULE 19 HEMOLYTIC ANEMIA DUE TO ABNORMAL HEMOGLOBIN SYNTHESIS 19.1 INTRODUCTION There are two main mechanisms by which anaemia is produced (a) Thalassemia:
2. Which of the following amino acids is most likely to be found on the outer surface of a properly folded protein?
Name: WHITE Student Number: Answer the following questions on the computer scoring sheet. 1 mark each 1. Which of the following amino acids would have the highest relative mobility R f in normal thin layer
a) The statement is true for X = 400, but false for X = 300; b) The statement is true for X = 300, but false for X = 200;
1. Consider the following statement. To produce one molecule of each possible kind of polypeptide chain, X amino acids in length, would require more atoms than exist in the universe. Given the size of
AMERICAN NATIONAL SCHOOL General Certificate of Education Advanced Subsidiary Level and Advanced Level
AMERIAN NATINAL SL General ertificate of Education Advanced Subsidiary Level and Advanced Level BILGY 9700/01 Paper 2 Structured Questions AS December 2009 lass A1 1 hour 15 minutes andidates answer on
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
Q1: Circle the best correct answer: (15 marks)
Q1: Circle the best correct answer: (15 marks) 1. Which one of the following incorrectly pairs an amino acid with a valid chemical characteristic a. Glycine, is chiral b. Tyrosine and tryptophan; at neutral
George R. Honig Junius G. Adams III. Human Hemoglobin. Genetics. Springer-Verlag Wien New York
George R. Honig Junius G. Adams III Human Hemoglobin Genetics Springer-Verlag Wien New York George R. Honig, M.D., Ph.D. Professor and Head Department of Pediatrics, College of Medicine University of Illinois
Sickle cell disease. Fareed Omar 10 March 2018
Sickle cell disease Fareed Omar 10 March 2018 Physiology Haemoglobin structure HbA2: 2α and 2δ chains (2-3%) HbF: 2α and 2γ chains (
Some Observations on Haemoglobin A 2
Some Observations on Haemoglobin A 2 Barbara J Bain St Mary s Hospital and Imperial College London Image from www.dsc.discovery.com Haemoglobin A 2 5 HBE1 HBG2 HBG1 HBD HBB LCRB ε G γ A γ ψβ δ β 3 5 LCRA
Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
Supplementary Information. Preferential associations between co-regulated genes reveal a. transcriptional interactome in erythroid cells
Supplementary Information Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells Stefan Schoenfelder, * Tom Sexton, * Lyubomira Chakalova, * Nathan
BIO 311C Spring Lecture 15 Friday 26 Feb. 1
BIO 311C Spring 2010 Lecture 15 Friday 26 Feb. 1 Illustration of a Polypeptide amino acids peptide bonds Review Polypeptide (chain) See textbook, Fig 5.21, p. 82 for a more clear illustration Folding and
Thalassemias. Emanuela Veras, M.D. 01/08/2006
Thalassemias Emanuela Veras, M.D. 01/08/2006 Structure and Function of normal Hemoglobin molecules: 2/3 1/3 β: increases from 6 th week of fetal life to 12 months of age At birth: HbF: 75-90% HbA: 10-25%
f(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14
SURVEILLANCE TECHNICAL
CHAPTER 5 SURVEILLANCE TECHNICAL ASPECTS 55 Protect - detect - protect Polio eradication strategies can be summed up as protect and detect protect children against polio by vaccinating them, and detect
MRC-Holland MLPA. Description version 14; 28 September 2016
SALSA MLPA probemix P279-B3 CACNA1A Lot B3-0816. As compared to version B2 (lot B2-1012), one reference probe has been replaced and the length of several probes has been adjusted. Voltage-dependent calcium