Alper Sarikaya 1, Michael Correll 2, Jorge M. Dinis 1, David H. O Connor 1,3, and Michael Gleicher 1

Size: px
Start display at page:

Download "Alper Sarikaya 1, Michael Correll 2, Jorge M. Dinis 1, David H. O Connor 1,3, and Michael Gleicher 1"

Transcription

1 Alper Sarikaya 1, Michael Correll 2, Jorge M. Dinis 1, David H. O Connor 1,3, and Michael Gleicher 1 1 University of Wisconsin-Madison 2 University of Washington 3 Wisconsin National Primate

2 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work

3 RNA viruses are very error prone in replication Viruses accumulate variation to help its survival Influenza, H1N1, Zika are hard to eliminate

4

5 Discover where functional shifts are occurring

6 Identify co-occurrences of mutations in genome

7 Identify groups of like-behaving subpopulations

8

9

10

11 Identify pairs of positions where mutations co-occur Analysis requires a maximum of sifting through (# positions) 2 correlations

12 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work

13

14

15

16

17

18

19

20

21 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work

22 Collect counts of bases (A, C, T, G) for each pair of positions

23 Compute co-occurrence strength between every pair of genomic positions

24 Overview Super-zoom Show co-occurrences in full pairwise genomic space, in a web browser Scale up to 20,000 x 20,000 Color shows the co-occurrence strength Pairwise genomic space Key

25 Show co-occurrences in full pairwise genomic space, in a web browser Scale up to 20,000 x 20,000 Color shows the co-occurrence strength

26 Too much data to sift through Alignment errors produce false positives Difficult to get an overview

27 Always present data in genomic sequence order Display annotations alongside genome Scaffold to navigate space of all pairwise correlation Support identifying synonymy

28 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work

29 Coverage (read depth) Variation (mutations) Co-occurrence strength

30

31 User-controlled metrics

32 Annotations Positions with significant co-occurrences

33 Pairwise co-occurrences with a particular position

34 Reads that do not overlap with the paired position

35

36

37 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work

38 Sample of : simian equivalent of HIV Large cluster of correlated mutations in Nef protein to evade T cell recognition Nearly no co-occurrences in structural proteins Gal & Pol

39 Use analyst-controlled metrics to focus exploration Displaying the full space does not necessarily empower analysts Providing usable context and scaffolding

40 Support comparison between multiple samples, and multi-step co-occurrence Data aggregation and filtering techniques to support larger data sizes Application to other event-driven sequences

41 @yelperalp Funding from the NIH and NSF Feedback from colleagues, virologists, and reviewers Code and working demo available online!

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Using the Health Indicators Warehouse in Community Health Assessment

Using the Health Indicators Warehouse in Community Health Assessment Using the Health Indicators Warehouse in Community Health Assessment November 9, 2011 Carter Blakey Jim Craver Bridget Booske Learning Objectives At the completion of the session participants will be able

More information

LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic

LESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic DEFINITIONS OF TERMS Gene a particular sequence of DNA or RNA that contains information for the synthesis of a protien or RNA molecule. For a complete list of defined terms, see the Glossary. LESSON 4.5

More information

MODULE 3: TRANSCRIPTION PART II

MODULE 3: TRANSCRIPTION PART II MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain

More information

Bjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012

Bjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 www.iedb.org Bjoern Peters bpeters@liai.org La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 Overview 1. Introduction to the IEDB 2. Application: 2009 Swine-origin influenza virus

More information

Washington State Getting to the End of AIDS

Washington State Getting to the End of AIDS Washington State Getting to the End of AIDS Tamara Jones End AIDS Washington Policy & Systems Coordinator Office of Infectious Disease Washington State Department of Health 1 End AIDS Washington Developing

More information

Elsevier ClinicalKey TM FAQs

Elsevier ClinicalKey TM FAQs Elsevier ClinicalKey FAQs Table of Contents What is ClinicalKey? Where can I access ClinicalKey? What medical specialties are covered in ClinicalKey? What information is available through ClinicalKey?

More information

Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures

Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures : RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com

More information

Protein Structure and Computational Biology, Good morning and welcome!

Protein Structure and Computational Biology, Good morning and welcome! Protein Structure and Computational Biology, 27617 Good morning and welcome! Program 9.00-9.30 Introduction to the course 9.30-9.40 Break 9.40-10.00 Introduction to influenza a recurring case story 10.00-10.10

More information

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and

More information

Zika Virus. It may be devastating, But we might just get one step ahead of it. Learning in Retirement Winter 2017 Daniel Burnside. photo: Newsweek.

Zika Virus. It may be devastating, But we might just get one step ahead of it. Learning in Retirement Winter 2017 Daniel Burnside. photo: Newsweek. Zika Virus It may be devastating, But we might just get one step ahead of it Learning in Retirement Winter 2017 Daniel Burnside photo: Newsweek.com INTRODUCTION TO VIRUSES STRUCTURE GENOME LIFE CYCLE

More information

Sequence Analysis of Human Immunodeficiency Virus Type 1

Sequence Analysis of Human Immunodeficiency Virus Type 1 Sequence Analysis of Human Immunodeficiency Virus Type 1 Stephanie Lucas 1,2 Mentor: Panayiotis V. Benos 1,3 With help from: David L. Corcoran 4 1 Bioengineering and Bioinformatics Summer Institute, Department

More information

De Novo Viral Quasispecies Assembly using Overlap Graphs

De Novo Viral Quasispecies Assembly using Overlap Graphs De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique

More information

Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution.

Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution. Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution. Brian T. Foley, PhD btf@lanl.gov HIV Genetic Sequences, Immunology, Drug Resistance and Vaccine Trials

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Ginkgo Interactive analysis and quality assessment of single-cell CNV data

Ginkgo Interactive analysis and quality assessment of single-cell CNV data Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael

More information

Appendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations

Appendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations From OPENFLU to OPENFMD a resource for automatic and curated nomenclature and tools for the FMD community Filip Claes, Philippe Le Mercier, Dmitry Kuznetsov, Robin Liechti, Anne Gleizes, Ioannis Xenarios,

More information

Study the Evolution of the Avian Influenza Virus

Study the Evolution of the Avian Influenza Virus Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction

More information

Comparing Cohorts of Event Sequences

Comparing Cohorts of Event Sequences Comparing Cohorts of Event Sequences A VISUAL ANALYTICS APPROACH presented by Sana Malik with Fan Du, Catherine Plaisant, and Ben Shneiderman May 26, 2016 HCIL 33 rd Annual Symposium, College Park often,

More information

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

More information

Defect Removal. RIT Software Engineering

Defect Removal. RIT Software Engineering Defect Removal Agenda Setting defect removal targets Cost effectiveness of defect removal Matching to customer & business needs and preferences Performing defect removal Techniques/approaches/practices

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Grade Level: Grades 9-12 Estimated Time Allotment Part 1: One 50- minute class period Part 2: One 50- minute class period

Grade Level: Grades 9-12 Estimated Time Allotment Part 1: One 50- minute class period Part 2: One 50- minute class period The History of Vaccines Lesson Plan: Viruses and Evolution Overview and Purpose: The purpose of this lesson is to prepare students for exploring the biological basis of vaccines. Students will explore

More information

USING SOCIAL MEDIA TO STUDY PUBLIC HEALTH MICHAEL PAUL JOHNS HOPKINS UNIVERSITY MAY 29, 2014

USING SOCIAL MEDIA TO STUDY PUBLIC HEALTH MICHAEL PAUL JOHNS HOPKINS UNIVERSITY MAY 29, 2014 USING SOCIAL MEDIA TO STUDY PUBLIC HEALTH MICHAEL PAUL JOHNS HOPKINS UNIVERSITY MAY 29, 2014 WHAT IS PUBLIC HEALTH? preventing disease, prolonging life and promoting health WHAT IS PUBLIC HEALTH? preventing

More information

Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015

Metabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015 Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Process Mining to enhance security of Web information systems

Process Mining to enhance security of Web information systems Process Mining to enhance security of Web information systems Simona Bernardi, Raúl Piracés Alastuey, and Raquel Trillo Lado Paris, 29th April 2017 Simona Bernardi, Raúl Piracés Alastuey, and Raquel Trillo

More information

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing

MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by

More information

Predictive Diagnosis. Clustering to Better Predict Heart Attacks x The Analytics Edge

Predictive Diagnosis. Clustering to Better Predict Heart Attacks x The Analytics Edge Predictive Diagnosis Clustering to Better Predict Heart Attacks 15.071x The Analytics Edge Heart Attacks Heart attack is a common complication of coronary heart disease resulting from the interruption

More information

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication

LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit

More information

Following virus recombination and evolution

Following virus recombination and evolution Following virus recombination and evolution Coping with the avalanche of sequencing data Dmitry Kusnetsov, Anne Gleizes, Robin Liechti, Ioannis Xenarios, Philippe Le Mercier Vital-IT/Swiss-Prot group SIB

More information

Protein Structure and Computational Biology, Programme. Programme. Good morning and welcome! Introduction to the course

Protein Structure and Computational Biology, Programme. Programme. Good morning and welcome! Introduction to the course Protein Structure and Computational Biology, 27617 Good morning and welcome! Programme 9.00-9.30 Introduction to the course 9.30-9.40 Break 9.40-10.00 Introduction to influenza a recurring case story 10.00-10.10

More information

Nature Biotechnology: doi: /nbt.1904

Nature Biotechnology: doi: /nbt.1904 Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is

More information

IPA Advanced Training Course

IPA Advanced Training Course IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises

More information

Modeling the Antigenic Evolution of Influenza Viruses from Sequences

Modeling the Antigenic Evolution of Influenza Viruses from Sequences Modeling the Antigenic Evolution of Influenza Viruses from Sequences Taijiao Jiang Center of Systems Medicine, Chinese Academy of Medical Sciences Suzhou Institute of Systems Medicine October 8-10, 2015.

More information

Rama Nada. - Malik

Rama Nada. - Malik - 2 - Rama Nada - - Malik 1 P a g e We talked about HAV in the previous lecture, now we ll continue the remaining types.. Hepatitis E It s similar to virus that infect swine, so its most likely infect

More information

On the Usability and Security of Pseudo-signatures

On the Usability and Security of Pseudo-signatures On the Usability and Security of Pseudo-signatures Computer Science & Engineering Lehigh University {jic207, lopresti}@cse.lehigh.edu Motivation How many textual passwords have you been using? Just a few?

More information

An Evolutionary Story about HIV

An Evolutionary Story about HIV An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst

More information

Human beings contain tens of thousands of genes, the basic material for cell

Human beings contain tens of thousands of genes, the basic material for cell II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes

More information

Review: Genome assembly Reads

Review: Genome assembly Reads Assembly validation Review: Genome assembly Reads Contigs Scaffolds Chromosome Review: Mate pair data Overlap-Layout-Consensus AMOS project: A Modular Open Source assembler Importing data to an AMOS bank

More information

7.013 Spring 2005 Problem Set 7

7.013 Spring 2005 Problem Set 7 MI Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor yler Jacks, Dr. Claudette Gardel 7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005 Question

More information

Automated Quantification and Description of the Evolutionary Patterns of Influenza Viruses in U.S. Swine

Automated Quantification and Description of the Evolutionary Patterns of Influenza Viruses in U.S. Swine Automated Quantification and Description of the Evolutionary Patterns of Influenza Viruses in U.S. Swine Spatial dissemination of a novel H3 influenza A Swine influenza A epidemic peaks Influenza A virus

More information

From Mosquitos to Humans: Genetic evolution of Zika Virus

From Mosquitos to Humans: Genetic evolution of Zika Virus Article: From Mosquitos to Humans: Genetic evolution of Zika Virus Renata Pellegrino, PhD Director, Sequencing lab Center for Applied Genomics The Children s Hospital of Philadelphia Journal Club Clinical

More information

Comprehensive Cancer Control Technical Assistance Training and Communication Plan. PI: Mandi Pratt-Chapman, MA. Cooperative Agreement #1U38DP

Comprehensive Cancer Control Technical Assistance Training and Communication Plan. PI: Mandi Pratt-Chapman, MA. Cooperative Agreement #1U38DP Comprehensive Cancer Control Technical Assistance Training and Communication Plan PI: Mandi Pratt-Chapman, MA Cooperative Agreement #1U38DP004972-01 July 2014 Acknowledgement: This work was supported by

More information

levels of genes were separated by their expression levels; 2,000 high, medium, and low

levels of genes were separated by their expression levels; 2,000 high, medium, and low Figure S1. Histone modification profiles near transcription start sites. The overall histone modification around transcription start sites (TSSs) was calculated. Histone modification levels of genes were

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Palindromes drive the re-assortment in Influenza A

Palindromes drive the re-assortment in Influenza A www.bioinformation.net Hypothesis Volume 7(3) Palindromes drive the re-assortment in Influenza A Abdullah Zubaer 1, 2 * & Simrika Thapa 1, 2 1Swapnojaatra Bioresearch Laboratory, DataSoft Systems, Dhaka-15,

More information

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads

Transcriptome and isoform reconstruc1on with short reads. Tangled up in reads Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity

More information

Sebastian Jaenicke. trnascan-se. Improved detection of trna genes in genomic sequences

Sebastian Jaenicke. trnascan-se. Improved detection of trna genes in genomic sequences Sebastian Jaenicke trnascan-se Improved detection of trna genes in genomic sequences trnascan-se Improved detection of trna genes in genomic sequences 1/15 Overview 1. trnas 2. Existing approaches 3. trnascan-se

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

Mutational Impact on Diagnostic and Prognostic Evaluation of MDS

Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by

More information

Part Of A Virus That Contains The Instructions For Making New Viruses

Part Of A Virus That Contains The Instructions For Making New Viruses Part Of A Virus That Contains The Instructions For Making New Viruses A hidden virus. Becomes part of the host cell's generic material. A virus's contains the instructions for making new viruses. Genetic

More information

Visualizing the Affective Structure of a Text Document

Visualizing the Affective Structure of a Text Document Visualizing the Affective Structure of a Text Document Hugo Liu, Ted Selker, Henry Lieberman MIT Media Laboratory {hugo, selker, lieber} @ media.mit.edu http://web.media.mit.edu/~hugo Overview Motivation

More information

White Paper Estimating Complex Phenotype Prevalence Using Predictive Models

White Paper Estimating Complex Phenotype Prevalence Using Predictive Models White Paper 23-12 Estimating Complex Phenotype Prevalence Using Predictive Models Authors: Nicholas A. Furlotte Aaron Kleinman Robin Smith David Hinds Created: September 25 th, 2015 September 25th, 2015

More information

Exploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein

Exploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through

More information

Interactive Intervention Analysis

Interactive Intervention Analysis Interactive Intervention Analysis David Gotz 1, Krist Wongsuphasawat 2 1 IBM Research, Hawthorne, NY; 2 University of Maryland, College Park, MD Abstract Disease progression is often complex and seemingly

More information

The NIMH Data Repositories

The NIMH Data Repositories The NIMH Data Repositories November 5, 2014 Greg Farber, Ph.D. Director Office of Technology Development and Coordination National Institute of Mental Health National Institutes of Health 1 Expansion to

More information

Origins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings

Origins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings Origins and evolutionary genomics of the novel 2013 avian-origin H7N9 influenza A virus in : Early findings Jiankui He*, Luwen Ning, Yin Tong Department of Biology, South University of Science and Technology

More information

Influenza and other Respiratory Viruses Update

Influenza and other Respiratory Viruses Update Influenza and other Respiratory Viruses Update-- 2017 Pete Shult, PhD CDD Director & Emergency Laboratory Response and Erik Reisdorf, MPH, M(ASCP) CM Surveillance and Virology Lab-Team Lead WISCONSIN STATE

More information

What Happened to Bob? Semantic Data Mining of Context Histories

What Happened to Bob? Semantic Data Mining of Context Histories What Happened to Bob? Semantic Data Mining of Context Histories Michael Wessel, Marko Luther, Ralf Möller Racer Systems DOCOMO Euro-Labs Uni Hamburg A mobile community service 1300+ users in 60+ countries

More information

Comparing adherence items of missed doses with different timeframes and their associations with viral load in routine clinical care

Comparing adherence items of missed doses with different timeframes and their associations with viral load in routine clinical care Comparing adherence items of missed doses with different timeframes and their associations with viral load in routine clinical care R Nance, JAC Delaney, R Fredericksen, A Church, A Harrington, P Crane,

More information

Nature Structural & Molecular Biology: doi: /nsmb.2419

Nature Structural & Molecular Biology: doi: /nsmb.2419 Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb

More information

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer

Cancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:

More information

Bioterrorism and the Pandemic Potential

Bioterrorism and the Pandemic Potential Page 1 of 5 Bioterrorism and the Pandemic Potential March 7, 2013 1001 GMT Print 38 35 125 29 Text Size Stratfor By Rebecca Keller Periodic media reports of bird flu, a new SARS-like virus and a case of

More information

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation

NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department

More information

Self Assessment 8.3 to 8.4.x

Self Assessment 8.3 to 8.4.x Self Assessment 8.3 to 8.4.x User Guide November 30, 2009 Contents What Self Assessments does Managing self assessments Creating self assessments Adding questions to your self assessment Grading and answers

More information

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap

More information

HIV-1 Dual Infection and Neurocognitive Impairment

HIV-1 Dual Infection and Neurocognitive Impairment HIV-1 Dual Infection and Neurocognitive Impairment Gabriel Wagner, MD Assistant Professor of Medicine Infectious Diseases & Global Public Health UC San Diego HIV-Associated End Organ Damage Antiretroviral

More information

TERRORIST WATCHER: AN INTERACTIVE WEB- BASED VISUAL ANALYTICAL TOOL OF TERRORIST S PERSONAL CHARACTERISTICS

TERRORIST WATCHER: AN INTERACTIVE WEB- BASED VISUAL ANALYTICAL TOOL OF TERRORIST S PERSONAL CHARACTERISTICS TERRORIST WATCHER: AN INTERACTIVE WEB- BASED VISUAL ANALYTICAL TOOL OF TERRORIST S PERSONAL CHARACTERISTICS Samah Mansoour School of Computing and Information Systems, Grand Valley State University, Michigan,

More information

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro. RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature

Supplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

GST: Step by step Build Diary page

GST: Step by step Build Diary page GST: At A Glance The home page has a brief overview of the GST app. Navigate through the app using either the buttons on the left side of the screen, or the forward/back arrows at the bottom right. There

More information

VIP: an integrated pipeline for metagenomics of virus

VIP: an integrated pipeline for metagenomics of virus VIP: an integrated pipeline for metagenomics of virus identification and discovery Yang Li 1, Hao Wang 2, Kai Nie 1, Chen Zhang 1, Yi Zhang 1, Ji Wang 1, Peihua Niu 1 and Xuejun Ma 1 * 1. Key Laboratory

More information

Reliable Prediction of Viral RNA Structures

Reliable Prediction of Viral RNA Structures Reliable Prediction of Viral RNA Structures Winterseminar 2016, Bled Roman Ochsenreiter TBI Wien Bled, 15.2.2016 Roman Ochsenreiter TBI Wien Reliable Prediction of Viral RNA Structures Bled, 15.2.2016

More information

HOW AND WHY GENES ARE REGULATED HOW AND WHY GENES ARE REGULATED. Patterns of Gene Expression in Differentiated Cells

HOW AND WHY GENES ARE REGULATED HOW AND WHY GENES ARE REGULATED. Patterns of Gene Expression in Differentiated Cells HOW AND WHY GENES ARE REGULATED 5 HOW AND WHY GENES ARE REGULATED 6 Every somatic cell in an organism contains identical genetic instructions. They all share the same genome. So what makes cells different

More information

PRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression.

PRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression. PRECISION INSIGHTS GPS Cancer Molecular Insights You Can Rely On Tumor-normal sequencing of DNA + RNA expression www.nanthealth.com Cancer Care is Evolving Oncologists use all the information available

More information

HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS

HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS Somda&a Sinha Indian Institute of Science, Education & Research Mohali, INDIA International Visiting Research Fellow, Peter Wall Institute

More information

Mapping the Global Virome. Making the Unknown Known. And the World Safe From a Future of Viral Threats

Mapping the Global Virome. Making the Unknown Known. And the World Safe From a Future of Viral Threats Mapping the Global Virome Making the Unknown Known. And the World Safe From a Future of Viral Threats If you know your enemies and know yourself, you will not be imperiled in a hundred battles;..if you

More information

Advanced Molecular Detection: An Overview

Advanced Molecular Detection: An Overview Advanced Molecular Detection: An Overview Gregory Armstrong, MD Director Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases Office of Advanced Molecular

More information

PERSONALITY ASSESSMENT INVENTORY

PERSONALITY ASSESSMENT INVENTORY PERSONALITY ASSESSMENT INVENTORY TM The Personality Assessment Inventory (PAI) Revealed: Creation and Use of a Research Repository for the PAI Jennifer A. Greene, PhD Leslie Morey, PhD Introduction The

More information

Process Mining in Healthcare. Ronny Mans

Process Mining in Healthcare. Ronny Mans Process Mining in Healthcare Ronny Mans Introduction This talk: Applicability of Process Mining in the healthcare domain Challenges -> Results from applying Process Mining in the AMC PAGE 1 Overview Introduction

More information

Ontology-based interactive visualization of patient-generated research questions

Ontology-based interactive visualization of patient-generated research questions Ontology-based interactive visualization of patient-generated research questions David Borland Laura Christopherson Charles Schmitt RENCI, UNC-Chapel Hill RENCI, UNC-Chapel Hill NIEHS Overview Background

More information

Biology 350: Microbial Diversity

Biology 350: Microbial Diversity Biology 350: Microbial Diversity Strange Invaders: Viruses, viroids, and prions. Lecture #27 7 November 2007-1- Notice handouts and announcements for today: Outline and study questions A 1999 paper discussing

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Illustration of the working of network-based SVM to confidently predict a new (and now confirmed) ASD gene. Gene CTNND2 s brain network neighborhood that enabled its prediction by

More information

National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2009 Formula Grant

National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2009 Formula Grant National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2009 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Formula Grant Overview The National Surgical

More information

Leicester. Research Group. Background. Inside. contact. Page 1: Background. Page 2-4: Leicester IgAN individual research

Leicester. Research Group. Background. Inside. contact. Page 1: Background. Page 2-4: Leicester IgAN individual research May 2015 Newsletter Leicester Research Group Inside Page 1: Background Page 2-4: Page 5: Other research in the Group Background contact Dr Jonathan Barratt, The John Walls Renal Unit, Leicester General

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

High-throughput transcriptome sequencing

High-throughput transcriptome sequencing High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome

More information

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5 TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each

More information

Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies. Guotong Xie IBM Research - China

Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies. Guotong Xie IBM Research - China Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies Guotong Xie IBM Research - China Explosion of Healthcare Data Exogenous data 1,100 Terabytes Generated

More information

1. Cut the copier paper into strips 8.5 inches long and half an inch wide, to make at least 40 strips.

1. Cut the copier paper into strips 8.5 inches long and half an inch wide, to make at least 40 strips. 1 Unit 2: Lesson 2 Case Studies: Influenza and HIV Activity 1: Influenza Antigenic Drift Materials 4 highlighter pens colored red, green, blue and yellow Tape or glue Scissors Paper clips 2 sheets copier

More information

The H5N1 case: A virologist s view

The H5N1 case: A virologist s view The H5N1 case: A virologist s view Jan Wilschut Department of Molecular Virology University Medical Center Groningen Groningen, The Netherlands Meeting of States Parties - Side Event Geneva, 11 December

More information

Reducing INDEL calling errors in whole genome and exome sequencing data.

Reducing INDEL calling errors in whole genome and exome sequencing data. Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max

More information

Data mining with Ensembl Biomart. Stéphanie Le Gras

Data mining with Ensembl Biomart. Stéphanie Le Gras Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:

More information