Alper Sarikaya 1, Michael Correll 2, Jorge M. Dinis 1, David H. O Connor 1,3, and Michael Gleicher 1
|
|
- Noel Evans
- 5 years ago
- Views:
Transcription
1 Alper Sarikaya 1, Michael Correll 2, Jorge M. Dinis 1, David H. O Connor 1,3, and Michael Gleicher 1 1 University of Wisconsin-Madison 2 University of Washington 3 Wisconsin National Primate
2 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work
3 RNA viruses are very error prone in replication Viruses accumulate variation to help its survival Influenza, H1N1, Zika are hard to eliminate
4
5 Discover where functional shifts are occurring
6 Identify co-occurrences of mutations in genome
7 Identify groups of like-behaving subpopulations
8
9
10
11 Identify pairs of positions where mutations co-occur Analysis requires a maximum of sifting through (# positions) 2 correlations
12 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work
13
14
15
16
17
18
19
20
21 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work
22 Collect counts of bases (A, C, T, G) for each pair of positions
23 Compute co-occurrence strength between every pair of genomic positions
24 Overview Super-zoom Show co-occurrences in full pairwise genomic space, in a web browser Scale up to 20,000 x 20,000 Color shows the co-occurrence strength Pairwise genomic space Key
25 Show co-occurrences in full pairwise genomic space, in a web browser Scale up to 20,000 x 20,000 Color shows the co-occurrence strength
26 Too much data to sift through Alignment errors produce false positives Difficult to get an overview
27 Always present data in genomic sequence order Display annotations alongside genome Scaffold to navigate space of all pairwise correlation Support identifying synonymy
28 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work
29 Coverage (read depth) Variation (mutations) Co-occurrence strength
30
31 User-controlled metrics
32 Annotations Positions with significant co-occurrences
33 Pairwise co-occurrences with a particular position
34 Reads that do not overlap with the paired position
35
36
37 Biological Background Displaying occurrence relationships (in biology) MatrixViewer CooccurViewer Case Study, Future Work
38 Sample of : simian equivalent of HIV Large cluster of correlated mutations in Nef protein to evade T cell recognition Nearly no co-occurrences in structural proteins Gal & Pol
39 Use analyst-controlled metrics to focus exploration Displaying the full space does not necessarily empower analysts Providing usable context and scaffolding
40 Support comparison between multiple samples, and multi-step co-occurrence Data aggregation and filtering techniques to support larger data sizes Application to other event-driven sequences
41 @yelperalp Funding from the NIH and NSF Feedback from colleagues, virologists, and reviewers Code and working demo available online!
Analysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationUsing the Health Indicators Warehouse in Community Health Assessment
Using the Health Indicators Warehouse in Community Health Assessment November 9, 2011 Carter Blakey Jim Craver Bridget Booske Learning Objectives At the completion of the session participants will be able
More informationLESSON 4.5 WORKBOOK. How do viruses adapt Antigenic shift and drift and the flu pandemic
DEFINITIONS OF TERMS Gene a particular sequence of DNA or RNA that contains information for the synthesis of a protien or RNA molecule. For a complete list of defined terms, see the Glossary. LESSON 4.5
More informationMODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
More informationBjoern Peters La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012
www.iedb.org Bjoern Peters bpeters@liai.org La Jolla Institute for Allergy and Immunology Buenos Aires, Oct 31, 2012 Overview 1. Introduction to the IEDB 2. Application: 2009 Swine-origin influenza virus
More informationWashington State Getting to the End of AIDS
Washington State Getting to the End of AIDS Tamara Jones End AIDS Washington Policy & Systems Coordinator Office of Infectious Disease Washington State Department of Health 1 End AIDS Washington Developing
More informationElsevier ClinicalKey TM FAQs
Elsevier ClinicalKey FAQs Table of Contents What is ClinicalKey? Where can I access ClinicalKey? What medical specialties are covered in ClinicalKey? What information is available through ClinicalKey?
More informationTutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures
: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com
More informationProtein Structure and Computational Biology, Good morning and welcome!
Protein Structure and Computational Biology, 27617 Good morning and welcome! Program 9.00-9.30 Introduction to the course 9.30-9.40 Break 9.40-10.00 Introduction to influenza a recurring case story 10.00-10.10
More information38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and
More informationZika Virus. It may be devastating, But we might just get one step ahead of it. Learning in Retirement Winter 2017 Daniel Burnside. photo: Newsweek.
Zika Virus It may be devastating, But we might just get one step ahead of it Learning in Retirement Winter 2017 Daniel Burnside photo: Newsweek.com INTRODUCTION TO VIRUSES STRUCTURE GENOME LIFE CYCLE
More informationSequence Analysis of Human Immunodeficiency Virus Type 1
Sequence Analysis of Human Immunodeficiency Virus Type 1 Stephanie Lucas 1,2 Mentor: Panayiotis V. Benos 1,3 With help from: David L. Corcoran 4 1 Bioengineering and Bioinformatics Summer Institute, Department
More informationDe Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
More informationGoing Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution.
Going Nowhere Fast: Lentivirus genetic sequence evolution does not correlate with phenotypic evolution. Brian T. Foley, PhD btf@lanl.gov HIV Genetic Sequences, Immunology, Drug Resistance and Vaccine Trials
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationGinkgo Interactive analysis and quality assessment of single-cell CNV data
Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael
More informationAppendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations
From OPENFLU to OPENFMD a resource for automatic and curated nomenclature and tools for the FMD community Filip Claes, Philippe Le Mercier, Dmitry Kuznetsov, Robin Liechti, Anne Gleizes, Ioannis Xenarios,
More informationStudy the Evolution of the Avian Influenza Virus
Designing an Algorithm to Study the Evolution of the Avian Influenza Virus Arti Khana Mentor: Takis Benos Rachel Brower-Sinning Department of Computational Biology University of Pittsburgh Overview Introduction
More informationComparing Cohorts of Event Sequences
Comparing Cohorts of Event Sequences A VISUAL ANALYTICS APPROACH presented by Sana Malik with Fan Du, Catherine Plaisant, and Ben Shneiderman May 26, 2016 HCIL 33 rd Annual Symposium, College Park often,
More informationCharacterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
More informationDefect Removal. RIT Software Engineering
Defect Removal Agenda Setting defect removal targets Cost effectiveness of defect removal Matching to customer & business needs and preferences Performing defect removal Techniques/approaches/practices
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationGrade Level: Grades 9-12 Estimated Time Allotment Part 1: One 50- minute class period Part 2: One 50- minute class period
The History of Vaccines Lesson Plan: Viruses and Evolution Overview and Purpose: The purpose of this lesson is to prepare students for exploring the biological basis of vaccines. Students will explore
More informationUSING SOCIAL MEDIA TO STUDY PUBLIC HEALTH MICHAEL PAUL JOHNS HOPKINS UNIVERSITY MAY 29, 2014
USING SOCIAL MEDIA TO STUDY PUBLIC HEALTH MICHAEL PAUL JOHNS HOPKINS UNIVERSITY MAY 29, 2014 WHAT IS PUBLIC HEALTH? preventing disease, prolonging life and promoting health WHAT IS PUBLIC HEALTH? preventing
More informationMetabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015
Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationProcess Mining to enhance security of Web information systems
Process Mining to enhance security of Web information systems Simona Bernardi, Raúl Piracés Alastuey, and Raquel Trillo Lado Paris, 29th April 2017 Simona Bernardi, Raúl Piracés Alastuey, and Raquel Trillo
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationPredictive Diagnosis. Clustering to Better Predict Heart Attacks x The Analytics Edge
Predictive Diagnosis Clustering to Better Predict Heart Attacks 15.071x The Analytics Edge Heart Attacks Heart attack is a common complication of coronary heart disease resulting from the interruption
More informationLESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication
DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit
More informationFollowing virus recombination and evolution
Following virus recombination and evolution Coping with the avalanche of sequencing data Dmitry Kusnetsov, Anne Gleizes, Robin Liechti, Ioannis Xenarios, Philippe Le Mercier Vital-IT/Swiss-Prot group SIB
More informationProtein Structure and Computational Biology, Programme. Programme. Good morning and welcome! Introduction to the course
Protein Structure and Computational Biology, 27617 Good morning and welcome! Programme 9.00-9.30 Introduction to the course 9.30-9.40 Break 9.40-10.00 Introduction to influenza a recurring case story 10.00-10.10
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationIPA Advanced Training Course
IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises
More informationModeling the Antigenic Evolution of Influenza Viruses from Sequences
Modeling the Antigenic Evolution of Influenza Viruses from Sequences Taijiao Jiang Center of Systems Medicine, Chinese Academy of Medical Sciences Suzhou Institute of Systems Medicine October 8-10, 2015.
More informationRama Nada. - Malik
- 2 - Rama Nada - - Malik 1 P a g e We talked about HAV in the previous lecture, now we ll continue the remaining types.. Hepatitis E It s similar to virus that infect swine, so its most likely infect
More informationOn the Usability and Security of Pseudo-signatures
On the Usability and Security of Pseudo-signatures Computer Science & Engineering Lehigh University {jic207, lopresti}@cse.lehigh.edu Motivation How many textual passwords have you been using? Just a few?
More informationAn Evolutionary Story about HIV
An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst
More informationHuman beings contain tens of thousands of genes, the basic material for cell
II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes
More informationReview: Genome assembly Reads
Assembly validation Review: Genome assembly Reads Contigs Scaffolds Chromosome Review: Mate pair data Overlap-Layout-Consensus AMOS project: A Modular Open Source assembler Importing data to an AMOS bank
More information7.013 Spring 2005 Problem Set 7
MI Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor yler Jacks, Dr. Claudette Gardel 7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005 Question
More informationAutomated Quantification and Description of the Evolutionary Patterns of Influenza Viruses in U.S. Swine
Automated Quantification and Description of the Evolutionary Patterns of Influenza Viruses in U.S. Swine Spatial dissemination of a novel H3 influenza A Swine influenza A epidemic peaks Influenza A virus
More informationFrom Mosquitos to Humans: Genetic evolution of Zika Virus
Article: From Mosquitos to Humans: Genetic evolution of Zika Virus Renata Pellegrino, PhD Director, Sequencing lab Center for Applied Genomics The Children s Hospital of Philadelphia Journal Club Clinical
More informationComprehensive Cancer Control Technical Assistance Training and Communication Plan. PI: Mandi Pratt-Chapman, MA. Cooperative Agreement #1U38DP
Comprehensive Cancer Control Technical Assistance Training and Communication Plan PI: Mandi Pratt-Chapman, MA Cooperative Agreement #1U38DP004972-01 July 2014 Acknowledgement: This work was supported by
More informationlevels of genes were separated by their expression levels; 2,000 high, medium, and low
Figure S1. Histone modification profiles near transcription start sites. The overall histone modification around transcription start sites (TSSs) was calculated. Histone modification levels of genes were
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationPalindromes drive the re-assortment in Influenza A
www.bioinformation.net Hypothesis Volume 7(3) Palindromes drive the re-assortment in Influenza A Abdullah Zubaer 1, 2 * & Simrika Thapa 1, 2 1Swapnojaatra Bioresearch Laboratory, DataSoft Systems, Dhaka-15,
More informationTranscriptome and isoform reconstruc1on with short reads. Tangled up in reads
Transcriptome and isoform reconstruc1on with short reads Tangled up in reads Topics of this lecture Mapping- based reconstruc1on methods Case study: The domes1c dog De- novo reconstruc1on method Trinity
More informationSebastian Jaenicke. trnascan-se. Improved detection of trna genes in genomic sequences
Sebastian Jaenicke trnascan-se Improved detection of trna genes in genomic sequences trnascan-se Improved detection of trna genes in genomic sequences 1/15 Overview 1. trnas 2. Existing approaches 3. trnascan-se
More informationSupplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR
Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4
More informationMutational Impact on Diagnostic and Prognostic Evaluation of MDS
Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by
More informationPart Of A Virus That Contains The Instructions For Making New Viruses
Part Of A Virus That Contains The Instructions For Making New Viruses A hidden virus. Becomes part of the host cell's generic material. A virus's contains the instructions for making new viruses. Genetic
More informationVisualizing the Affective Structure of a Text Document
Visualizing the Affective Structure of a Text Document Hugo Liu, Ted Selker, Henry Lieberman MIT Media Laboratory {hugo, selker, lieber} @ media.mit.edu http://web.media.mit.edu/~hugo Overview Motivation
More informationWhite Paper Estimating Complex Phenotype Prevalence Using Predictive Models
White Paper 23-12 Estimating Complex Phenotype Prevalence Using Predictive Models Authors: Nicholas A. Furlotte Aaron Kleinman Robin Smith David Hinds Created: September 25 th, 2015 September 25th, 2015
More informationExploring HIV Evolution: An Opportunity for Research Sam Donovan and Anton E. Weisstein
Microbes Count! 137 Video IV: Reading the Code of Life Human Immunodeficiency Virus (HIV), like other retroviruses, has a much higher mutation rate than is typically found in organisms that do not go through
More informationInteractive Intervention Analysis
Interactive Intervention Analysis David Gotz 1, Krist Wongsuphasawat 2 1 IBM Research, Hawthorne, NY; 2 University of Maryland, College Park, MD Abstract Disease progression is often complex and seemingly
More informationThe NIMH Data Repositories
The NIMH Data Repositories November 5, 2014 Greg Farber, Ph.D. Director Office of Technology Development and Coordination National Institute of Mental Health National Institutes of Health 1 Expansion to
More informationOrigins and evolutionary genomics of the novel avian-origin H7N9 influenza A virus in China: Early findings
Origins and evolutionary genomics of the novel 2013 avian-origin H7N9 influenza A virus in : Early findings Jiankui He*, Luwen Ning, Yin Tong Department of Biology, South University of Science and Technology
More informationInfluenza and other Respiratory Viruses Update
Influenza and other Respiratory Viruses Update-- 2017 Pete Shult, PhD CDD Director & Emergency Laboratory Response and Erik Reisdorf, MPH, M(ASCP) CM Surveillance and Virology Lab-Team Lead WISCONSIN STATE
More informationWhat Happened to Bob? Semantic Data Mining of Context Histories
What Happened to Bob? Semantic Data Mining of Context Histories Michael Wessel, Marko Luther, Ralf Möller Racer Systems DOCOMO Euro-Labs Uni Hamburg A mobile community service 1300+ users in 60+ countries
More informationComparing adherence items of missed doses with different timeframes and their associations with viral load in routine clinical care
Comparing adherence items of missed doses with different timeframes and their associations with viral load in routine clinical care R Nance, JAC Delaney, R Fredericksen, A Church, A Harrington, P Crane,
More informationNature Structural & Molecular Biology: doi: /nsmb.2419
Supplementary Figure 1 Mapped sequence reads and nucleosome occupancies. (a) Distribution of sequencing reads on the mouse reference genome for chromosome 14 as an example. The number of reads in a 1 Mb
More informationCancer Gene Panels. Dr. Andreas Scherer. Dr. Andreas Scherer President and CEO Golden Helix, Inc. Twitter: andreasscherer
Cancer Gene Panels Dr. Andreas Scherer Dr. Andreas Scherer President and CEO Golden Helix, Inc. scherer@goldenhelix.com Twitter: andreasscherer About Golden Helix - Founded in 1998 - Main outside investor:
More informationBioterrorism and the Pandemic Potential
Page 1 of 5 Bioterrorism and the Pandemic Potential March 7, 2013 1001 GMT Print 38 35 125 29 Text Size Stratfor By Rebecca Keller Periodic media reports of bird flu, a new SARS-like virus and a case of
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationSelf Assessment 8.3 to 8.4.x
Self Assessment 8.3 to 8.4.x User Guide November 30, 2009 Contents What Self Assessments does Managing self assessments Creating self assessments Adding questions to your self assessment Grading and answers
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationHIV-1 Dual Infection and Neurocognitive Impairment
HIV-1 Dual Infection and Neurocognitive Impairment Gabriel Wagner, MD Assistant Professor of Medicine Infectious Diseases & Global Public Health UC San Diego HIV-Associated End Organ Damage Antiretroviral
More informationTERRORIST WATCHER: AN INTERACTIVE WEB- BASED VISUAL ANALYTICAL TOOL OF TERRORIST S PERSONAL CHARACTERISTICS
TERRORIST WATCHER: AN INTERACTIVE WEB- BASED VISUAL ANALYTICAL TOOL OF TERRORIST S PERSONAL CHARACTERISTICS Samah Mansoour School of Computing and Information Systems, Grand Valley State University, Michigan,
More informationBIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.
RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationSupplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationGST: Step by step Build Diary page
GST: At A Glance The home page has a brief overview of the GST app. Navigate through the app using either the buttons on the left side of the screen, or the forward/back arrows at the bottom right. There
More informationVIP: an integrated pipeline for metagenomics of virus
VIP: an integrated pipeline for metagenomics of virus identification and discovery Yang Li 1, Hao Wang 2, Kai Nie 1, Chen Zhang 1, Yi Zhang 1, Ji Wang 1, Peihua Niu 1 and Xuejun Ma 1 * 1. Key Laboratory
More informationReliable Prediction of Viral RNA Structures
Reliable Prediction of Viral RNA Structures Winterseminar 2016, Bled Roman Ochsenreiter TBI Wien Bled, 15.2.2016 Roman Ochsenreiter TBI Wien Reliable Prediction of Viral RNA Structures Bled, 15.2.2016
More informationHOW AND WHY GENES ARE REGULATED HOW AND WHY GENES ARE REGULATED. Patterns of Gene Expression in Differentiated Cells
HOW AND WHY GENES ARE REGULATED 5 HOW AND WHY GENES ARE REGULATED 6 Every somatic cell in an organism contains identical genetic instructions. They all share the same genome. So what makes cells different
More informationPRECISION INSIGHTS. GPS Cancer. Molecular Insights You Can Rely On. Tumor-normal sequencing of DNA + RNA expression.
PRECISION INSIGHTS GPS Cancer Molecular Insights You Can Rely On Tumor-normal sequencing of DNA + RNA expression www.nanthealth.com Cancer Care is Evolving Oncologists use all the information available
More informationHOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS
HOST-PATHOGEN CO-EVOLUTION THROUGH HIV-1 WHOLE GENOME ANALYSIS Somda&a Sinha Indian Institute of Science, Education & Research Mohali, INDIA International Visiting Research Fellow, Peter Wall Institute
More informationMapping the Global Virome. Making the Unknown Known. And the World Safe From a Future of Viral Threats
Mapping the Global Virome Making the Unknown Known. And the World Safe From a Future of Viral Threats If you know your enemies and know yourself, you will not be imperiled in a hundred battles;..if you
More informationAdvanced Molecular Detection: An Overview
Advanced Molecular Detection: An Overview Gregory Armstrong, MD Director Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases Office of Advanced Molecular
More informationPERSONALITY ASSESSMENT INVENTORY
PERSONALITY ASSESSMENT INVENTORY TM The Personality Assessment Inventory (PAI) Revealed: Creation and Use of a Research Repository for the PAI Jennifer A. Greene, PhD Leslie Morey, PhD Introduction The
More informationProcess Mining in Healthcare. Ronny Mans
Process Mining in Healthcare Ronny Mans Introduction This talk: Applicability of Process Mining in the healthcare domain Challenges -> Results from applying Process Mining in the AMC PAGE 1 Overview Introduction
More informationOntology-based interactive visualization of patient-generated research questions
Ontology-based interactive visualization of patient-generated research questions David Borland Laura Christopherson Charles Schmitt RENCI, UNC-Chapel Hill RENCI, UNC-Chapel Hill NIEHS Overview Background
More informationBiology 350: Microbial Diversity
Biology 350: Microbial Diversity Strange Invaders: Viruses, viroids, and prions. Lecture #27 7 November 2007-1- Notice handouts and announcements for today: Outline and study questions A 1999 paper discussing
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Illustration of the working of network-based SVM to confidently predict a new (and now confirmed) ASD gene. Gene CTNND2 s brain network neighborhood that enabled its prediction by
More informationNational Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2009 Formula Grant
National Surgical Adjuvant Breast and Bowel Project (NSABP) Foundation Annual Progress Report: 2009 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Formula Grant Overview The National Surgical
More informationLeicester. Research Group. Background. Inside. contact. Page 1: Background. Page 2-4: Leicester IgAN individual research
May 2015 Newsletter Leicester Research Group Inside Page 1: Background Page 2-4: Page 5: Other research in the Group Background contact Dr Jonathan Barratt, The John Walls Renal Unit, Leicester General
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationHigh-throughput transcriptome sequencing
High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome
More informationThe Deciphering Development Disorders (DDD) project: What a genomic approach can achieve
The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5 TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each
More informationPersonalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies. Guotong Xie IBM Research - China
Personalized, Evidence-based, Outcome-driven Healthcare Empowered by IBM Cognitive Computing Technologies Guotong Xie IBM Research - China Explosion of Healthcare Data Exogenous data 1,100 Terabytes Generated
More information1. Cut the copier paper into strips 8.5 inches long and half an inch wide, to make at least 40 strips.
1 Unit 2: Lesson 2 Case Studies: Influenza and HIV Activity 1: Influenza Antigenic Drift Materials 4 highlighter pens colored red, green, blue and yellow Tape or glue Scissors Paper clips 2 sheets copier
More informationThe H5N1 case: A virologist s view
The H5N1 case: A virologist s view Jan Wilschut Department of Molecular Virology University Medical Center Groningen Groningen, The Netherlands Meeting of States Parties - Side Event Geneva, 11 December
More informationReducing INDEL calling errors in whole genome and exome sequencing data.
Reducing INDEL calling errors in whole genome and exome sequencing data. Han Fang November 8, 2014 CSHL Biological Data Science Meeting Acknowledgments Lyon Lab Yiyang Wu Jason O Rawe Laura J Barron Max
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More information