Analysis of Poliovirus Protein 3A Interactions with Viral and Cellular Proteins in Infected Cells

Transcription

1 JOURNAL OF VIROLOGY, May 2011, p Vol. 85, No X/11/$12.00 doi: /jvi Copyright 2011, American Society for Microbiology. All Rights Reserved. Analysis of Poliovirus Protein 3A Interactions with Viral and Cellular Proteins in Infected Cells Natalya L. Teterina,* Yuval Pinto, Joseph D. Weaver, Kenneth S. Jensen, and Ellie Ehrenfeld Laboratory of Infectious Diseases, NIAID, NIH, Bethesda, Maryland Received 17 November 2010/Accepted 10 February 2011 Poliovirus proteins 3A and 3AB are small, membrane-binding proteins that play multiple roles in viral RNA replication complex formation and function. In the infected cell, these proteins associate with other viral and cellular proteins as part of a supramolecular complex whose structure and composition are unknown. We isolated viable viruses with three different epitope tags (FLAG, hemagglutinin [HA], and c-myc) inserted into the N-terminal region of protein 3A. These viruses exhibited growth properties and characteristics very similar to those of the wild-type, untagged virus. Extracts prepared from the infected cells were subjected to immunoaffinity purification of the tagged proteins by adsorption to commercial antibody-linked beads and examined after elution for cellular and other viral proteins that remained bound to 3A sequences during purification. Viral proteins 2C, 2BC, 3D, and 3CD were detected in all three immunopurified 3A samples. Among the cellular proteins previously reported to interact with 3A either directly or indirectly, neither LIS1 nor phosphoinositol-4 kinase (PI4K) were detected in any of the purified tagged 3A samples. However, the guanine nucleotide exchange factor GBF1, which is a key regulator of membrane trafficking in the cellular protein secretory pathway and which has been shown previously to bind enteroviral protein 3A and to be required for viral RNA replication, was readily recovered along with immunoaffinity-purified 3A-FLAG. Surprisingly, we failed to cocapture GBF1 with 3A-HA or 3A-myc proteins. A model for variable binding of these 3A mutant proteins to GBF1 based on amino acid sequence motifs and the resulting practical and functional consequences thereof are discussed. Poliovirus (PV) is a member of the human enterovirus C cluster in the Enterovirus genus of the virus family Picornaviridae. The PV genome encodes a single polyprotein that is proteolytically processed to generate a set of intermediate precursors and final cleavage products that are all required for virus replication. The N-terminal region of the polyprotein (P1) forms the viral capsid proteins, which are dispensable for viral RNA translation and replication but are needed for encapsidation and assembly of infectious particles. The remainder of the polyprotein (P2 and P3 regions) generates proteins that contribute catalytic and structural functions for viral RNA translation and replication, as well as for disruption and/or reorganization of numerous cellular processes and activities that could restrict or combat virus replication. All of the PV noncapsid proteins are essential for viral RNA replication; most manifest multiple activities during the virus replication cycle, and all at least partially localize to large, membraneassociated replication complexes that form from preexisting subcellular organelles after infection. Viral proteins 2B, 2C, and 3A contain hydrophobic trans-membrane regions or amphipathic helices, and these proteins as well as their larger precursor proteins bind membranes directly (7, 12, 27, 33, 34). The recruitment of other viral proteins, as well as cellular factor(s) required for viral RNA synthesis, to the replication complexes presumably occurs via an extensive network of protein-protein interactions. Functional interactions between viral * Corresponding author. Mailing address: Laboratory of Infections Diseases, National Institutes of Health, Bldg. 33, Room 3W10A.2, 33 North Drive, MSC 3203, Bethesda, MD Phone: (301) Fax: (301) nteterina@niaid.nih.gov. Published ahead of print on 23 February proteins have been observed in genetic studies of PVs bearing debilitating mutations in noncapsid proteins, where variants manifesting improved growth were selected with compensatory second-site mutations in different proteins (13, 29, 32). Indeed, physical interactions between numerous viral proteins have been demonstrated directly by yeast and mammalian two-hybrid system analyses (17, 29, 40, 41). Viral protein 3A and its relatively stable precursor 3AB appear to be key players in replication complex formation and function and in viral RNA synthesis reactions, although the precise biochemical roles played by these proteins are poorly understood. The 87-amino-acid-long 3A protein has a C-terminal hydrophobic domain of 22 residues which is responsible for its direct membrane association and which has been shown to be important for PV replication by molecular genetic studies (13 15, 31 33). Membrane-bound 3AB, but not 3A, serves as a cofactor to stimulate the activity of 3D viral polymerase (3D pol ) in vitro (13). In addition, cleavage of 3AB mediated by 3C/3CD protease (3C/3CD pro ) to release 3A and 3B occurs only when the precursor is bound to membranes (13, 21). The structure of a truncated form of protein 3A lacking its hydrophobic domain was determined by nuclear magnetic resonance (NMR); in solution, the protein formed a dimer, with each monomer adopting a helical hairpin fused to an unstructured region at the N terminus (26). The latter domain is thought to be cytosolic, both in 3A and 3AB (5). Expression of protein 3A by itself in mammalian cells resulted in major effects on the cellular protein secretory pathway. The protein colocalized with membranes of the endoplasmic reticulum (ER) and caused a dramatic dilation of the ER tubular morphology (10). Both PV and the closely related coxsackievirus B3 (CVB3) 3A proteins inhibited anterograde 4284

2 VOL. 85, 2011 POLIOVIRUS PROTEIN 3A INTERACTIONS IN INFECTED CELLS 4285 traffic from the ER to the Golgi apparatus and caused disassembly of the Golgi complex (6, 11, 38). Inhibition of protein secretion mediated by protein 3A in isolation has been linked to the reduction of the secretion of antiviral cytokines interleukin 6 (IL-6), IL-8, and beta interferon (IFN- ) from poliovirus-infected cells (9), the major histocompatibility complex class I (MHC-I)-dependent presentation of antigens (8), and the concentration of the tumor necrosis factor (TNF) receptor on the surface of infected cells (24). More detailed studies demonstrated that the Golgi-specific brefeldin A (BFA) resistance factor 1 (GBF1), which plays an important role in regulating membrane trafficking in the cellular secretory pathway, binds directly to the N-terminal portion of the PV and CVB3 3A protein (35, 37). Moreover, the 3A protein was demonstrated to recruit GBF1 to membranes in vitro (1). The relationship between 3A and GBF1 binding and viral RNA replication, however, has not yet been mechanistically clarified. In a recent study, Hsu et al. (18) demonstrated that expression of PV or CVB3 3A proteins induced a selective recruitment to membranes of phosphoinositol-4 kinase (PI4K) III, which catalyzes production of PI4P lipids and which is required for viral RNA replication, perhaps because the PI4P lipid-enriched membranes bind the viral RNA-dependent RNA polymerase, 3D. They reported that antibodies to PI4K III coimmunoprecipitated viral proteins 3A and 3AB from CVB3-infected cells. It was not determined whether 3A sequences interacted directly with the kinase or if they were pulled down indirectly, e.g., by binding to 3D that was bound to PI4K. In an independent study, the PV 3A protein expressed by itself was shown to bind and inactivate LIS1 (20), a component of the dynein/dynactin motor complex encoded by the gene mutated in patients with type I lissencephaly and involved in microtubule-dependent transport. The relevance of this binding to virus growth in infected cells has not been studied. In the present study, we attempted to determine the interactions of PV protein 3A with other viral and cellular factors during virus replication in infected cells. We isolated viable viruses bearing epitope tag insertions in the N-terminal region of protein 3A, based on a previous transposon insertion screen, to guide the selection of epitope insertion sites. We describe here the use of these tags to capture protein 3A interactions via immunoaffinity copurification, and we examine the functional consequences of variable 3A binding to GBF1. MATERIALS AND METHODS Selection of viable viruses encoding 5-amino-acid insertions in protein 3A. Selection of viruses encoding insertions of 5 amino acids (aa) after aa 6, 9, or 10 of protein 3A from a random library of transposon insertion mutants of PV has been described previously (28). Plasmids. ppv-3a6-tp, ppv-3a9-tp, and ppv-3a10-tp carrying the full-length cdna genome of PV with 15 bp inserted after nucleotide (nt) 5128, 5137, or 5140, resulting in an in-frame insertion of 5 aa after aa 6, 9, or 10 of PV protein 3A, respectively, were constructed using standard cloning techniques. The insertion sites and sequences were selected from a library of transposon insertion mutants of PV (28). Plasmid ppv-3a-flag encodes the full-length genome of PV with an insertion of 24 nt (GACTATAAAGACGATGATGACAAG) between nt 5128 and 5129 that results in 8 aa of FLAG-tag sequence (DYKDD DDK) inserted after aa K6 of PV protein 3A. Plasmid ppv-3a-ha encodes the full-length genome with insertion of 27 nt (TACCCATATGACGTTCCAGAC TATGCT) between nt 5128 and 5134 that results in 9 aa of hemagglutinin (HA) tag (YPYDVPDYAK) inserted between aa K6 and K9 of PV protein 3A (with deletion of 6 nt coding for aa D7 and L8). Plasmid ppv-3a-myc contains an insertion of 30 nt (GAGCAGAAACTCATCTCTGAAGAGGATCTG) between nt 5128 and 5134 that encodes 10 aa of the c-myc epitope (EQKLISE EDL) between aa K6 and K9. These three insertion mutants were initially constructed in subclone pgem-pv-nh by Mutagenex Inc., and then insertioncontaining fragments were recloned into plasmid pxpa containing the fulllength cdna of PV (16). A replicon plasmid pxpa-renr has been described previously (1). pxpa-ren-3a-flag, pxpa-ren-3a-flag-y, pxpa-ren-3a- HA, and pxpa-ren-3a-myc were produced by conventional cloning of PCR fragments produced from the corresponding viral RNAs into pxpa-renr vector. The sequences of the P2 and P3 regions were verified. Cloning details are available upon request. Plasmid pcmv-gluc for expression of secreted Gaussia luciferase (GLuc) was from New England BioLabs. Plasmid pyfp-gbf1a795e for expression of a BFA-resistant mutant of GBF1 was described previously (2). RNA transcription and transfection. RNA transcription and transfection were performed essentially as described previously (30). Briefly, plasmids were linearized at the EcoRI restriction site located downstream of the PV poly(a) sequence prior to transcription with T7 RNA polymerase in vitro. HeLa cell monolayers in 6-well plates were transfected with serial dilutions of RNA transcripts using the TransIt-mRNA transfection kit (Mirus Bio LLC), according to the manufacturer s protocol. The RNAs were applied to HeLa cells and incubated at 37 C for 2 to 3 h. The medium was replaced with Dulbecco s modified Eagle s medium (DMEM) containing 0.4% agarose. Plates were incubated at 37 C for the indicated times, and individual plaques were isolated or plates were stained with crystal violet. Isolation of 3A-specific protein complexes. Subconfluent HeLA cell monolayers ( cells/65-mm plate) were infected with the indicated viruses at a multiplicity of infection (MOI) of 20 PFU/cell. After 30 min of adsorption, 2.5 ml of DMEM supplemented with 5% fetal bovine serum (FBS) was added and plates were incubated at 37 C. At 6 h postinfection, cells were washed twice with phosphate-buffered saline (PBS) and lysed with 500 l of cold lysis buffer (50 mm Tris-HCl [ph 8.0], 250 mm NaCl, 1% NP-40, 1 protease inhibitor cocktail [Sigma-Aldrich], and 5 g/ml phenylmethylsulfonyl fluoride [PMSF]). After 15 min of incubation on ice, cell lysates were collected in Eppendorf tubes, and nuclei were pelleted by centrifugation at 13,000 g for 5 min at 4 C. The postnuclear supernatant was used for coimmunoprecipitation (CoIP) of protein. Supernatants were mixed with 60 l of the corresponding affinity beads (see below) and incubated at 4 C on a rotating platform overnight, and the beads were collected by centrifugation for 5 min at 8,000 g at 4 C. The beads were washed three times with buffer (50 mm Tris-HCl [ph 7.4], 150 mm NaCl, 1 protease inhibitors [0.5 g/ml PMSF, 50 ng/ml leupeptin, and 100 ng/ml aprotinin]), and bound proteins were eluted in 120 l of SDS-PAGE sample buffer. We used anti-flag M2 affinity gel (Sigma-Aldrich) for immunoisolation of proteins from cells infected with PV-3A-FLAG or PV-3A-FLAG-Y, ProFound HA tag IP/CoIP kit (Pierce) for isolation of proteins from cells infected with PV-3A-HA, and ProFound c-myc tag IP/CoIP kit (Pierce) for isolation of proteins from cells infected with PV-3A-myc. In parallel, the same affinity purification procedures were applied to cells infected with the control, untagged, wildtype virus. Eluted proteins were separated on a 4 to 12% NuPAGE Novex Bis-Tris precast electrophoresis gel (Invitrogen) with 1 MES (morpholineethanesulfonic acid) buffer (Invitrogen). Proteins were visualized by staining with a silver stain kit (Pierce) or by Western blotting. Antibodies. Anti-polio 2C protein, anti-polio 2B protein, anti-polio 3A protein, and anti-polio 3D protein mouse monoclonal antibodies were gifts from Kurt Bienz (Basel University, Switzerland). Mouse monoclonal anti-flag M2 antibody was from Sigma-Aldrich, mouse monoclonal anti-ha antibody conjugated to horseradish peroxidase was from Miltenyi Biotec Inc., and mouse monoclonal anti c-myc antibody conjugated to horseradish peroxidase was from GenScript. Anti-GBF1 and anti-pi4k rabbit polyclonal antibodies were a gift from Nihal Altan-Bonnet (Rutgers University). Anti-LIS mouse monoclonal antibodies were a gift from O. Reiner (Weizmann Institute of Science). Secondary antibodies conjugated to horseradish peroxidase used in Western blot analyses were from Amersham. Alexa Fluor 488-conjugated secondary antibodies used in immunofluorescence were from Molecular Probes. Immunofluorescence assay. Immunofluorescent assay (IFA) was performed as described previously (30). In brief, the transfected cells were fixed with 3% paraformaldehyde (PFA), washed with PBS, and permeabilized with 0.2% Triton X-100 PBS. Anti-3A antibodies were used as the primary antibodies (1:200 dilution), and Alexa Fluor 488-conjugated goat anti-mouse IgG were used as secondary antibodies (1:50,000 dilution; Molecular Probes). Nuclei were counterstained with Hoechst (Invitrogen). Renilla luciferase replicon assay. Assays were performed essentially as described previously (1). HeLa cells grown in 96-well plates were transfected using

3 4286 TETERINA ET AL. J. VIROL. Mirus Trans-It mrna transfection reagent (Mirus Bio LLC) with poliovirus replicon RNAs (0.8 ng/well) transcribed from pxpa-renr or its derivatives encoding the indicated tagged 3A proteins. Transfection mixtures contain 60 M EnduRen Renilla luciferase substrate (Promega) and 2 g/ml BFA (or dimethyl sulfoxide [DMSO] in control samples). For GBF1 rescue assays, HeLa cells were transfected with pyfp-gbf1a795e GBF1 expression plasmid or empty pgem vector plasmid with Lipofectamine LTX (Invitrogen) at the time of seeding, 24 h prior to transfection with replicon RNAs. Plates were incubated at 37 C in a Molecular Device M5 microplate reader, and light emission from luciferase activity was measured every hour from at least 16 replicate wells. Secretion assay. HeLa cells were transfected with pcmv-gluc with Lipofectamine LTX (Invitrogen) at the time of seeding in duplicate 96-well plates. The next day, the medium was removed and cells were infected with the indicated viruses or mock infected. After 30 min of adsorption, medium supplemented with 5% fetal bovine serum was added and plates were incubated at 37 C for 3 h. As a positive control for inhibition of protein secretion, the incubation medium in one set of wells contained 2 g/ml BFA. After 3 h, in the plate used to measure secretion, fresh medium was substituted and incubation continued for 1 h (till 4 h postinfection), after which the supernatant medium was collected, and Gaussia luciferase activity was determined with the Gaussia luciferase assay kit (New England BioLabs) according to the manufacturer s protocol. To determine the level of intracellular Gaussia luciferase present in infected and control cells at 3 h, after removal of incubation medium from the duplicate plate, it was washed twice with PBS, cells were lysed with 80 l of the luciferase cell lysis buffer (New England BioLabs), lysates were collected, and Gaussia luciferase activity was determined as described above. RESULTS Recovery of recombinant polioviruses harboring small insertions in the N-terminal region of protein 3A. The viral protein 3A sequence participates in numerous functions during PV replication, both in the form of the 3A cleavage product and in precursor forms, such as 3AB and perhaps even larger precursors (25). To identify sites in protein 3A suitable for the insertion of specific polypeptide tags that did not prevent virus replication, we used transposon (Tn)-based insertion mutagenesis and generated a cdna library of PV genomes encoding random insertions of 5 aa in the P3 region of the polyprotein (28). RNA transcripts from the pooled library were transfected into HeLa cells, and individual plaques were isolated and amplified, after which viral RNAs were extracted and sequenced. The sequencing data from 20 plaques formed by viruses containing insertions in the 3A coding region demonstrated that the amino-terminal portion of 3A tolerated small insertions in a series of neighboring residues, suggesting that this region represents a flexible region both in length and amino acid sequence. Five different viable genomes, each encoding an insertion of five amino acids after residues 2, 6, 9, 10, or 11 in protein 3A, were independently isolated (Fig. 1A), some multiple times (28). The flexibility of this region suggested by its ability to accommodate insertions supports the NMR spectroscopy analysis of a truncated 3A protein that predicted a highly unstructured N-terminal region (Fig. 1B) (26). RNA transcripts produced from the reconstructed fulllength viral cdnas encoding 5-aa inserts after 3A residue 6, 9, or 10 demonstrated specific infectivities similar to the wild-type PV RNA transcripts ( PFU/ g of RNA). Sequence analyses of viruses isolated from plaques generated after transfection confirmed that the insertions were retained after two passages. All three viruses exhibited plaque phenotypes similar to that of the wild-type virus (Fig. 1C), indicating that 3A protein with these insertions in the N-terminal region are functional in PV replication. Although protein 3A is one of the least conserved proteins among the picornavirus genera, there is a high level of sequence conservation among viruses within the Enterovirus genus (Fig. 1D). Some of the more distantly related enteroviruses (e.g., human rhinovirus A [HRV-A] and HRV-C) lack up to 10 of the 20 amino-terminal amino acid residues; however, it appears that no insertions in this region occurred during virus evolution. Recombinant PVs expressing tagged 3A proteins. Previous studies have demonstrated that PV protein 3A plays a role in altering the cellular membranous organelle network and disrupting anterograde trafficking from the ER to the Golgi apparatus (6, 11, 38). These activities likely require specific interactions of 3A with host cell proteins. To facilitate isolation and analysis of proteins interacting with 3A or 3A-containing proteins in infected cells, we designed recombinant PV genomes encoding epitope tag insertions in the identified flexible region of protein 3A. The tag sequences were placed after amino acid K 6 of 3A, in the middle of the predicted flexible region (Fig. 1A and B). We constructed PV genomes encoding three different tags FLAG, HA, and c-myc for which immunoisolation reagents are well characterized and commercially available, in order to compare the resulting virus growth properties and ultimately to ensure that any binding partners that were isolated resulted from specificity for the 3A sequences rather than from the tag sequences. RNA transcripts from the 3A-tagged PV cdnas were transfected into HeLa cells, and recombinant viruses were rescued from plaques formed after 2 days. The characteristics of viruses isolated from transfections with each tagged construct are described below. Table 1 shows a summary of the viruses recovered after transfection and amplification to produce virus stocks. PV-3A-FLAG. The specific infectivity of PV-3A-FLAG RNA was 500-fold lower than that of wild-type PV RNA (10 3 and PFU/ g RNA, respectively). Nine plaque-purified PV-3A-FLAG viruses were recovered after transfection and amplification to produce virus stocks (Table 1). Of these, two had partial deletions in the FLAG sequence (FLAGdel), three contained a point mutation that changed residue 7 from D to Y in the 8-aa inserted FLAG epitope sequence (designated FLAG-Y), one contained a mutation that changed residue 5 from D to G in the FLAG sequence, and three retained the original FLAG sequence that had been inserted. Three virus isolates that retained the unmodified FLAG sequence were analyzed by sequencing the P2 and P3 regions: two had acquired mutations in the 2B coding sequence, Q19K or Q20R, that appeared to compensate for the poor growth of the unmodified 3A-FLAG (3A-FLAG unmod ) virus, whereas no mutations were identified in the third virus. Stocks containing unmodified FLAG and FLAG-Y were subjected to further passage and plaque purification. Viruses containing FLAG-Y were stable upon passage and produced plaques only slightly smaller than those of wild-type PV (Fig. 2A). Viruses containing an unmodified FLAG sequence produced smaller plaques that generated either FLAG-Y or other FLAG mutations upon further passage. Thus, the original FLAG sequence inserted after the K residue at position 6 in the 3A protein was not stable. In particular, the run of four consecutive aspartate residues in the inserted FLAG epitope appeared not to be well tolerated in 3A; thus, a single amino acid change at either of

4 VOL. 85, 2011 POLIOVIRUS PROTEIN 3A INTERACTIONS IN INFECTED CELLS 4287 FIG. 1. Location of sites in PV protein 3A tolerant to the insertion of five amino acids. (A) The schematic diagram of the genome organization of PV and the 3A protein are shown. The conserved hydrophobic domain at the C-terminal end of the protein is shaded in black. The regions involved in formation of the helical hairpin predicted by the NMR analysis of the truncated protein are shaded in gray. The amino acid sequences of the N-terminal region of the 3A protein of PV type 1 and viruses with 5-aa insertions are shown. The arrows indicate sites of insertions. Amino acids encoded by transposon insertions are underlined. (B) Three-dimensional structure of the dimer formed by residues 1 to 58 of the PV 3A protein determined by NMR (26) (Protein Databank file 1NG7). The locations of Pro2, Lys6, Lys9, Ile10, and Asp11 are highlighted on both monomers. (C) Growth phenotype of viruses with 5-aa insertions after Lys6 (3A-6), Lys9 (3A-9), and Ile10 (3A-10) determined by plaque assay. HeLa cells were infected with serial dilutions of wild-type PV or mutant viruses. At 30 min postinfection, medium containing unadsorbed virus was replaced by DMEM supplemented with 5% FBS and 0.5% agarose. Cells were incubated at 37 C for 48 h and stained with crystal violet. (D) Amino acid sequence alignment of 3A proteins of enteroviruses. The sequences of the 3A proteins of prototypic representatives of seven species of the genus Enterovirus are shown in an alignment generated using the ClustalW2 program. Sequences with the following GenBank accession numbers were used: NC_ (human enterovirus A [HEV-A]), NC_ (HEV-B), NC_ (HEV-C), NC_ (HEV-D), NC_ (HRV-A), NC_ (HRV-B), and NC_ (HRV-C). TABLE 1. Properties of viruses recovered after transfection of HeLa cells with RNAs encoding tagged 3A proteins Tag Tag insertion sequences present in passage 1 viruses a Additional mutations No. of virus isolates Plaque phenotype FLAG DYKDDDDK 1 Small, mixed FLAG DYKDDDDK 2B Q19K or 2 Medium Q20R FLAG-Y DYKDDDYK 3 Large FLAG-G DYKDGDDK 1 Large FLAGdel DYK 2 Large HA YPYDVPDYA 4 Large myc EQKLISEEDL 2B D23G 4 Medium, mixed a The amino acid changed in the original insertion is underlined. the two aspartate residues was sufficient to overcome the negative effect on growth of the FLAG-containing virus, yielding tagged viruses that grew similarly to wild-type untagged virus. Alternatively, robust virus growth could be restored by a compensatory mutation at either position 19 or 20 in protein 2B, previously shown to interact with protein 3A (29, 32, 41). To avoid introduction of a second-site mutation in 2B and since the FLAG-Y virus was stable and grew well, we chose to work with PV-3A-FLAG-Y for this study. PV-3A-HA. RNA transcripts PV-3A-HA, encoding a 9-aa HA epitope tag, displayed a specific infectivity of 10 5 PFU/ g, similar to the infectivity of wild-type PV RNA transcripts. Virus rescued from these transfections generated plaques of the same size and morphology as those of the wild type (Fig. 2A). Sequence analysis of the entire P2 and P3 regions after three consecutive passages of virus stock showed no mutations. This indicated that insertion of the HA epitope had little, if

5 4288 TETERINA ET AL. J. VIROL. FIG. 2. Effect of different tags placed in protein 3A on virus growth, RNA replication, and function of protein 3A. (A) Plaque titrations of viruses encoding wild-type PV, FLAG, FLAG-Y, HA, and c-myc tag insertions in protein 3A were performed on HeLa cells at 37 C. Monolayers were stained with crystal violet at 48 h postinfection. Viral plaque phenotypes were analyzed in two separate experiments (top and bottom) and each included a wild-type virus (PVwt) control. (B) HeLa cells were transfected with PV Renilla luciferase replicon RNA transcripts in 96-well plates and incubated in the presence of cell-permeable Renilla luciferase substrate. Light readings were taken every hour with a Molecular Device M5 reader. RLU, relative light units. (C) HeLa cells were transfected with plasmid pcmv-gluc that encodes Gaussia luciferase under the control of a CMV promoter. Twenty-four hours after transfection, cells were washed and infected with wild-type or 3A mutant viruses or mock infected in the presence or absence of 2 mg/ml brefeldin A (BFA). After 3 h of incubation at 37 C, cells were washed and incubated with fresh medium for an additional hour, after which supernatants were collected and assayed for GLuc activity. Maximal GLuc secretion (100%) was set at the amount of secretion in the mock-infected cells. Average values and standard errors from the results of four replicate samples are shown. (D) HeLa cells were infected with the wild type or viruses expressing FLAG-Y-, HA-, or c-myc-tagged 3A proteins at a multiplicity of 10 PFU/cell, incubated for 4.5 h, fixed, and processed for immunofluorescent staining with anti-polio 3A antibodies (red). Nuclear chromatin was stained with Hoechst any, negative effect on virus growth and that no adaptive mutations were required for replication of the tagged virus. PV-3A-myc. The specific infectivity of the recombinant PV- 3A-myc RNA, encoding a 10-aa c-myc epitope, was approximately 1 log lower than that of wild-type RNA, and this RNA produced plaques of significantly smaller size (Fig. 2A). Like PV-3A-FLAG, PV-3A-myc manifested a mixed plaque size phenotype, suggesting some level of instability of these genomes. Sequence analysis of RNA from a plaque-purified PV- 3A-myc virus after two passages revealed that the c-myc insertion in 3A was unchanged; however, the virus had acquired an additional adaptive mutation in protein 2B that changed residue 23 from D to G. Interestingly, this compensating mutation was close to the 2B mutations at positions 19 or 20 selected by the unmodified FLAG insertion in 3A (see Table 1). In the latter case, both mutations increased the positive charge in that region of the protein (Q19K and Q20R), and in the PV-3Amyc virus, the mutation in 2B eliminated a negative charge (D23G). Characterization of 3A-tagged viruses. Fig. 2A shows the plaques formed by wild-type and 3A-tagged viruses at 37 C. The viruses with FLAG and FLAG-Y inserts in the 3A protein were tested at 32 C and 39 C and did not display temperature sensitivity (data not shown). To compare the effect of different tags in protein 3A on viral RNA replication efficiencies in HeLa cells, we placed these insertions in the background of a PV replicon RNA containing the Renilla luciferase gene in place of the structural protein-coding region (1). HeLa cells were transfected with replicon RNAs, and Renilla luciferase activity was monitored as a measure of replicon RNA synthesis. Figure 2B shows that replicons encoding FLAG-Y or HA insertions in protein 3A replicated with the same kinetics and yields as those of wild-type replicons; c-myc insertions caused a slight reduction in efficiency of replication, and the replicon with the unmodified FLAG insertion was significantly slower and less productive. The robust replication of genomes encoding tagged 3A proteins indicated that tagged 3AB proteins fulfilled any cofactor requirements for support of viral RNA replication, in addition to those required of the tagged 3A proteins. Similar results were observed when single-step growth curves of the viruses harboring each of the 3A insertion variants were compared by quantitative reverse transcription

6 VOL. 85, 2011 POLIOVIRUS PROTEIN 3A INTERACTIONS IN INFECTED CELLS 4289 FIG. 3. PV proteins containing FLAG-Y and FLAG sequences are recognized by anti-flag antibodies. HeLa cells were infected with wild-type virus or viruses encoding FLAG or FLAG-Y sequences at a multiplicity of 20 PFU/cell and incubated at 37 C. Infected cell lysates were prepared at 4 and 6 h postinfection. Proteins were separated on a 12% SDS-polyacrylamide gel and assessed by immunoblotting with poliovirus protein 3A-specific antibodies (left), and the same membrane was stripped and probed again with FLAG-specific antibodies (right). The asterisk indicates an unidentified 3A-containing polypeptide whose presence was highly variable in different extracts. It appears to react only weakly with anti-flag antibodies. (RT)-PCR measurements of viral RNA accumulation after infections at a multiplicity of 20 PFU/cell (data not shown). Several studies have implicated PV protein 3A in the inhibition of protein secretion induced in infected cells (4, 10, 11). Analysis of this inhibition by different mutants of PV or the closely related CVB3 3A proteins pointed to several specific amino acids in the N-terminal region as important determinants for the protein s ability to inhibit the secretory pathway (4, 36, 39). The tag epitopes inserted in the PV 3A proteins synthesized by viruses described in this study are located within the N-terminal region, quite close to the implicated amino acids. This prompted us to determine whether the viruses with tagged 3A proteins were capable of inhibiting protein secretion during infection. Cells were transfected with a plasmid expressing a secreted form of Gaussia luciferase 1 day prior to infection with wild-type PV or PV-3A-FLAG-Y, PV-3A-HA, or PV-3A-myc. At 3 h postinfection, cells from one set of duplicate plates were harvested, washed, and analyzed for intracellular luciferase to ensure that GLuc levels were similar in all of the different virus-infected cells and that all cells contained high levels of the enzyme. Virus-induced inhibition of cellular protein synthesis had only minimal effects on total intracellular luciferase concentrations compared to that of mock-infected cells. The medium was removed from the second set of duplicate plates at 3 h postinfection and replaced with fresh medium, and extracellular luciferase was assayed 1 h later as a measure of secretion between 3 and 4 h postinfection. In a control set of luciferase-expressing cells, BFA was added instead of virus to completely inhibit the cellular secretion pathway (Fig. 2C). Consistent with previous reports (4, 10, 39), secretion of the luciferase reporter was reduced by 80% after 3 h of wild-type PV infection. Figure 2C shows that the 3Atagged viruses all induced similar levels of inhibition of protein secretion after 3 h of infection, perhaps slightly less effective than the wild-type virus. The intracellular localization patterns of tagged and untagged 3A in infected cells were examined by confocal immunofluorescence microscopy using monoclonal anti-3a antibodies. The tagged proteins expressed during infection showed a labeling pattern indistinguishable from that of untagged 3A (Fig. 2D). Taken together, these data demonstrate that 3A and precursor proteins containing epitope insertion tags are fully functional for growth in the context of a replicating PV genome and thus justified the use of the tagged proteins for analysis of 3A binding partners in infected cells. To confirm that the modified FLAG-Y epitope tag would be recognized by specific anti-flag antibodies, HeLa cells were infected with wild-type PV, PV-3A-FLAG, or PV-3A- FLAG-Y viruses at an MOI of 20 PFU/cell. Cell lysates were harvested at 4 and 6 h postinfection, and cytoplasmic proteins were resolved by SDS-PAGE and analyzed by Western blot analysis with anti-3a or anti-flag antibodies (Fig. 3). The accumulation of 3A-containing proteins during infection correlated with the growth of the corresponding viruses: 3A, 3AB, and larger precursors containing 3A sequences accumulated at similar rates and to similar levels for the wild-type and PV-3A- FLAG-Y viruses, while accumulation of these proteins in cells infected with PV-3A-FLAG was slower by 2 h (Fig. 3). The FLAG epitope was present and recognized by specific antibodies both in cells infected with PV-3A-FLAG and PV-3A- FLAG-Y viruses. These data demonstrated that the modified FLAG-Y sequence DYKDDDYK (the modification is in boldface) retained its reactivity with anti-flag antibodies. Immunoaffinity isolation of tagged 3A proteins from infected cells. Cells infected with PV-tagged 3A viruses for 5.5 to 6 h were lysed in the presence of 1% NP-40, and cellular lysates were incubated with commercially prepared agarose beads covalently linked to anti-tag-specific antibodies. Figure 4A shows that the 3A and 3AB proteins carrying the FLAG-Y epitope insertion adsorbed efficiently ( 85%) to anti-flag-coated beads (compare lanes 1 and 2) and that recovery of the tagged 3A and 3AB proteins was achieved after elution (lane 3). A similar binding and elution pattern was exhibited by the larger 3A precursor proteins (not shown; see Fig. 3). As expected, untagged wild-type proteins present in a control extract loaded on the anti-flag column (lane 4) flowed through the affinity column (lane 5), and no 3A or 3AB proteins were detected in the elution fraction (lane 6). In Fig. 4B, similar protocols were utilized to purify and monitor HA- and c-myc-tagged proteins, as indicated. Adsorption of HA-tagged 3A, 3AB, and larger

7 4290 TETERINA ET AL. J. VIROL. FIG. 4. Immunoprecipitation of tagged 3A proteins. (A) HeLa cells were infected with PV-3A-FLAG-Y virus (lanes 1 to 3) or wildtype virus (lanes 4 to 6). Lysates were collected 6 h postinfection and subjected to immunoaffinity isolation using anti-flag affinity beads as described in Materials and Methods. Immune complexes were purified, electrophoretically separated, and subjected to immunoblot analysis with protein 3A-specific antibodies. L (lanes 1 and 4), total lysate prior to incubation with affinity beads; S (lanes 2 and 5), supernatant after incubation with affinity beads; E (lanes 3 and 6), fraction eluted from the affinity beads. (B) The same procedures as described for panel A were performed for lysates from PV-3A-HA- or PV-3Amyc-infected cells using the corresponding affinity beads as described in Materials and Methods. Samples shown in each panel of Fig. 4B were analyzed on the same gel. precursor proteins to the anti-ha beads was nearly 100% in this experiment (compare lanes 1 and 2), and recovery after elution was also highly efficient (lane 3). The anti-c-myc beads used in the experiment shown at the bottom of Fig. 4B were overloaded, so significant amounts of myc-3a and myc-3ab proteins flowed through the column (compare lanes 1 and 2); however, sufficient amounts of protein were adsorbed and recovered after elution (lane 3). Our protocols were generally optimized to bind the majority of tagged 3A and precursor proteins to the beads and to achieve efficient recovery of the tagged 3A-containing proteins after subsequent elution. This often required altering the ratio of beads to cell extract protein and varied somewhat for different extracts. FIG. 5. Analysis of proteins isolated with tagged protein 3A from virus-infected cells. HeLa cells were infected with PV-3A-FLAG-Y virus or wild-type PV for 6 h. Immunoaffinity purification via the FLAG tag was performed from infected cell lysates as described in Materials and Methods. Proteins eluted from the affinity beads were resolved by SDS-PAGE. (A) Gel was stained with silver stain. (B and C) The aliquot of total cellular lysate prior to immunoaffinity isolation (lanes 1 and 2) or proteins isolated from the affinity beads (lanes 3 and 4) were resolved by SDS-PAGE and subjected to immunoblotting with antibodies against poliovirus protein 2C (B, top); the same membrane was stripped and probed again with antibodies against poliovirus protein 3D (B, middle) and then with antibodies against poliovirus protein 2B (B, bottom). (C) Immunoblot analysis was performed using antibodies against the LIS1 protein. The membrane was stripped and probed again with anti-gbf1 antibodies. Isolation of tagged 3A protein binding partners. Since all three tagged 3A proteins in infected cell extracts could be specifically isolated by immunoaffinity adsorption and subsequent elution from the anti-tag beads, we sought to determine whether additional proteins, viral or cellular, that may have been bound to tagged 3A sequences in the infected cell extracts could also be detected in the column eluates. Figure 5A shows a silver stain of the fraction in which 3A FLAG-Y was eluted and resolved by SDS-PAGE, from the anti-flag affinity beads (lane 1), compared with a similarly prepared sample from cells infected with virus expressing the wild-type, untagged 3A protein (lane 2). Two major bands were present in both samples, corresponding to IgG heavy and light chains released from the immunoaffinity beads during the elution procedure. This contamination from both tagged and control extracts was reproducibly observed from the different batches of anti-flag and anti-c-myc beads that we utilized but was

8 VOL. 85, 2011 POLIOVIRUS PROTEIN 3A INTERACTIONS IN INFECTED CELLS 4291 almost absent from the anti-ha beads that we purchased (not shown). As expected, untagged 3A and 3AB were not detected in the control sample (lane 2), whereas the tagged proteins were readily observed (lane 1). In addition, numerous polypeptides extending over a wide molecular weight range were also detected from the tagged virus extract. These proteins had been bound to and eluted from the anti-flag beads along with 3A proteins and therefore represented candidates for proteins interacting with 3A in the infected cell during virus replication. Similar, although not identical, distributions of polypeptides were apparent in the anti-ha and anti-c-myc bead eluates (not shown). Viral proteins 3A/3AB are known to function in association with other viral and cellular proteins as part of a supramolecular complex that catalyzes viral RNA synthesis. Several investigators have looked for interactions among viral proteins from the P2 and P3 regions of the PV genome by yeast or mammalian two-hybrid analyses; these investigations suggested that 3A specifically binds 2B, 2C, 2BC, 3CD, and 3D under conditions of the two-hybrid fusion protein screens (29, 41). To determine whether our affinity purification protocol revealed 3A interactions with these proteins in the extracts prepared from virusinfected cells, we analyzed anti-flag affinity-purified samples by immunoblot analysis with antibodies against 2B, 2C, and 3D. Figure 5B shows that viral proteins 2C, 2BC, 3D, and 3CD and some processing intermediates were present in the fractions in which 3A was eluted from the anti-flag affinity beads. These proteins were not present in similarly prepared samples from cells infected with virus expressing untagged 3A protein, and thus their presence in the eluted fractions was dependent on the binding of tagged 3A-containing proteins to the anti-flag affinity beads. Protein 2B was not detected in the eluted fractions (Fig. 5B). Similar results were obtained using samples immunopurified from lysates of PV-3A-HA- or PV-3A-myc-infected cells (data not shown). Thus, at least some proteins that were implicated as potential 3A binding partners were identified in the anti-flag-purified samples as having been bound to 3A under conditions of virus replication. This result served to validate the use of this method to analyze potential cellular protein binding partners. Two cellular proteins, GBF1 and LIS1, have been shown previously to bind to PV or CVB3 3A sequences by yeast two-hybrid analysis (20, 36, 37); however, it is not known whether these binding interactions occur or are required for viral RNA replication during infection. We therefore examined the fractions that eluted from the anti-tag affinity beads with 3A by immunoblot analysis of these proteins. Figure 5C shows that GBF1 was clearly present in the samples of affinitypurified 3A-FLAG-Y. Although interactions between these two proteins had been demonstrated previously in cells overexpressing 3A protein by itself, this represents the first evidence of 3A/GBF1 binding during viral RNA replication in infected cells. No evidence of LIS coelution with 3A-FLAG-Y was observed (Fig. 5C). We also looked for the presence of PI4K III in these fractions, based on the recent report that antibodies to this lipid kinase coimmunoprecipitated 3A and 3AB from CVB3-infected cells (18). We did not detect evidence of direct binding of PI4K to 3A (data not shown). Copurification of GBF1 with different tagged 3A proteins. The binding of 3A to GBF1 was reported to be mediated by FIG. 6. Tag sequences inserted in protein 3A affect its interaction with GBF1. (A) Amino acid sequences of the N-terminal portions of 3A proteins with FLAG, modified FLAG-Y, HA, and myc insertions are shown. (B and C) Lysates of cells infected with either wild-type PV or one of the indicated recombinant viruses were subjected to affinity purification using the corresponding affinity beads. After an extensive washing step, proteins bound to the beads were eluted with SDS, electrophoretically separated, and subjected to immunoblotting with antibodies to GBF1 (top) or 3A (bottom). Lane 1 shows proteins present in the total cell lysate. 3A s N-terminal sequences (35), close to the location of the epitope insertions. Figure 6A shows the N-terminal sequences of the wild type and each of the tagged 3A proteins studied here. We performed affinity purification with anti-ha, anti-cmyc, and anti-flag antibodies from extracts prepared from cells infected with viruses bearing the corresponding tags in protein 3A or with wild-type PV. Fractions containing the eluted proteins were probed with anti-gbf1 antibodies (Fig. 6B, top). As shown in Fig. 5C, samples containing 3A-FLAG-Y showed efficient GBF1 pulldown; however, no GBF1 was detected in the samples from 3A-HA or 3A-myc pulldowns. The same membrane probed with anti-3a antibodies confirmed that similar amounts of 3A proteins were recovered from all samples (Fig. 6B, bottom). The absence of GBF1 in the 3A-HA and 3A-myc samples was surprising, since this laboratory has shown previously that GBF1 is an essential host factor

9 4292 TETERINA ET AL. J. VIROL. for viral RNA replication (2), and it has been generally thought that the requirement for GBF1 was accomplished by recruitment of this factor to the viral replication complex by virtue of its binding to 3A. Efforts to detect GBF1 by immunoblot analysis in samples of affinity-purified 3A-HA and 3A-myc proteins were repeated in multiple experiments, always yielding the same result. All variants of PV-3A-FLAG showed clear evidence of GBF1 binding (Fig. 6C). The absence of detectable 3A-GBF1 interactions in the HA- or c-myc-tagged 3A pulldowns from extracts of cells in which virus was growing robustly could be interpreted to mean that 3A-GBF1 binding is not required for GBF1 to fulfill its role in virus replication; however, it is also possible that these two mutant 3A proteins manifest a sufficiently reduced affinity for GBF1 to cause the two proteins to fail to remain associated during the immunoaffinity adsorption and washing procedure. Inhibition of virus growth by BFA and rescue with GBF1. In uninfected cells, GBF1 activates Arf GTPases that regulate the formation of transport vesicles in the cellular protein secretory pathway. GBF1 function is inhibited by a fungal metabolite, brefeldin A, which traps GBF1 in a nonproductive complex with GDP, preventing guanine nucleotide exchange and thereby blocking cellular membrane and protein trafficking. BFA is also a potent inhibitor of PV replication (19, 23); inhibition of virus growth by BFA can be rescued by overexpression of GBF1 (2). The striking difference between wildtype PV and PV-3A-FLAG-Y proteins, on the one hand, and PV-3A-HA and PV-3A-myc, on the other, to copurify with GBF1 prompted us to determine whether all of these viruses were sensitive to BFA and, if so, whether their growth could be rescued by GBF1. First we examined the BFA sensitivity of the wild-type PV replicon and mutant replicons containing FLAG-Y, HA, or myc tags in protein 3A. The replication assays were conducted in the absence or presence of two concentrations of BFA. These concentrations were determined previously to impose a partial (1 g/ml) and a near-complete (2 g/ml) inhibition of wild-type virus growth (2). In this experiment, in the absence of the inhibitor, replication of 3A-FLAG-Y, 3A-HA, and 3A-myc replicons was very similar to the replication of the wild type (Fig. 7A, top). High concentrations of BFA inhibited replication of all viruses (Fig. 7A, bottom). However, replication of the mutant replicons in the presence of an intermediate concentration of the inhibitor revealed that 3A-HA and 3A-myc replicons are significantly more sensitive to BFA: their replication was almost completely abrogated in the presence of 1 g/ml of BFA, whereas wild-type and 3A-FLAG replicons showed only partial sensitivity at this concentration of BFA (Fig. 7A, middle). Figure 7B shows a summary of the BFA sensitivity for the wild-type and all three tagged 3A viruses, based on replication levels at 8 h posttransfection and expressed as a percentage of luciferase signal in the absence of the drug. The replicons sorted into two distinct categories: wild-type and 3A-FLAG-Y replicons showed nearly identical BFA sensitivities, whereas 3A-HA and 3A-myc replicons were more sensitive to BFA. This division correlated precisely with the ability of the 3A protein sequence to bind GBF1 during the pulldown assay. To confirm that the BFA sensitivities of these viruses resulted from BFA s inactivation of GBF1, we attempted to rescue the BFA inhibition of viral RNA replication by expression of a BFA-resistant GBF1 (3, 22). Cells were transfected with a plasmid expressing GBF1 A795E, a GBF1 mutant conferring BFA resistance, 24 h prior to transfection with PV replicons in the presence or absence of BFA. Figure 8 shows that expression of the BFA-resistant form of GBF1 efficiently rescued the replication of all three mutant replicons, 3A- FLAG-Y, 3A-HA, and 3A-myc, to approximately the same level as that of the wild-type replicon. All transfected cells expressed similar amounts of GBF1 (Fig. 8, bottom). Thus, despite the failure of the 3A-HA- and 3A-myc-tagged proteins to demonstrate stable binding of GBF1, the sensitivities of these viruses to BFA were rescued efficiently by the BFAresistant GBF1. DISCUSSION Successful virus replication depends upon a complex set of interactions between viral proteins and host cell factors that together create the appropriate intracellular environment and activities required for virus growth. Often, the identification of cellular factors that are recruited or modified by viral components to play essential roles in virus replication are initially sought by searching for proteins that bind specifically to viral gene products. A variety of methods, such as photo or chemical cross-linking, cocapture by immune or other affinity purification, genetic complementation, functional domain screening by two-hybrid analyses, or small interfering RNA (sirna) depletion screens, have been explored for the purposes of elucidating these virus-host cell interactions. Data from these methods are not easy to interpret, and most require multiple and often tedious validations. The approach utilized in this study was to search for cellular proteins in infected cell extracts that remained bound to 3Acontaining protein sequences during immunoaffinity purification. To minimize inclusion of adventitious or nonspecific 3A binding partners, we produced 3A proteins with multiple different epitope tags from viruses that were selected to grow robustly when the tags were introduced into the viral genome. Transposon-mediated mutagenesis had previously pointed us to a region near the N terminus of 3A that would tolerate small insertions (28), and three viable viruses, each containing a different epitope tag in that region, were isolated and characterized. Stable virus clones encoding all three tagged versions of 3A were shown to replicate efficiently in cultured HeLa cells, inhibit cellular protein secretion and protein synthesis, exhibit normal patterns of intracellular protein localization, and behave overall similarly to the wild-type virus. Our rationale was that if interactions between 3A and a particular set of cellular proteins were essential for virus growth, then those cellular proteins should be found in all three collections, regardless of which tag was used for purification. When cytoplasmic extracts of cells infected with the tagged viruses were subjected to immunoaffinity purification by adsorption to and elution from antibodies immobilized on beads, efficient recovery of tagged 3A and 3AB proteins was readily achieved, although optimal conditions varied slightly for different reagent batches and different extracts. A collection of additional proteins, both viral and cellular, was cocaptured with the 3A proteins in the material eluted from the beads,