EFFECTS OF ALUMINIUM AND FLUORIDE ON THE EXPRESSION OF TYPE I COLLAGEN IN THE TEETH OF GUINEA PIGS

Transcription

1 45 45 EFFECTS OF ALUMINIUM AND FLUORIDE ON THE EXPRESSION OF TYPE I COLLAGEN IN THE TEETH OF GUINEA PIGS Min Wang, a,b Tianlong Han, a,b Chunfang Cao, a Jundong Wang a Shanxi, China SUMMARY: Effects of aluminum (Al) and fluoride (F) on the expression of type I collagen (COL1A1) were investigated in the teeth of guinea pigs administrated sodium fluoride (NaF, 150 mg/l) and/or aluminium trichloride (AlCl 3, 300 mg/l) in their drinking water. Quantitative real-time polymerase chain reaction (QRT-PCR) and immunohistochemistry (IH) were used to quantify the gene and protein expression levels of COL1A1, respectively. These expressions were significantly reduced (p<0.05) in the incisor and molar teeth of guinea pigs treated with Al and F alone and in combination. Interestingly, in comparison with animals exposed to F alone, the COL1A1 protein level in the Al plus F group was statistically increased (p<0.05). Keywords: Aluminium; Fluoride; Guinea pig; Teeth; Type I collagen. INTRODUCTION A previous investigation has shown a positive association between high aluminium (Al) exposure and increased fluoride (F) in the blood of workers in an Al smelter. 1 Actually, besides occupational exposure, the increasing coexistence of Al and F in the natural environment with the industrial development also threatens the health of human beings and animals. 2 Owing to the strong chemical affinity between F and Al, a number of experiments have been conducted to investigate the biological interaction between the two elements. 3-6 Results show they can induce alterations in intelligence, memory, metabolism, and growth in animals and humans. However, opinions on their interaction still differ. Some research on hard tissues showed that high doses of Al restrained dentinification in mice induced by F, 7 whereas other studies on the brain revealed that neuronal brain cell damage occurred in rats administrated Al and F, indicating a synergistic effect. 3 Moreover, an in vitro study found that F weakened the inhibitory action of Al on the growth of human embryo osteoblasts, 8,9 providing evidence for an antagonism between F and Al. It appears, therefore, that there is a complex biological interaction between F and Al. Our earlier experiments demonstrated significant negative effects of F on type I collagen (COL1A1) in the teeth of rabbits and sheep. 10,11 In the present study, in order to investigate the combined effects of F and Al on the expression of dental type I collagen (COL1A1), the guinea pig, an animal especially sensitive to F, was chosen to quantify the gene and protein expression levels of COL1A1 in its incisor and molar teeth in order to elucidate further the complex mechanisms involved in teeth damaged by F and Al. a For correspondence: Prof Jundong Wang, Shanxi Key Laboratory of Ecological Animal Science and Environmental Medicine, Shanxi Agricultural University, Taigu, Shanxi, , PR of China; wangjd@sxau.edu.cn. b Chifeng Animal Husbandry Veterinary Science Research Institute, Chifeng, Inner Mongolia, , PR of China.

2 46 46 MATERIALS AND METHODS Experimental animals: Fifty-two eight-week-old healthy white male Hartley guinea pigs weighing g, supplied by the Xinglong Experimental Animal Nursery of Beijing, were randomly divided into 4 groups fed with standard feed (provided by Experimental Animal Center of Shanxi Medical University) and given drinking water as shown in Table 1. The study design was approved by the Institutional Animal Care and Use Committee of China. Table 1. Fluoride (as NaF) and aluminium (as AlCl 3) in the drinking water Group (n=13) Treatment NaF (mg/l) AlCl 3 (mg/l) Control Normal 0 0 F NaF Al AlCl F+Al NaF+A lcl On the 90 th day of feeding, the animals were lethally anesthetized with 2% pentobarbital sodium solution, and the incisors and molars were extracted and quickly dipped into 4% polyoxymethylene for staining and stored in liquid nitrogen for total RNA extraction. HE and Masson staining: After being decalcified with 10% EDTA (ethylenediaminetetraacetic acid), the teeth were then dehydrated, embedded in paraffin, and sliced in 5-µm sections for staining with HE (haematoxylin and eosin) and Masson following the protocol recommended by the reagent kit (Masson, Tianjing Tianjin Chemical Industry). Total RNA extraction and QRT-PCR: Incisors and molars were crushed up in liquid nitrogen, and total RNA was extracted following the procedure as Yan et al. 9 for QRT-PCR (real-time fluorescence quantitative reverse transcription polymerase chain reaction). According to the alignments of the published mrna sequences of β-actin and COL1A1 genes of guinea pig in Genebank, two pairs of specific primers shown in Table 2 were designated by the Primer Premier 5.0 and Primer 3 software. Table 2. Primer sequences with their corresponding PCR product size and position Gene Primers Primer locations Product (base-pairs) Genebank accession No. β-actin AGCAGATGTGGATCAGCAAG AAGGGTGTAACGCAGCAAAG AF COL1A1 CTGGACAGCGTGGTGTAGTC TCCAGAAGGACCTTGTTTGC AF The expression level of COL1A1 gene was quantified by the method of Yan et al. 9 except that the annealing step was performed at 58 C for 20 sec. The amplified products were analyzed by agarose gel electrophoresis.

3 47 47 Immunohistochemistry: The procedures were processed according to the protocol recommended by the COL1 immunohistochemistry kit (StreptAvidin Biotin Complex Kit, Wuhan Boster Biotechnology Co., LTD). After deparaffinization and rehydration, sections were selectively incubated separately using goat anti-col1 polyclonal antibody (1:100, Santa Cruz Biotechnology, Inc.) for 3 hr at 37 C, washed 3 times in PBS (phosphate buffered saline). Next, biotinlabeled anti-goat secondary antibody (Haoyang Biological Manufacture Co. LTD. Tianjin, China) was introduced and incubated for 20 min at 37 C. The specificity of the antibodies was tested by omission of the primary antibodies. After washing in PBS, tissues were visualized with DAB (diaminobenzidine) and counterstained with hematoxyline. Finally, the sections were dehydrated in xylene and coverslipped for microscopic examination. Statistical analysis: An independent sample t-test (Statistical Package for the Social Sciences, SPSS 11.0) was performed to analyze differences in COL1 protein expression level. Differences with p<0.05 were considered statistically significance. RESULTS Histomorphology: The model of guinea pigs with dental fluorosis has been successfully developed (Figure 1). The teeth showed obvious mottled enamel and irregular abrasions in the F group, but there were no clear manifestation of dental fluorosis in the Al and F+Al groups. Figure 1. Incisor and molar guinea pig teeth damaged by 150 mg NaF/L with obvious dental fluorosis. The results of HE and Masson staining (Figures 2 and 3) were in agreement with our previous studies. 3 Fluoride-induced collagen damage was attenuated in group F+Al. COL1A1gene and protein expression: As shown in Figures 4 and 5 and in Table 3, gene and protein expressions were significantly reduced in both the F and Al groups, whereas partial recovery occurred in the F+Al group.

4 48 48 Figure 2. Photomicrographs showing HE staining the dentin structure of guinea pig teeth in the control group (A) and the 150 mg NaF/L group (B). Figure 3. Photomicrographs of Masson staining showing the dentin structure of the guinea pig teeth in the control group (A) and the 150 mg NaF/L group (B). Figure 4. Photomicrographs showing expressions of COL1A1 in dentin of guinea pig teeth in the control group (A) and the 150 mg NaF/L group (B).

5 49 49 Relative expression Control F Al F + Al Incisor Molar Figure 5. R relative expression level of the COL1A1 gene in incisor and molar teeth of guinea pig in the four groups. Table 3. Expression of COL1A1 in incisor and molar teeth of the guinea pigs (mean±sem, n=10) Group Incisor COL1A1 Molar COL1A1 Control 22.23± ±0.65 F 14.42±0.75* 18.04±0.29* Al 15.24±0.99* 21.70±0.32* F+Al 16.32±0.60* 23.61±0.55* *p<0.05: F, Al, and F+Al groups compared with control group, respectively. p<0.05: F+Al group compared with F group. DISCUSSION Owing to their widespread existence in the modern environment, F and Al can easily accumulate in the body through water, food, air, and pharmaceutical products, which are now attracting increased attention to the toxicity of F and Al alone or in combination. Earlier studies in our laboratory demonstrated that F adversely affects tooth mineralization and dentin growth. 12,13 In the present study, F exposure resulted in serious mottled enamel and irregular abrasion in the teeth of guinea pigs, which are morphologically in agreement with previous studies. 12,14 However, tooth lesions in the F+Al group were less than in the F group. Studies on absorption of Al and F in the intestines have shown that the presence of Al inhibited the uptake of F. 15,16 This may be the possible reason for the recovery in tooth structure in the F+Al group. Since collagen is the main structure-stabilizing component of bones and teeth, alterations in collagen could be a main reason for hard tissue lesions induced by

6 50 50 F. 17 For this reason, the expression of COL1A1 mrna and protein in relation to F and Al were investigated in this study. Our findings showed that administration of 150 mg NaF/L in the drinking water inhibited the expression of COL1A1 in the teeth of guinea pigs, and the depression effects were also detected in the 300 mg AlCl 3 /L group. Compared with the control group, COL1A1 expression levels were also decreased in the combined Al+F group. When AlCl 3 and NaF are present together in water, aluminofluoride complexes are formed spontaneously. Previous investigations indicate that AlCl 3 potentiates the adverse effects of low doses of NaF, and thus F in the presence of trace amounts of Al could affect protein phosphorylation and organization of cytoskeletal proteins, the functions of bone cells, calcium homeostasis, ion transport, and energy metabolism. 2 Thus the decreased expression of dental COL1A1 observed here might be the result of the interaction of intracellular Al and F. However, we also found that COL1A1 protein expression in the F+Al group was higher than in the F group, possibly indicating a depressant effect of Al on F adsorption in intestinal tract. ACKNOWLEDGEMENTS Authors Min Wang and Tianlong Han contributed equally to this work. This research was sponsored by the China National Natural Science Foundation (Grant No ) and the Shanxi Province Key Laboratory Open Foundation (Grant No ). REFERENCES 1 Søyseth V, Kongerud J, Ekstrand J, Boe J. Relation between exposure to fluoride and bronchial responsiveness in aluminum potroom workers with work-related asthma-like symptoms. Thorax 1994;49(10): Strunecká A, Patočka J. Pharmacological and toxicological effects of aluminofluoride complexes. Fluoride 1999;32(4): Varner JA, Jensen KF, Horvath W, Isaacson RL. Chronic administration of aluminumfluoride or sodium-fluoride to rats in drinking water: alterations in neuronal and cerebrovascular integrity. Brain Res 1998;784(1-2): Chinoy NJ, Patel TN. Effects of sodium fluoride and aluminium chloride on ovary and uterus of mice and their reversal by some antidotes. Fluoride 2001;34(1): Chinoy NJ, Sorathia HP, Jhala DD. Fluoride+aluminium induced toxicity in mice testis with giant cells and its reversal by vitamin C. Fluoride 2005;38(2): Ali G. Fluoride and aluminium tolerance in planktonic microalgae. Fluoride 2004;37(2): Yang LP, Wang KY, Li H, Shi XQ. The chronic toxicity of aluminum trichloride on bone and teeth in mice. J Toxicol 2008;22(3):19-4. [in Chinese]. 8 Kang J, Huang GW. The effect of aluminum and fluorine on the growth and development of human osteoblasts in vitro. Journal of Tianjin Medical University 2001;7(2):20-3. [in Chinese]. 9 Li HR, Wang WY, Yang LS, Li YH, Li HL. Research progress on the joint effect of fluoride and aluminium [abstract]. Proceedings of the 2005 World Conference of Chinese Geographers; 2005 Aug 16-17; Beijing, PR China. 10 Yan XY, Li WT, Zhou BH, Wang JM, Wang JD. Effect of supplemented protein and Ca nutrition on fluoride-induced disturbance of rib COL1A1 gene expression in rabbits. Fluoride 2007;40(2):140-8.

7 Li WT, Yang LF, Ren YC, Yan XY, Wang JD. Quantification of rib COL1A2 gene expression in healthy and fluorosed Inner Mongolia cashmere goats. Fluoride 2007;40(1): Wang JD, Zhan CW, Chen YF, Li JX, Wang WF, Cai JP. A study of damage to hard tissue of goats due to industrial fluoride pollution. Fluoride 1992;25(3): Hao YQ, Wang GQ, Niu ZY. Effects of fluoride on dentin. Chinese Journal of Conservative Dentistry 2003;13(2): [in Chinese]. 14 Wang JD, Guo YH, Liang ZX, Hao JH. Amino acid composition and histopathology of goat teeth in an industrial fluoride polluted area. Fluoride 2003;36(3): Allain P, Gauchard F, Krari N. Enhancement of aluminum digestive absorption by fluoride in rats. Res Commun Mol Pathol Pharmacol 1996;91(2): Spencer H, Kramer L, Norris C, Wiatrowski E. Effect of aluminum hydroxide on fluoride metabolism. Clin Pharmacol Ther 1980;28(4): Susheela AK, Sharma YD. Certain facets of F action on collagen protein in osseous and nonosseous tissues. Fluoride 1982;15(4): Copyright 2010 The International Society for Fluoride Research Inc Editorial Office: 727 Brighton Road, Ocean View, Dunedin 9035, New Zealand.