MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER DISEASE (NAFLD)

Transcription

1 MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER DISEASE (NAFLD) By KAITLYN ABDO A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2017

2 2017 Kaitlyn Abdo

3 To my mother, for always standing by me through the good times and the bad, and to my brother, for rolling with the punches

4 ACKNOWLEDGMENTS I thank my family for their support, and my amazing coworkers and mentor. For without them, I would not have accomplished this great feat. My father was my greatest inspiration, and my mother my strongest level of support. Support for this work was provided by Dr. Cusi s ongoing Endocrine, Diabetes and Metabolism research program. I would like to thank Dr. Sunny for experimental design and implementation of the jugular catheters. Srilaxmi Kalavalapalli was instrumental in conducting and analyzing the insulin assay. Furthermore, I would like to acknowledge Gabriel Fernandez from Dr. Clayton Matthew s lab for his expertise in mitochondrial respiration and ROS assays, and Dr. Matthew Merritt for utilization of the Oroboros O2K system. I would also like to acknowledge the University of Florida Molecular Pathology Core for work done on histology. 4

5 TABLE OF CONTENTS page ACKNOWLEDGMENTS... 4 LIST OF FIGURES... 8 LIST OF ABBREVIATIONS ABSTRACT CHAPTER 1 GENERAL OVERVIEW OF NONALCOHOLIC FATTY LIVER DISEASE Why Study NAFLD: Biological and Clinical Relevance of Studying NAFLD Progression of NAFLD to NASH The Pathophysiology of NAFLD Hepatic Insulin Resistance in NAFLD Mitochondrial Dysfunction and Inflexibility Overall Hypothesis ESTABLISHMENT OF AN IN VITRO MODEL SYSTEM TO PROBE MITOCHONDRIAL ALTERATIONS IN EARLY STAGES OF NAFLD Materials and Methods Chemicals Animal Studies Primary Hepatocyte Isolation Mitochondrial Respiration Mitochondrial ROS Production Histology Western Blotting for Protein Expression Gene Expression Analysis Biochemical Measurements Targeted Metabolomics Statistics Results Hepatocytes of Mice Fed a High Fructose Diet Develop NAFLD at 4 Weeks.. 28 Protein and Gene Expression Show Insulin Resistance and Increased Mitochondrial Function at 4 Weeks of Feeding Mitochondrial Respiration and ROS Production is Elevated in TFD Mice at 4 Weeks INTRALIPID CHALLENGE SHOWS COMPLETE MITOCHONDRIAL DYSFUNCTION IN MOUSE MODEL OF NASH

6 Materials and Methods Chemicals Animal Studies Histology Jugular Vein Catherization Intralipid Infusion Preliminary Data for Intralipid Infusion Rate Intralipid Infusion Analysis Western Blotting for Protein Expression Gene Expression Analysis Biochemical Measurements Targeted Metabolomics Statistics Results C57BL/6J Mice Develop NASH at 24 Weeks of High Fructose High trans- Fat Feeding Mitochondria are Dysfunctional in Mouse Model of NASH NASH Mice Exhibit Severe Insulin Resistance DISCUSSION APPENDIX: SUPPLEMENTARY FIGURES LIST OF REFERENCES BIOGRAPHICAL SKETCH

7 LIST OF TABLES Table page 2-1 Expression of genes related to mitochondrial metabolism and inflammation markers in primary isolated hepatocytes of C57BL/6J mice fed on a control diet or a high fructose high trans-fat diet (TFD) for 4 weeks Clinical and metabolic parameters from biological samples of C57BL/6J control and TFD fed mice when challenged with a five-hour glycerol or Intralipid infusion Expression of genes related to mitochondrial metabolism and inflammation markers in liver homogenates of C57BL/6J mice fed on a control diet or a high fructose, high trans-fat diet (TFD) for 24 weeks A-1 Primer sequences for genes analyzed with qpcr for isolated hepatocytes and liver homogenates

8 LIST OF FIGURES Figure page 1-1 Fatty liver disease progresses to steatohepatitis Fat accumulation occurs in insulin resistant liver with NAFLD Hepatic insulin resistance and dyslipidemia in NAFLD Histology of C57BL/6J mice fed on a control or TFD diet for 4 weeks Metabolic changes in C57BL/6J primary hepatocytes following a custom media incubation Insulin signaling was blunted in NAFLD-modeled hepatocytes Genes involved in fat oxidation and ketogenesis were upregulated in TFD mice at 4 weeks Hepatocytes isolated at 4 weeks of TFD exhibited elevated fibrotic and inflammatory markers Primary hepatocytes from 4-wk TFD mice showed elevated oxygen consumption rate (OCR) and ROS production with NAFLD Histology of C57BL/6J mice fed a control or TFD diet for 24 weeks Basal parameters of control and TFD fed mice TFD raises fasting plasma insulin and Intralipid increases insulin and glucose levels C57BL/6J mice following a 5-hr Intralipid infusion exhibited mitochondrial dysfunction and inflexibility Basal insulin signaling is upregulated in insulin resistant C57BL/6J TFD mice Gene expression of C57BL/6J mice at 24 weeks of feeding Inflammation and fibrosis is present in NASH mouse models A-1 Concentration of FFAs (mmol/l) over a period of 5 hours, including baseline (0 hours) A-2 Quantification of western blot from hepatocytes on 4-week diet A-3 Plasma blood glucose levels in 24-week fed mice

9 A-4 Plasma urea concentrations in mice on 24-weeks of control or TFD diet A-5 Quantification of western blot from liver homogenates on 24-week diet

10 LIST OF ABBREVIATIONS Acc1 Acetyl-coA carboxylase 1 ADP ATP BGL BSA Chrebp Cpt1a CytC DMF DPBS Fas FBS FFA Adenosine diphosphate Adenosine triphosphate Blood glucose levels measured in mg/dl Bovine serum albumin Carbohydrate-responsive element-binding protein Carnitine palmitoyltransferase 1a Cytochrome C Dimethylformamide Dulbecco s phosphate buffered saline Fatty acid synthase Fetal bovine serum Free fatty acids Fgf21 Fibroblast growth factor 21 Hmgcs2 3-Hydroxy-3-methylglutaryl-coA synthase 2 Il6 Interleukin 6 IR Lcad Insulin resistance Long chain acyl-coa dehydrogenase Mmp13 Matrix metallopeptidase 13 MTBSTFA NAFLD NASH OCR N-tert-Butyldimethylsilyl-N-methyltrifluoroacetamide Nonalcoholic fatty liver disease is defined by the accumulation of fat in the liver Nonalcoholic steatohepatitis is characterized as the end-stages of NAFLD, with hepatocyte injury and inflammation Oxygen consumption rate 10

11 Ppara Peroxisome proliferator-activated nuclear receptor alpha variant Pc1 Pro-collagenase 1 ROS T2DM TCA cycle TG Reactive oxygen species Type II diabetes mellitus Tricarboxylic acid cycle Triglycerides Ucp2 Uncoupling protein 2 11

12 Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science MITOCHONDRIAL OXIDATIVE METABOLISM IN NONALCOHOLIC FATTY LIVER DISEASE (NAFLD) Chair: Kenneth Cusi Major: Medical Sciences By Kaitlyn Abdo August 2017 Dysfunctional mitochondrial energetics and hepatic insulin resistance are central features of nonalcoholic fatty liver disease (NAFLD). Mitochondrial pathways (tricarboxylic acid (TCA) cycle, ketogenesis, respiration and ATP synthesis) remodel with progressed severity of hepatic insulin resistance and fatty liver disease. While the activity of several of these pathways are induced during early stages of insulin resistance, mitochondrial respiration and ATP synthesis have been shown to be impaired during more severe states, including nonalcoholic steatohepatitis (NASH) and type 2 diabetes mellitus (T2DM). Understanding the metabolic events during the remodeling of oxidative metabolism and its interaction with reactive oxygen species generation through the electron transport chain is of significant interest for developing therapeutic strategies. We hypothesize that chronic free fatty acid (FFA) overload will result in hepatic insulin resistance and further disturb the mitochondria s flexibility to compensate and adapt to nutrient and hormonal stimuli. In in vitro studies, primary hepatocytes isolated from mice (C57BL/6J) challenged with a high fructose, high transfat (TFD) diet or a control diet for 4-wks, were treated with low (0.2 mm) vs. high (0.8 mm) FFA. In vivo studies were conducted on mice with NASH, following 24-wks of TFD 12

13 feeding. These mice were infused with Intralipid for 5-hrs to elevate FFA levels by 2-3 fold. Measures of ketone production, insulin signaling by western blot analysis, gene expression patterns, and analysis of circulating biomarkers were conducted to test our hypothesis. Primary hepatocytes isolated from 4-wk TFD fed mice had impaired insulin signaling and higher hepatocyte triglyceride content (Control: 0.25±0.12 vs. TFD: 1.15±0.03 mg/ml; p < 0.05). In spite of insulin resistance, ketogenesis (Control: 766±115 vs. TFD: 1242±105 µm; p < 0.05) was upregulated in extracted primary hepatocytes. However, when mice with NASH were challenged by Intralipid infusion, the mice clearly illustrated an inability to induce ketogenesis (C-Glycerol: 213±35.2, C- Intralipid: 513±169, TFD-Glycerol: 654±213, TFD-Intralipid: 615±99.9 µm) indicating blunted compensatory mechanisms to FFA overload. Early induction of ketogenesis despite hepatic insulin resistance in primary hepatocytes and the blunted response of ketogenesis to Intralipid challenge in mice with NASH, demonstrates mitochondrial inflexibility. Blunted compensatory mechanisms within hepatic mitochondria during hepatic insulin resistance can result in sustained induction of oxidative flux, hastening oxidative stress and inflammation. 13

14 CHAPTER 1 GENERAL OVERVIEW OF NONALCOHOLIC FATTY LIVER DISEASE Nonalcoholic fatty liver disease (NAFLD) is a prevalent metabolic disorder that is due to the accumulation of fat in the liver and is associated with metabolic dysfunction and insulin resistance [1], [2], [3]. Excess adiposity and insulin resistance are two major risk factors of NAFLD [4]. Fatty liver disease is a common comorbidity of type 2 diabetes mellitus (T2DM) as well as obesity [5]. NAFLD can progress further to nonalcoholic steatohepatitis (NASH), with inflammation and fibrosis [6]. Why Study NAFLD: Biological and Clinical Relevance of Studying NAFLD NAFLD is defined as the accumulation of fat in the liver more than 5% by histology and absence of other liver conditions and alcohol consumption [5]. Consequence of chronic fatty liver disease include cirrhosis, hepatocellular carcinoma, and also increased risk of cardiovascular disease [6]. Approximately 34% of the people in the United States have been diagnosed with NAFLD, and this disease stands to be the leading cause of liver transplants in the near future [7], [8]. Furthermore, NAFLD has become common in pediatrics, with up to 50% of obese children [9]. Despite the prevalence of this disease, patients with NAFLD are underdiagnosed and undertreated in the clinical setting. Many of the limitations in clinical practice are secondary to our poor understanding of the pathogenesis of the disease. It is currently unclear the factors involved in the development and progression of the disease [7]. Currently there are no exclusive therapeutic options that specifically target the disease, and the current diagnosis requires a liver biopsy, due to lack of good plasma biomarkers [5], [10]. A better understanding of the underlying mechanisms involved in the development and 14

15 progression of NAFLD is essential, if we want to overcome the current clinical limitations. Progression of NAFLD to NASH It has been suggested that this two-hit hypothesis is outdated and that multiple parallel hits simultaneously lead to the progression of NAFLD [11]. The first hit in the progression of NAFLD is associated with accumulation of fat in the liver and the second characterized by signs of fibrosis and inflammation [12], [11]. Large clinical studies have identified an excessive FFA supply, hyperinsulinemia, and hyperglycemia as key factors in the progression of NAFLD to NASH [13], [14], [15]. Seventy percent of T2DM patients have isolated steatosis [5], [16]. Isolated steatosis (IS) gradually transitions to NASH, with inflammation and fibrosis [17] (Figure 1-1). The mitochondria in the liver attempt to adapt to the chronic influx of free fatty acids (FFA), and once maximal capacity is met, inflammatory and apoptotic pathways are initiated [13]. The maladaptation of the hepatic mitochondria is associated with the progression to nonalcoholic steatohepatitis (NASH) [6]. NASH can progress to cirrhosis of the liver and hepatocellular carcinoma [18], [19]. NASH is projected to be the leading cause of liver transplants [20], [21], [22]. Thus, studying NAFLD and the mechanisms by which the build-up of fat in the liver transitions to inflammatory responses is of biomedical and clinical importance [23]. The Pathophysiology of NAFLD Obesity leads to increased adiposity, and eventually, insulin resistance in the adipose tissue [4]. Insulin resistance in adipose tissue in conjunction with elevated free fatty acids from a chronic supply of nutrients leads to the continual accumulation of triglycerides (TGs) in the liver [7], [13]. In obese and T2DM patients, approximately 70% 15

16 of the lipolysis of adipose tissue into free fatty acids is used for fat synthesis in the liver [13], [24]. Fatty liver disease is characterized by peripheral insulin resistance and accumulation of lipid droplets in the liver (Figure 1-2). NAFLD is a multifactorial metabolic disorder that is strongly associated with the onset of hepatic insulin resistance (IR) from a chronic overload of metabolic substrates (free fatty acids) [1]. Hepatic IR is present from the liver s insensitivity to raised blood glucose levels (BGLs) and increased gluconeogenic pathways (either due to T2DM or obesity) [1]. A mouse model is necessary to target the mechanism by which NAFLD progresses to end-stage nonalcoholic steatohepatitis (NASH). Dysfunctional mitochondrial fat oxidation precedes lipotoxic byproducts (i.e. DAGs and ceramides) that further progress the disease due to inflammatory and cytokine responses [1]. Fat accumulation, resulting in hepatocellular injury, is commonly accompanied by inflammation [18]. Excessive accumulation in the hepatocytes of an insulin resistant liver ultimately leads to mitochondrial stress and increased cytokine and overproduction of reactive oxidative species (ROS) [26]. The continual fueling of these inflammatory and fibrotic pathways leads to hepatocyte apoptosis and cirrhosis of the liver [27]. The accumulation of lipids in the muscle has been previously studied, and now our lab is studying the same effect in the liver of mice due to the prevalence of NAFLD and the clinical relevance to studying the disease [7]. Hepatic Insulin Resistance in NAFLD Insulin is a hormone produced by the pancreas that partakes in many signaling transduction pathways, with the main role being the maintenance of physiologic blood glucose levels. Glucose transport is the primary defect in insulin-mediated glucose metabolism in patients with T2DM [5]. Adiposity is elevated in obese and T2DM 16

17 patients, which leads to further lipolysis of fat entering the hepatic mitochondria [23]. The hepatic mitochondria is involved in the storing or oxidizing of fat (from diet or adipose tissue) and this remains in homeostatic balance, unless insulin resistance occurs [23]. In NAFLD, there is mitochondrial dysfunction from fat overload that results in hepatic insulin resistance and lipotoxic byproducts [25]. Free fatty acids are the most abundant energy source circulating in the body under fasting conditions [28]. During hepatic insulin resistance, fatty acids are taken up by the liver for immediate energy, stored in the liver as triglycerides if energy demand is low, or excreted into the plasma as very low-density lipoproteins (VLDLs). Carnitine palmitoyltransferase I (CPT1) transports long-chain free fatty acids into the mitochondria to either be broken down through beta oxidation (β-oxidation) or to enter the tricarboxylic acid (TCA) cycle for immediate energy [23]. Upregulated fat oxidation results in the esterification of triglycerides and increased gluconeogenic pathways [23]. The liver, which is the location of the main source of glucose production, continues producing glucose, consequently causing hyperglycemia and hyperinsulemia [1]. In an insulin-resistant state, gluconeogenesis remains high and thus, more fats brought into the liver are stored and esterified as triglycerides. Mitochondrial activity is impaired to compensate for increased fat in IR patients. The TCA cycle is thus upregulated with IR from increased FFA, leading to further progression of the disease. The metabolic effects that occur in NAFLD from insulin resistance and unregulated uptake of FFA is shown in Figure 1-3 [29]. 17

18 Mitochondrial Dysfunction and Inflexibility The liver plays a major role in lipid metabolism [28]. TCA cycle flux increases in diet-induced mice with NASH [25]. Diacylglycerides (DAGs) and ceramides increase concurrently, regardless of increased TCA cycle activity to compensate for the influx of fat into the mitochondria [25]. This suggests incomplete fat oxidation and storage due to mitochondrial dysfunction [25]. Studies in mice fed on a trans-fat high fat diet (TFD) have shown the inability of the hepatic mitochondria to regulate ketone turnover. The mitochondria were unable to adapt to severe insulin resistance [30]. Chronic mitochondrial dysfunction triggers inflammatory pathways, with hepatocellular death, ballooning, and fibrosis. As a compensatory mechanism, mitochondrial respiration initially increases in response to an excessive FFA supply, but progression of the disease leads to diminished mitochondrial function [31]. Uncoupled mitochondrial respiration and elevated oxidative metabolism through the TCA cycle may increase reactive oxygen species (ROS) in patients with a fatty liver [32]. ROS production is recognized as the main contributor to hepatocellular death in the progression of NAFLD to NASH [33]. High concentrations of ROS have been attributed to the development of NASH [28], [34]. Reactive oxygen species is a natural product of mitochondrial metabolism; however, dysfunction from severe insulin resistance and chronic nutrient supply cause an overproduction of ROS, activating proinflammatory responses [28]. For example, it has been well studied that long-chain fatty acids activate toll-like receptor 4 (TLR4), and that diet-induced mice have shown to have increased hepatic inflammation through the TLR4 pathway [35, 36]. 18

19 Overall Hypothesis Previous investigators have set the groundwork for the emerging field in metabolic disorders. A study conducted in 2012 showed severely insulin resistant mice had impaired ketogenesis [30]. The inflexibility of ketone turnover supported the idea of mitochondrial metabolism remodeling during hepatic insulin resistance. Furthermore, researchers have suggested rates of hepatic mitochondrial oxidation, or flux through the TCA cycle, may play a key role in the progression of NAFLD. A prominent investigator in the field, Gary Shulman, showed that TCA cycle flux is not altered in NAFLD [38], which brings to attention the need to further study this disease. The Shulman lab measured hepatic fluxes in humans using an experimental method with labeled acetate and lactate. The data from Shulman s lab suggested flux through the TCA cycle is not a key player in the pathogenesis of NAFLD. Contrary to Shulman, our lab published last year that flux through the TCA cycle increases in diet-induced mice with NASH [25]. Concurrently, we also showed lipotoxicity in steatohepatitis occurs despite an increase in TCA activity. An increase in DAGs and ceramides suggest incomplete fat oxidation and storage mechanisms. Furthermore, an increase in TCA cycle was shown in rats when given an acute lipid load, or Intralipid challenge [37]. Likewise, oxidative stress and inflammation occurred in response to higher flux through the TCA cycle. Together, the idea that mitochondrial metabolism mediates oxidative stress and inflammation in fatty liver is new novel observation, and our lab is currently working on this emerging idea in more detail. Our main hypothesis is that hepatic mitochondria are unable to adapt to the influx of fat in mice with hepatic insulin resistance and fatty liver. Both in vivo and in vitro experiments will be conducted to support the stated hypothesis. In this study, we 19

20 present two studies, which together, capture the beginning and end-stages of fatty liver disease. Our first aim will be to develop a cell system to model NAFLD. In vitro studies will be used to see changes early on in an in vitro model of NAFLD, using low and high concentrations of palmitate. In our second aim, in vivo studies will be used to assess the acute and chronic adaptations of liver mitochondria during FFA overflow. These effects will support the idea of mitochondrial dysfunction and impartial fat oxidation. Mitochondrial oxidative flux is upregulated in NASH, and the current study is meant to tease out the mechanisms by which NAFLD is associated with fat oxidation. Intralipid infusion will be used to perturb mitochondrial oxidative function and detect metabolic alterations. Mitochondria are mechanistically dysfunctional during hepatic insulin resistance. Observing the effects of mitochondrial oxidative metabolism will reveal the alterations involved in NAFLD and aid in the discovery for drug therapeutics for the disease. 20

21 Figure 1-1. Fatty liver disease progresses to steatohepatitis. NAFLD is characterized by an infiltration of fat in the liver. This disease is extremely prevalent in patients with diabetes as well as obesity. Approximately 70% of T2DM patients will have a fatty liver and 30-40% of those patients will progress to NASH with fibrosis and inflammation within the liver, defined as NASH. Progression of NASH involves chronic inflammation and continual hepatocellular injury, leading to cirrhosis of the liver and high risk of cardiovascular disease [12]. 21

22 Figure 1-2. Fat accumulation occurs in insulin resistant liver with NAFLD. This human model demonstrates fat build-up in the liver compared to a healthy liver [7]. Chronic fat accumulation is associated with an insulin resistant state of the liver, connected with obesity and insulin resistant adipose tissue [25]. 22

23 Figure 1-3. Hepatic insulin resistance and dyslipidemia in NAFLD. Fat oxidation resulting from increased adiposity in combination with nutrient overload, leads to raised triglyceride levels and gluconeogenic pathways, along with increased ketone bodies and TCA cycle flux. 23

24 CHAPTER 2 ESTABLISHMENT OF AN IN VITRO MODEL SYSTEM TO PROBE MITOCHONDRIAL ALTERATIONS IN EARLY STAGES OF NAFLD In the current application, we developed an in vitro model system to study fatty liver disease. We created a cell system that exhibited similar physiological changes observed in a clinical setting in NAFLD. We designed the experiment to observe alterations in mitochondrial function early-on in the disease. The rationale behind this study was that teasing out mechanisms in isolated hepatocytes would provide further insight into the metabolic feature of NAFLD. Chemicals Materials and Methods Sodium D-3-hydroxybutyrate-2,4-13 C2 was purchased from Sigma Aldrich. Urea ( 13 C, 99%; 15 N2, 98%) was purchased from Cambridge Isotope Laboratories, Inc. All other chemicals came from Fisher Scientific. Animal Studies Animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Florida (UF) using protocol number Male mice (C57BL/6J) were ordered from Jackson Laboratory at 10 to 12 weeks of age for animal diet feeding studies. C57BL/6J mice were fed a synthetic control diet (C; 10% fat calories, no. D ; Research Diets) by Animal Care Services (ACS) or a high trans-fat diet (TFD; 40% fat calories, no. D ) for 4-5 weeks for in vitro studies. Primary Hepatocyte Isolation Primary hepatocytes were isolated by collagenase perfusion from C57BL/6J mice fed on either a control or TFD diet for 4 weeks. After several centrifugation steps, 1 million hepatocytes were seeded onto collagen-coated plates in customized Waymouth 24

25 media. Custom Waymouth media contained 10% of FBS, insulin (100nM), dexamethasone (100 nm), and penicillin-streptomycin. Following a 4 hour incubation period, primary hepatocytes were incubated overnight in low or high fat custom-made media- 0.2 mm FFA or 0.8 mm FFA. Custom-made media contained L-carnitine (1 mm), BCAA (0.2 mm), insulin (1 nm), glucose (5 mm), and glycerol (0.3 mm) in a solution containing 2% BSA in DPBS. Media was collected in hourly increments for ketone production measurements. For protein expression of insulin resistance, media was given an insulin bolus (50 nm) for 15 minutes and then the hepatocytes were collected. Cells were collected the next day for triglyceride content, as well as protein and gene expression analysis. Mitochondrial Respiration Intact mitochondria were isolated from fresh liver tissue using differential centrifugation. Mitochondrial oxygen consumption was measured using the Oroboros O2K system in mice fed four weeks on control or TFD diet. The chamber volume was 2 ml for each measurement. A total of 0.4 mg of mitochondrial protein was added to respiration incubation media at 37 C containing Complex I respiratory substrates, glutamate (2 M) and malate (0.8 M) to assess State 3 and 4 respiration. State 4, or nonphosphorylating oxygen consumption, was obtained as endogenous ATP is depleted from the addition of mitochondria. State 3, also known as ADP stimulated respiration, was induced with the addition of adenosine diphosphate in excess (ADP, 1 mm). All rates were recorded for at least 2 minutes. The assay was repeated in duplicate, with the rate of change between State 3 and 4 calculated for comparison. 25

26 Mitochondrial ROS Production Liver mitochondrial reactive oxygen species (ROS) production was done with constant stirring at 37 C using 150 μg of mitochondrial protein in 500 μl of incubation media. ROS production was assessed in the presence of Complex I substrates, glutamate/malate, and in the presence of Complex I and Complex III electron transport chain inhibitors to determine sources of ROS. This was done using an AmplexRed (AR) and horseradish peroxidase reaction, which measures the amount of hydrogen peroxide (H2O2) produced on a spectrofluorometer (Shimadzu RF5301PC). To determine the optimal inhibitor concentration, titration curves were performed for each inhibitor at concentrations of 0, 0.1, 1, 5, 10, and 20 μm in liver mitochondria utilizing either glutamate and malate or succinate to support ROS production, with the final concentration used as 10 μm for each inhibitor. Basal ROS production was assessed first for two minutes, Antimycin A added after the initial two minutes, and Rotenone added subsequently two minutes later. Each sample was analyzed for ROS production twice, with average concentrations of H2O2 reported. Histology Tissue (liver) from mice fed on diet for four weeks was placed in formalin for histology. Liver from mice fed on diet for 4 weeks were fixed in 10% neutral buffered formalin for hours, washed and stored in 70% ethanol before embedding in paraffin at the Molecular Pathology Core at University of Florida. The liver sections from the control mice and mice with NAFLD were then stained with Masson s Trichrome to visualize collagen fibers. The liver slides were blinded and scored by a veterinary pathologist using a previously published and validated scoring system of liver biopsies [39]. 26

27 Western Blotting for Protein Expression Primary hepatocytes were lysed in buffer containing protease and phosphatase inhibitors (Sigma-Aldrich, St. Louis, MO). Following SDS-PAGE, proteins were transferred to a nitrocellulose membrane (Protran; Whatman/GE Healthcare, Piscataway, NJ) and incubated overnight with the desired primary antibody (Cell Signaling Technology, Danvers, MA). Membranes were incubated in the IgG rabbit secondary antibody the next morning and developed using BioRad ChemiDoc System with ECL or lumigen imaging. Protein expression was quantified using Image J Software. Gene Expression Analysis Primary hepatocytes mrna were extracted by using Trizol. The extracted mrna was converted into cdna using the iscript cdna Synthesis Kit from (BioRad, Inc.). Quantitative real-time polymerase chain reaction (qpcr) was performed on the desired genes. The qpcr mix contained 25 ng cdna, 150 nmol/l of each primer and 5 µl SYBR Green PCR master mix (BioRad Inc.). Samples were run in triplicate on a CFX Real Time system (Bio Rad, C1000 Touch Thermal Cycler). The comparative threshold method was used to determine relative mrna levels with cyclophilin as the internal control. Primers used for qpcr are listed in Table A-1. Biochemical Measurements Hepatocyte triglycerides were resuspended in 2:1 chloroform: methanol and the supernatant was taken for measurement. Concentrations were determined using Serum Triglyceride Determination kit from Sigma Aldrich. 27

28 Targeted Metabolomics Analysis of plasma urea and ketones was done by gas chromatography-mass spectrometry (GC-MS). To 50 µl media, a known concentration of their respective internal standards was added. The samples were deproteinized with 500 µl acetone and supernatant was dried under nitrogen. Dried sample was converted to a derivative by 50% MTBSTFA + 50% DMF before separation on a HP-5MS column (30m x 0.25 mm x 0.25 μm; Agilent) under electron impact ionization (HP 5973N Mass Selective Detector, Agilent). Statistics All continuous variables were represented as means ± SEM. A Student s t-test was used for comparison among two groups, with significance determined as p<0.05. Results Hepatocytes of Mice Fed a High Fructose Diet Develop NAFLD at 4 Weeks An in vitro model system was created to perturb the mechanisms involved in the progression of NAFLD. Hepatocytes were isolated from the liver of mice fed either a semisynthetic control diet or a high fructose, high trans-fat diet. Histology at 4 weeks further validates this model with presence of lipid droplets in mice fed a high fructose high trans-fat diet. Hematoxylin and eosin (H&E) staining showed increased lipid droplets in TFD mice versus control (Figure 2-1A and 2-1B). Trichrome staining showed no fibrosis among both groups (Figure 2-1C and 2-1D). Mice fed on a high fructose, high trans-fat diet experienced adaptive mitochondrial oxidative metabolism and increased storage mechanisms (Figure 2-2). Challenging isolated hepatocytes from a four-week control-fed mouse with high FFA 28

29 (0.8 mm) led to increased triglyceride (TG) storage (Figure 2-2A). In media with physiological FFA, hepatocytes isolated from mice on a TFD diet had significantly higher TG content than their control counterparts. Furthermore, ketone production was elevated at each time interval in TFD-fed mice versus control-fed mice (Figure 2-2B). Protein and Gene Expression Show Insulin Resistance and Increased Mitochondrial Function at 4 Weeks of Feeding Insulin signaling was initially upregulated with elevated concentrations of free fatty acids in primary isolated hepatocytes. Antibodies involved in the downstream signaling of insulin (Akt Ser473) were probed to test insulin sensitivity. Protein expression was high due to increased nutrient supply at 4 weeks of feeding. Insulin sensitivity was tested by administering a bolus of insulin for 15 minutes (Figure 2-3). Control-fed mice had increased expression of Akt-P(Ser473) when stimulated with insulin. The phosphorylated form of Akt, downstream from the insulin receptor (Irs- 2), was used as a measure of insulin sensitivity. Western blots conducted using isolated hepatocytes showed increased expression in control-fed mice when given an insulin bolus. The expression of Akt-P(Ser473) was more prevalent when challenged with 0.8 mm FFA. Protein expression by western blotting showed elevated basal insulin signaling in TFD mice. The TFD mice at 4 weeks experienced a blunted response to an insulin stimuli, which is clearly shown with isolated hepatocytes in high FFA media. Protein expression was lower in TFD mice when challenged with high FFA, and did not increase significantly when stimulated by insulin. Fatty acid synthase (Fas) displayed higher expression in TFD mouse, but did not vary when challenged with insulin or high FFA. 29

30 Isolated hepatocytes fed for four weeks displayed alterations shown by qpcr. Genes involved in fat oxidation and ketogenic pathways were upregulated. Upregulation of FAO and ketogenesis were diet-induced. Pgc1a is a coactivator of Ppara, which is involved in fat oxidation as well as mitochondrial biogenesis and gluconeogenesis [31], [40], [41]. Cpt1a is the key enzyme in carnitine-dependent transport across the mitochondrial inner membrane [42]. We also analyzed the gene responsible for the uncoupling protein within the mitochondria, Ucp2, which separates oxidative phosphorylation from ATP synthesis and is used to control ROS production [43]. Genes involved in lipogenesis were also regulated differently in mice fed a TFD diet. The gene involved with fatty acid metabolism and is the rate-limiting step in fatty acid synthesis Acc1 [44], trended higher in mice on a TFD diet. Fatty acid synthase, Fas, involved with the synthesis of palmitate [45] trended lower with mice fed a high fructose, high trans-fat diet. Fibrotic and inflammatory markers were also upregulated in TFD mice (Table 2-1). Hepatic mitochondrial function was elevated at four weeks of high trans-fat feeding. A precursor for fat oxidation and involved in mitochondria biogenesis, Pgc1a, was upregulated in TFD mice compared to control (Figure 2-4A). The gene involved in bringing FFA into the mitochondria for oxidative metabolism, Cpt1a, was also upregulated in TFD mice. Higher nutrient supply (0.8 mm FFA) increased expression of Cpt1a (Figure 2-4B). Long chain acyl-coa dehydrogenase, Lcad, is the first enzyme involved in free fatty acid metabolism, and was upregulated in TFD mice (Figure 2-4C). 3-Hydroxy-3-methylglutaryl-coA synthase 2, Hmgcs2, the first enzyme involved in ketogenesis [46], exhibited increased expression in TFD hepatocytes compared to their control counterparts (Figure 2-4D). 30

31 Genes involved with collagen synthesis and breakdown, Pc1 and Mmp13, were upregulated in the hepatocytes of mice on a TFD diet [47]. Also involved in fibrosis, Pc1 and Mmp13, were upregulated in mice fed on a high fructose, high trans-fat diet for 4 weeks (Figure 2-5A and 2-5B). Interleukin 6, Il6, is a pro-inflammatory cytokine that acts to increase the breakdown of fats and to improve insulin resistance [48]. Il6 was significantly increased in TFD mice, and high FFA in the media of TFD hepatocytes further upregulated expression of Il6 (Figure 2-5C). Mitochondrial Respiration and ROS Production is Elevated in TFD Mice at 4 Weeks Oxygen consumption rates were higher in mice fed a TFD using glutamate and malate as substrates (Figure 2-6A). Isolated mitochondria at 4 weeks on a TFD displayed increased mitochondrial respiration at State 4 and State 3 respiration. Furthermore, ROS production was also increased at 4 weeks in TFD mice (Figure 2-6B). 31

32 Figure 2-1. Histology of C57BL/6J mice fed on a control or TFD diet for 4 weeks. A) Hematoxylin and eosin staining showed no lipid droplets in control mice. B) H&E staining showed drastically increased lipid droplets in mice fed a high fructose, high trans-fat diet for 4 weeks. Trichrome staining showed no fibrosis in C) control or D) TFD hepatocytes. 32

33 All data are represented as mean ± SEM; n=3-4. ( # p<0.05 among 0.2 mm FFA vs. 0.8 mm FFA; * * p<0.05 versus respective control group) Figure 2-2. Metabolic changes in C57BL/6J primary hepatocytes following a custom media incubation. A) Primary hepatocytes isolated from 4-wk TFD fed mice had a higher triglyceride content versus control-fed mice. B) Ketone production was elevated for each time increment in mice fed a high trans-fat diet for 4 weeks compared to a control diet in 0.2 mm FFA custom media. 33

34 0.2 mm 0.8 mm Control TFD diet Control TFD diet -ins +ins -ins +ins -ins +ins -ins +ins Akt-P (Ser473) Akt-T Fas Gapdh Figure 2-3. Insulin signaling was blunted in NAFLD-modeled hepatocytes. Akt- P(Ser473) insulin signaling expression was highly expressed from an insulin bolus in control-fed mice. In TFD hepatocytes with an acute insulin bolus, a blunted insulin signaling response was present. Quantification of the western blot is shown in Figure A-2. 34

35 Table 2-1. Expression of genes related to mitochondrial metabolism and inflammation markers in primary isolated hepatocytes of C57BL/6J mice fed on a control diet or a high fructose high trans-fat diet (TFD) for 4 weeks. Mice fed on a TFD for 4 weeks had elevated fat oxidation and ketogenic pathways. Mitochondrial respiration was also upregulated, in conjunction with lipogenesis. Mice fed at TFD had an upregulation in fibrosis and inflammatory genes. Control diet TFD diet Fat oxidation and Ketogenesis 0.2 mm FFA 0.8 mm FFA 0.2 mm FFA 0.8 mm FFA Pgc1a/Ppargc1a 1.00 ± ± ± 0.33 * 1.78 ± 0.28 Mitochondrial Respiration Lipogenesis Ppara 1.00 ± ± ± ± 0.14 Cpt1a 1.00 ± ± ± 0.27 * 3.45 ± 0.74 * Lcad/Acadl 1.00 ± ± ± ± 0.17 * Hmgcs ± ± ± 0.50 * 2.78 ± 0.48 * Ucp ± ± ± ± 0.38 Acc ± ± ± ± 0.11 Fibrosis and Inflammation Fas 1.00 ± ± ± ± 0.06 Pc ± ± ± 0.29 * 2.46 ± 0.74 Mmp ± ± ± ± 0.62 Il ± ± ± 0.53 * ±3.78 *# Values are mean ± SEM; n=3-5 per group. (*p 0.05 versus respective control groups; # p 0.05 between 0.2 mm and 0.8 mm FFA groups). 35

36 All data are represented as mean ± SEM; n=3-4. ( # p<0.05 among 0.2 mm FFA vs. 0.8 mm FFA; * p<0.05 versus respective control group) Figure 2-4. Genes involved in fat oxidation and ketogenesis were upregulated in TFD mice at 4 weeks. A) Pgc1a, an activator of Ppara, was significantly upregulated in a diet-induced model of NAFLD. B) The gene involved in bringing fat into the mitochondria for oxidation, Cpt1a, was also increased, and further increased with a high FFA challenge. C)The first step in the fatty acid oxidation, Lcad, was upregulated in TFD versus control. D) The first step in ketogenesis, Hmgcs2, was also elevated in TFD mice compared to the controls. 36

37 All data are represented as mean ± SEM; n=3-4. ( # p<0.05 among 0.2 mm FFA vs. 0.8 mm FFA; * p<0.05 versus respective control group) Figure 2-5. Hepatocytes isolated at 4 weeks of TFD exhibited elevated fibrotic and inflammatory markers. A) A promoter of collagen synthesis, Pc1, was significantly higher in mice fed a high fructose, high trans-fat diet. B) Another gene involved with fibrosis, Mmp13, showed an increasing trend in TFD compared to controls. C) A proinflammatory cytokine, Il6, was also higher due to diet, as well as a high FFA challenge. 37

38 Figure 2-6. Primary hepatocytes from 4-wk TFD mice showed elevated oxygen consumption rate (OCR) and ROS production with NAFLD. A) TFD isolated hepatocytes showed an increased OCR compared to control when given Complex I substrates during State 4 and State 3 respiration. B) At each mitochondrial complex inhibitor (Antimycin A for Complex III and Rotenone for Complex I), TFD isolated hepatocytes demonstrated increased ROS production compared to control-fed mice. 38

39 CHAPTER 3 INTRALIPID CHALLENGE SHOWS COMPLETE MITOCHONDRIAL DYSFUNCTION IN MOUSE MODEL OF NASH Our second aim of the study was to demonstrate mitochondrial dysfunction in a mouse model of NASH. This was done by feeding mice with a high fructose, high transfat diet for 24 weeks to induce steatohepatitis [49, 50]. To assess steatohepatitis, we used a nutrient-induced insulin resistant mouse model and administered an acute Intralipid infusion challenge. Chemicals Materials and Methods Intralipid (20% fat emulsion) was purchased from Fresenius Kabi. Heparin (1,000 units/ml) was purchased from Sagent Pharmaceuticals. All other chemicals came from Fisher Scientific. Animal Studies Animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Florida (UF) under protocol number Male mice (C57BL/6J) were ordered from Jackson Laboratory at 10 to 12 weeks of age for animal diet feeding studies. C57BL/6J mice were fed a synthetic control diet (C; 10% fat calories, no. D ; Research Diets) by Animal Care Services (ACS) or a high trans-fat diet (TFD; 40% fat calories, no. D ) for 24 weeks for in vivo studies. Histology Tissue (liver) from mice fed on diet for twenty-four weeks was placed in formalin for histology. Liver from mice fed on diet for 24 weeks were fixed in 10% neutral buffered formalin for hours, washed and stored in 70% ethanol before embedding in paraffin at the Molecular Pathology Core at University of Florida. The liver 39

40 sections from the control mice and mice with NAFLD were then stained with Masson s Trichrome to visualize collagen fibers. The liver slides were blinded and scored by a veterinary pathologist using a previously published and validated scoring system of liver biopsies [39]. Jugular Vein Catherization Jugular vein catheters were implanted in mice fed with control and TFD diet (n=5-9) for stable isotope infusions. Mice were given 100 µl buprenex under anesthesia the day of surgery and the day after surgery. Weight was monitored for 5 days to ensure viable mice. Intralipid Infusion Body weight (g) and fasting blood glucose levels (mg/dl) were recorded from each mouse before start of infusion. Mice were fasted one hour prior to the start of infusions. Control and TFD mice were randomized to receive either an Intralipid or a glycerol infusion over a 5 hour period. There were four treatment groups: control animals infused with glycerol (C + glycerol), control animals infused with Intralipid (C + Intralipid), TFD animals infused with glycerol (TFD + glycerol), and TFD animals infused with Intralipid (TFD + Intralipid). A group of control mice (n=11) were infused with only glycerol (n=5) or Intralipid (n=6). A group of TFD mice (n=17) were infused with only glycerol (n=8) or Intralipid (n=9). The Intralipid solution (20% fat emulsion) contained 2.25% glycerol, and thus the infusion of glycerol alone was 2.25%. Emulsion of 20% Intralipid was introduced through the mouse jugular vein catheter at a rate of ml/hour. Heparin was added (20 µl/ 1 ml Intralipid) to the infusion mixture to facilitate the lipolysis of Intralipid in vivo. 40

41 Preliminary Data for Intralipid Infusion Rate Two test animals were used to validate the dose of Intralipid infused. Mice were fasted an hour before infusion, and their blood (50 µl) were collected from the mouse tail vein in every hour interval for a total of five hours. Plasma was collected by spinning down the blood for 10 min, at 9000 rpm 4 o C. This was to test if desired level of free fatty acids (FFA, mmol/l) increased at least two-fold than normal to represent an elevated physiological level of free fatty acids (Figure A-1). Intralipid Infusion Analysis Following 5-hour infusion of either Intralipid or glycerol, mice were anesthetized and whole blood was collected from the descending aorta. Livers were flash frozen in liquid nitrogen and later stored at -80 C until further analysis. Western Blotting for Protein Expression Approximately 30 mg aliquots of frozen livers were used to analyze protein expression. Liver proteins were lysed in buffer containing protease and phosphatase inhibitors (Sigma-Aldrich, St. Louis, MO). Following SDS-PAGE, proteins were transferred to a nitrocellulose membrane (Protran; Whatman/GE Healthcare, Piscataway, NJ) and incubated overnight with the desired primary antibody (Cell Signaling Technology, Danvers, MA). Membranes were incubated in the IgG rabbit secondary antibody the next morning and developed using BioRad ChemiDoc System with ECL or lumigen imaging. Protein expression was quantified using Image J Software. Gene Expression Analysis Liver mrna was extracted by using Trizol. The extracted mrna was converted into cdna using the iscript cdna Synthesis Kit from (BioRad, Inc.). Quantitative real- 41

42 time polymerase chain reaction (qpcr) was performed on the desired genes. The qpcr mix contained 25 ng cdna, 150 nmol/l of each primer and 5 µl SYBR Green PCR master mix (BioRad Inc.). Samples were run in triplicate on a CFX Real Time system (Bio Rad, C1000 Touch Thermal Cycler). The comparative threshold method was used to determine relative mrna levels with cyclophilin as the internal control. Biochemical Measurements Plasma free fatty acid concentrations were determined using the HR Series NEFA kit, purchased from Wako Pure Chemical Industries, Ltd. Plasma and liver triglyceride concentrations were determined using Serum Triglyceride Determination kit from Sigma Aldrich. Triglyceride processing followed the method as described in the methods of Chapter 2. Plasma insulin was measured by a mouse insulin ELISA kit from Crystal Chem, Inc. Targeted Metabolomics Fasting plasma urea and ketones concentrations were analyzed by stable isotope dilution with GC-MS. To 10 µl plasma, a known concentration of their respective internal standards was added. Processing followed the method as described in the methods of Chapter 2. Statistics All continuous variables were represented as means ± SEM. A Student s t-test was used for comparison among two groups, with significance determined as p<

43 Results C57BL/6J Mice Develop NASH at 24 Weeks of High Fructose High trans-fat Feeding At 24 weeks of a high fructose high trans-fat diet, C57BL/6J mice develop nonalcoholic steatohepatitis. In a previous NASH study our lab conducted, liver histology with H&E staining showed large amounts of lipid droplets and fibrosis in mice fed a TFD diet versus a control diet (Figure 3-1A and 3-1B) [25]. Furthermore, fibrosis and inflammation was even more prevalent in mice on a TFD for 24 weeks than the controls (Figure 3-1C and 3-1D). Mitochondria are Dysfunctional in Mouse Model of NASH Mice with NASH at 24 weeks exhibited many metabolic alterations. Hepatic mitochondria were deemed dysfunctional from a high fructose high trans-fat diet based on measured metabolic parameters. This is further supported by an administered Intralipid challenge. Clinical and metabolic parameters of both control and TFD mice fed for 24 weeks are shown in Table 3-1. A high fructose high trans-fat diet generated weight gain compared to mice on a control diet (Figure 3-2A). An acute infusion of Intralipid gradually increased the overall weight of the mice. Liver weight was significantly different in TFD mice compared to their respective controls (Figure 3-2B). Liver triglyceride content also amounted to more in the presence of high nutrient supply, with an Intralipid challenge aiding in triglyceride storage (Figure 3-2C). An acute 5-hour infusion with Intralipid showed an increasing trend in raising plasma blood glucose levels (Figure A-3). A high fructose high trans-fat diet had no 43

44 significant effect on blood glucose. Insulin levels after a 1 hour fast were also raised in accordance to an Intralipid challenge and high nutrient supply (Figure 3-3). Triglycerides in the plasma were elevated when mice were given a 5-hour Intralipid infusion (Figure 3-4A). An acute Intralipid infusion for 5 hours elevated FFA levels two-fold (Figure A-1). Free fatty acids were elevated significantly when challenged with an acute Intralipid infusion in both control and TFD mice (Figure 3-4B). TFD mice initially had a higher level of FFAs compared to that of control. Ketogenesis was also elevated in TFD mice compared to the controls (Figure 3-4C). Ketone production in control mice increased significantly when supplemented with Intralipid, but this response was blunted in the TFD mice. There were no significant changes in urea production among all four groups (Figure 3-4D). NASH Mice Exhibit Severe Insulin Resistance Western blots conducted on liver homogenates show with Irs-2 severe insulin resistance in TFD mice at 24 weeks of feeding (Figure 3-5). Downstream signaling with Akt-P(Ser473) and Akt-P(T hr308) further demonstrate the inability of NASH mice to effectively respond to an influx of fat. Basal insulin signaling is upregulated in NASH mice infused with glycerol, and this response is blunted when challenged with Intralipid. Gene expression showed that oxidative metabolism, mitochondrial respiration, and lipogenesis in NASH mice were upregulated. Cytochrome C, CytC, which binds to cardiolipin and may result in ROS production remained unchanged [51]. Chrebp, a central regulator of de novo lipogenesis also remained unchanged in the TFD mice compared to the control-fed mice [52]. Inflammation and fibrosis were also higher in mice with steatohepatitis. Fgf21, involved in fatty acid oxidation and glucose uptake in fat was upregulated in control-fed mice from an acute Intralipid infusion [53]. Expression 44

45 of Fgf21 was slightly higher in TFD-fed mice versus the control, with no significant change in expression when challenged with Intralipid. All genes observed for NASH mice are displayed in Table 3-2. Hepatic mitochondrial signaling is upregulated in TFD mice compared to controls, but exhibit an inability to respond when given Intralipid. Fat oxidation was upregulated in control-fed mice with an Intralipid challenge, but TFD mice experienced a blunted response to increase fat oxidation when given Intralipid (Figure 3-6A). Mitochondrial respiration was significantly altered in TFD mice (Figure 3-6B). Srebp1c is a major regulator of fatty acid synthesis [54]. Lipogenesis, shown by Srebp1c, was also increased in TFD mice compared to the controls (Figure 3-6C). Fibrosis and inflammatory signaling, Mmp13, Tnfa, and Tlr4, were upregulated in TFD mice versus controls (Figure 3-7). Mmp13, a gene that encodes for collagenase 3 and is involved in fibrosis [47], was significantly high in TFD mice (Figure 3-7A). Involved in systemic inflammation and cell death, Tnfa, an inducer of cell death and systemic inflammation [55], was also higher due to TFD (Figure 3-7B). Tlr4, an activator of the innate immune system [56], was upregulated in TFD mice compared to respective controls (Figure 3-7C). 45

46 Control diet TFD diet Figure 3-1. Histology of C57BL/6J mice fed a control or TFD diet for 24 weeks. A) H&E staining for control mice showed no lipid droplets whereas B) TFD mice exhibited accumulation of lipids. C) Trichrome staining in control-fed mice showed no fibrosis. D) Trichrome staining showed severe fibrosis and hepatocyte cellular death in TFD-fed mice with NASH. 46

47 Table 3-1. Clinical and metabolic parameters from biological samples of C57BL/6J control and TFD fed mice when challenged with a five-hour glycerol or Intralipid infusion. NASH mice had higher body and liver weight than the controls. Intralipid further emphasized this effect. Ketogenesis and triglyceride storage mechanisms were higher in TFD mice compared to the controls. Control diet TFD diet Glycerol Intralipid Glycerol Intralipid Body Weight (g) ± ± ± 1.53 * ± 0.83 * Liver Weight (g) 1.21 ± ± ± 0.24 * 3.47 ± 0.23 * Plasma Glucose (mg/dl) ± ± ± ±12.28 Plasma Insulin (ng/ml) 0.43 ± ± ± ± 0.03 * Plasma Ketones (µmoles/l) Plasma Urea (µmoles/l) ± ± 95.1 # ±138.9 * ± ± ± ± ± 323 NEFA (mmoles/l) 0.24 ± ± 0.03 # 0.35 ± 0.04 * 0.62 ± 0.07 *# Plasma Triglycerides (mmoles/l) Liver Triglycerides (mg/g liver) 0.85 ± ± 0.05 # 0.83 ± ± 0.06 *# 9.76 ± ± ±10.94* ± 5.77* All data are represented as mean ± SEM; n=4-9. ( * p<0.05 versus respective control groups; # p<0.05 between glycerol and Intralipid infusion groups). 47

48 B o d y W e ig h t (g ) L iv e r W e ig h t (g ) L iv e r T rig ly c e rid e s (m g g liv e r -1 ) A ) B ) C ) * * 4 3 * * * * C o n tro l T F D 0 C o n tro l T F D 0 C o n tro l T F D All data are represented as mean ± SEM; n=5-9. ( * p<0.05 versus respective control groups; # p<0.05 bet ween glycerol and Intralipid infusion groups) Figure 3-2. Basal parameters of control and TFD fed mice. A) Mice weighed more when fed on a high trans-fat diet. B) Liver weight was significantly higher on a TFD diet, even more so in TFD mice challenged with Intralipid. C) Liver triglycerides were higher in TFD mice compared to their respective controls. All data are represented as mean ± SEM; n=5-9. ( * p<0.05 versus respective control groups; # p<0.05 between glycerol and Intralipid infusion groups) Figure 3-3. TFD raises fasting plasma insulin and Intralipid increases insulin and glucose levels. A) An acute infusion with Intralipid raised glucose levels in both control and TFD mice. B) Intralipid raised insulin levels in control and TFD mice. A high fructose high trans-fat diet also elevated insulin levels. 48

49 All data are represented as mean ± SEM; n=5-9. ( * p<0.05 versus respective control groups; # p<0.05 between glycerol and Intralipid infusion groups) Figure 3-4. C57BL/6J mice following a 5-hr Intralipid infusion exhibited mitochondrial dysfunction and inflexibility. A) High influx of FFA lead to elevated TGs in the plasma in TFD-fed mice infused with Intralipid. B) A 5-hr Intralipid infusion showed significant increase in FFA production in TFD-fed mice and a further elevated response when challenged with Intralipid. C) Ketone production was increased in TFD-fed mice at 24 weeks of feeding, and remained similar when challenged with Intralipid. Urea production is shown in Figure A-4. Figure 3-5. Basal insulin signaling is upregulated in insulin resistant C57BL/6J TFD mice. TFD mice had upregulated insulin signaling when infused with glycerol. Further challenge of Intralipid demonstrates the severe insulin resistance in mouse models of NASH. Quantification of the western blot is shown in Figure A-5. 49

50 Table 3-2. Expression of genes related to mitochondrial metabolism and inflammation markers in liver homogenates of C57BL/6J mice fed on a control diet or a high fructose, high trans-fat diet (TFD) for 24 weeks. Genes related to fat oxidation and ketogenic pathways were upregulated in TFD mice. Mitochondrial respiration was also increased due to diet. Fibrosis and inflammation was significantly increased in NASH mice. Fat oxidation and Ketogenesis Control diet TFD diet Glycerol Intralipid Glycerol Intralipid Pgc1a/Ppargc1a 1.00 ± ± ± ± 0.06 Mitochondrial Respiration Lipogenesis Fibrosis and Inflammation Ppara 1.00 ± ± 0.21 # 2.21 ± 0.25 * 1.98 ± 0.57 Cpt1a 1.00 ± ± ± ± 0.14 Lcad/Acadl 1.00 ± ± ± 0.09 * 1.43 ± 0.04 Hmgcs ± ± 0.04 # 1.36 ± ± 0.13 Ucp ± ± ± 0.15 * 2.09 ± 0.53 Cytc 1.00 ± ± ± ± 0.05 Acc ± ± ± ± 0.14 Fas 1.00 ± ± ± ± 0.19 Srebp1c 1.00 ± ± ± 0.24 * 1.74 ± 0.22 * Chrebp 1.00 ± ± ± ± 0.09 Pc ± ± ± ±12.17 Fgf ± ± 0.52 # 1.51 ± ± 0.15 Tnfa 1.00 ± ± ± 0.60 * 2.71 ± 0.22 Mmp ± ± ± 2.02 * ± 5.55 Il ± ± ± ± 0.26 Tlr ± ± ± 0.30 * 2.71 ± 0.45 * Values are mean ± SEM; n=3-4 per group. (*p 0.05 versus respective control groups; # p 0.05 between glycerol and Intralipid infusion groups). 50

51 All data are represented as mean ± SEM; n=5-9. (*p<0.05 versus respective control groups; #p<0.05 between glycerol and Intralipid infusion groups) Figure 3-6. Gene expression of C57BL/6J mice at 24 weeks of feeding. NASH mice exhibited elevated A) fat oxidation, B) mitochondrial respiration, and C) lipogenic signaling pathways. The gene involved in mitochondrial fat oxidation, Ppara, was upregulated in TFD mice versus control. Intralipid increased oxidation in control mice, but this response was blunted in TFD mice. Mitochondrial respiration, observed with Ucp2, was increased due to high nutrient supply. Lipogenesis (Srebp1c) was increased in TFD mice compared to their respective controls. 51

52 Relative mrna expression Relative mrna expression Relative mrna expression A) B) C) Mmp13 * 4 3 Tnfa * 4 3 Tlr4 * * * * * 0 CG CI TG TI 0 CI CG TG TI 0 CG CI TG TI All data are represented as mean ± SEM; n=5-9. ( * p<0.05 versus respective control groups; # p<0.05 between glycerol and Intralipid infusion groups) Mmp13 Tnfa Tlr4 Figure 3-7. Inflammation and fibrosis is present in NASH mouse models. Gene expression at 24 weeks of high trans-fat feeding showed elevated inflammatory signaling. A) Mmp13, a gene involved in fibrosis, was upregulated due to TFD. B) Proinflammatory genes, Tnfa and Tlr4, were upregulated in mice on a TFD versus control. C) TFD mice infused with Intralipid had a significantly higher expression than their respective controls. 52

53 CHAPTER 4 DISCUSSION It is well established that NAFLD is a chronic metabolic disorder [1]. Our study explored mitochondrial oxidative metabolism within the liver in insulin resistant mice. Mitochondrial metabolism was altered due to high nutrient supply with a TFD, as well with a further insult of FFA (0.8 mm FFA or Intralipid). We showed mitochondrial dysfunction despite insulin resistance, in both an in vitro cell model of NAFLD and an in vivo mouse model of NASH. Developing an in vitro model system to study NAFLD was a necessary innovation. The cell system model was validated through a variety of assays, allowing us to conduct experiments studying the mechanisms and progression of the disease. Histology further validate the cell system model, showing high accumulation of lipid droplets without fibrosis in TFD mice at 4 weeks of feeding. The accumulation of triglycerides from the influx of fat caused a switching of storage mechanisms to oxidation of fat. An overnight incubation with excess FFA (0.8 mm) demonstrated the ability of the mitochondria to adapt to external stimuli in the hepatocytes of control-fed mice. The ability for the mitochondria to compensate for a high supply of FFA was blunted in mice fed a TFD diet. Ketogenesis was elevated in TFD mice at each time interval, validating the in vitro model system. Isolated hepatocytes were shown to have upregulated basal insulin signaling, but displayed insulin resistance when TFD hepatocytes were challenged with a bolus of insulin. Isolated hepatocytes were showing elevated fat oxidation and ketogenesis in early stages of NAFLD. A promoter of fat oxidation, Pgc1a, was elevated in diet-induced mice. The gene involved in bringing fat into the mitochondria for oxidation, Cpt1a, also showed an increased trend with a high 53

54 FFA challenge as well as high nutrient supply from the diet. This is further supported with the first step in fatty acid oxidation, Lcad, which was upregulated in TFD mice. Ketogenesis was also upregulated in mice on a 4-week TFD, which supports previous data (Figure 2-4). Furthermore, fibrotic (Pc1 and Mmp13) and inflammatory (Il6) genes were upregulated in the isolated hepatocytes of TFD mice. Interleukin 6 has been associated with pro-inflammatory cytokines, which acts to increase fat metabolism to improve insulin resistance [48]. The 4-week in vitro study also showed elevated mitochondrial respiration and ROS production in the TFD mice. Together, this model system demonstrated the beginning stages of NAFLD with insulin resistance and mitochondrial dysfunction fueling inflammatory pathways. Our secondary aim probed the effect of a further insult to an already insulin resistant mouse model of NASH. A previous study by our lab showed mice fed on a TFD for 24 weeks develop steatohepatitis [25]. Body weight and liver weight increased as expected given a high nutrient supply. Weight of the liver as well as triglyceride content within the liver were affected only by diet and not by an acute infusion of Intralipid. Glucose levels were elevated by a high lipid load. After a one hour fast, plasma insulin levels showed an increasing trend in raised insulin due to Intralipid and TFD. Elevated insulin levels were not significant enough to suppress and oxidative metabolism within the liver. Hyperinsulinemia in NASH mice lowered glucose to the same levels as seen in the control-fed mice. An acute Intralipid challenge caused higher hepatocyte triglyceride secretion. The basal concentration of free fatty acids available for energy consumption was higher in TFD versus controls. This trend was even more apparent when the mice were given an insult of Intralipid. As the hepatocyte s storage 54

55 mechanisms in the form of esterified triglycerides meet a threshold, metabolism turns to fat oxidation and secretion of triglycerides from the liver in the form of very low-density lipoproteins. Ketogenesis was elevated in the control-fed mice due to Intralipid. At baseline, basal ketone production is raised in TFD mice due to the high fructose high trans-fat diet. The mitochondria were unable to adapt to a further influx of fat when challenged with Intralipid. The inability to respond to a high FFA stimuli demonstrates the severe insulin resistance and mitochondrial inflexibility in these NASH mice. Urea production was not altered from diet nor lipid load. Protein expression further supported mitochondrial dysfunction in NASH mice. Probing downstream pathways involved in insulin signaling showed the mitochondria s inability to upregulate insulin signaling when challenged with an insult such as Intralipid. Gene analysis supported a new steady state by showing upregulated genes involved in fatty acid oxidation, mitochondrial respiration, and lipogenesis. Fat oxidation was higher in control mice when infused with Intralipid, showing the hepatic mitochondria s ability to adapt to a high influx of fat. NASH mice displayed upregulated fat oxidation, but this response was blunted when challenged with Intralipid. This is explained by the elevated increase in plasma triglycerides, as both storage and oxidative machinery thresholds were met in these severely insulin resistant mice. Impaired mitochondrial respiration was shown with the uncoupling protein gene (Ucp2), where the NASH mice are unable to efficiently oxidize the high supply of FFA from the diet. Mitochondrial stress leads to the uncoupling of oxidative phosphorylation from energy synthesis to control ROS production [43, 57], a main contributor to the progression of NAFLD to steatohepatitis. Lipogenesis correlation was also increased in NASH mice, as shown by Srebp1c. In conjunction with upregulated and dysfunctional 55

56 mitochondrial machinery, hepatocellular injury occurred in NASH mice likely from lipotoxicity. Gene promoters of fibrosis, such as Mmp13, were upregulated from a 24- week high fructose high trans-fat diet. Pro-inflammatory cytokines, like Tnfa and Tlr4, were also upregulated in NASH mice. It is important to note Intralipid had an effect only on fat oxidation (Ppara) compared to its respective control. These metabolic infusion studies showed NASH mice had blunted compensatory mechanisms to FFA overload and this lead to elevated inflammatory signaling. An in vitro model system of NAFLD displayed early onset of insulin resistance and inflammation. The design of a cellular system to study the disease will allow our lab to tease out metabolic alterations that occur early-on in fatty liver disease. From our first aim, we were able to show how mice on a high fructose high trans-fat diet already showed signs of mitochondrial inflexibility. An acute 5-hour Intralipid infusion demonstrated severe insulin resistance and mitochondrial dysfunction in a mouse model of NASH. In spite of insulin resistance, ketogenesis managed to be upregulated in response to greater nutrient supply, but mice with NASH had an inability to further increase ketogenesis when challenged by an Intralipid infusion, clearly indicating a blunted and maladaptive compensatory response to lipid overload. Early induction of ketogenesis, despite hepatic insulin resistance in primary hepatocytes and the blunted response of ketogenesis to Intralipid challenge in mice with NASH, demonstrates mitochondrial inflexibility. Future studies will include measuring flux through the TCA cycle in mice with fatty liver as well as steatohepatitis. We aim to show an increase in TCA flux in NASH mice, contrary to Shulman s hypothesis, along with lipotoxic byproducts. Based on the in vitro data focusing on the electron transport 56

57 chain, we aim to take a closer look at respiration and ROS production in mice with endstage liver disease. We speculate that this mitochondrial inflexibility may be an early key defect that fosters oxidative stress, chronic inflammation, and hepatocyte injury in NASH. 57

58 APPENDIX SUPPLEMENTARY FIGURES Figure A-1. Concentration of FFAs (mmol/l) over a period of 5 hours, including baseline (0 hours). Free fatty acid levels increased by two-fold by end of infusion experiment, or to a normal physiological response to Intralipid. 58

59 Table A-1. Primer sequences for genes analyzed with qpcr for isolated hepatocytes and liver homogenates. Gene Name Primer Sequence (forward) Primer Sequence (reverse) Ppib/Cyclophilin b GGAGATGGCACAGGAGGAA GCCCGTAGTGCTTCAGCTT Pgc1a AGACAAATGTGCTTCCAAAAAGAA GAAGAGATAAAGTTGTTGGTTTGGC Ppara ACAAGGCCTCAGGGTACCA GCCGAAAGAAGCCCTTACAG Cpt1a CAAAGATCAATCGGACCCTAGAC CGCCACTCACGATGTTCTTC Lcad TCAATGGAAGCAAGGTGTTCA GCCACGACGATCACGAGAT Hmgcs2 GACTTCCTGTCATCCAGC GGTGTAGGTTTCTTCCAGC Ucp2 GCTTCTGCACCACCGTCAT GCCCAAGGCAGAGTTCATGT Cytc GAAAAGGGAGGCAAGCATAAG TGTCTTCCGCCCGAACA Acc1 GGACAGACTGATCGCAGAGAAAG TGGAGAGCCCCACACACA Fas GCTGCGGAAACTTCAGGAAAT AGAGACGTGTCACTCCTGGACTT Srebp1c GGAGCCATGGATTGCACATT GGCCCGGGAAGTCACTGT Chrebp GAAACCTGAGGCTGTCATCCT CGTGGTATTCGCGCATCA Pc1 ACCTGTGTGTTCCCTACTCA GACTGTTGCCTTCGCCTCTG Fgf21 CCTCTAGGTTTCTTTGCCAACAG AAGCTGCAGGCCTCAGGAT Tnfa CTGAGGTCAATCTGCCCAAGTAC CTTCACAGAGCAATGACTCCAAAG Mmp13 CCTTCTGGTCTTCTGGCACAC GGCTGGGTCACACTTCTCTGG Il6 TCGTGGAAATGAGAAAAGAGTTG AGTGCATCATCGTTGTTCATACA Tlr4 CACTGTTCTTCTCCTGCCTGAC CCTGGGGAAAAACTCTGGATAG 59

60 Figure A-2. Quantification of western blot from hepatocytes on 4-week diet. Isolated hepatocytes (N=1) were incubated overnight with low (0.2 mm) or high (0.8 mm) FFA in media. A 50 nm insulin bolus was given for 15 minutes. Insulin sensitivity was measured (p-akt) and showed insulin resistance in mice on a TFD diet. 60

61 Figure A-3. Plasma blood glucose levels in 24-week fed mice. Mice maintained same glucose levels regardless of increased nutrients. An Intralipid challenge slightly raised glucose levels in the the plasma in both control and NASH mice. 61

62 Figure A-4. Plasma urea concentrations in mice on 24-weeks of control or TFD diet. Urea production was not changed by diet nor Intralipid challenge. 62

63 Figure A-5. Quantification of western blot from liver homogenates on 24-week diet. Insulin sensitivity was measured by probing Irs-2 and p-akt in NASH mice when challenged with Intralipid. Mice with NASH showed severe insulin resistance when given an acute lipid load. 63