Scopoletin stimulates melanogenesis via camp/pka pathway and partially p38 activation
|
|
- Austen Gardner
- 5 years ago
- Views:
Transcription
1 by J-STAGE DOI: /bpb.b Advance Publication September 22, 2017 Biol. Pharm. Bull. Regular Articles Scopoletin stimulates melanogenesis via camp/pka pathway and partially p38 activation Dae-Sung Kim, a Su-Bin Cha, a Min-Cheol Park, b Seol-A Park, c Hye-Soo Kim, d Won-Hong Woo, e and Yeun-Ja Mun,a a Department of Herbal Resources, Professional Graduate School of Oriental Medicine, Wonkwang University; Iksan, 54538, Korea: b Department of Oriental Medical Ophthalmology & Otolaryngology & Dermatology, College of Oriental Medicine, Wonkwang University; Iksan, 54538, Korea: c Department of Beauty Design Graduate School, Wonkwang University; Iksan, 54538, Korea: d Hanpoong Pharm & Foods Co., LTD.; Wanju-Gun, 55316, Korea: e Department of Anatomy, College of Oriental Medicine, Wonkwang University, Iksan, 54538, Korea. Corresponding Author Yeun-Ja Mun Department of Herbal Resources, Professional Graduate School of Oriental Medicine, Wonkwang University 460, Iksan-daero, Iksan, 54538, Republic of Korea yjmun@wku.ac.kr C 2017 The Pharmaceutical Society of Japan
2 Summary Scopoletin was recently shown to stimulate melanogenesis through camp-response elementbinding protein (CREB) phosphorylation. In this study, we investigated the molecular events of melanogenesis-induced by scopoletin. After exposure to scopoletin, the protein levels of tyrosinase and tyrosianse related protein-1 (TRP-1) were significantly increased in B16F10 cells. The mrna levels of tyrosinase and microphthalmia-associated transcription factor (MITF) were also enhanced by scopoletin. camp production and phosphorylation of p38 mitogen-activated protein kinase (MAPK) were increased by scopoletin treatment. Scopoletin-mediated increase of intracellular melanin and tyrosinase expression were significantly attenuated by PKA inhibitors (H-89 and KT5720), while a PKC inhibitor (Ro ) had no effect and a p38 MAPK inhibitor (SB203580) partially blocked the scopoletin-induced intracellular melanin and tyrosinase expression. Moreover, scopoletin synergistically with cell-permeable camp analog (dibutyryl camp) significantly induced tyrosinase activity and melanin content in B16F10 cells. The silencing of p38 MAPK by sirna decreased the scopoletin-induced tyrosinase expression in B16F10 cells. These results suggest that scopoletin could induce melanin synthesis through the camp/pka pathway and partially p38 MAPK activation in B16F10 cells. Key words Scopoletin; tyrosinase; microphthalmia-associated transcription factor (MITF); camp; p38 MAPK; p38 MAPK sirna
3 INTRODUCTION Melanin is synthesized in organelles called melanosome and melanosomes are transferred to adjacent keratinocytes. In human, skin hyper-pigmentation is physiologically stimulated by UV radiation. 1) Melanin has a photo-protective effect against harmful UV injury in human skin. Melanin synthesis is mainly regulated by melanogenic enzymes such as tyrosinase, tyrosinase-related protein 1 (TRP-1), and TRP-2. At transcription level, the expression of melanogenic enzymes is up-regulated by a binding of microphthalmia-associated transcription factor (MITF) and tyrosinase promoter. 2 4) camp-responsive element binding protein (CREB) regulates in turn the expression of MITF. Phosphorylation of CREB is regulated by activation of camp and PKA. 5 7) Abnormal pigmentation conditions can be divided into two types, that is hypermelanosis or hypomelanosis, which involve excessive or insufficient melanin in skin. Many exogenous and endogenous factors are involved in melanin synthesis through intracellular signaling pathways. Especially, camp and PKC are important factors for melanogenesis pathways. 7) Downstream signaling of the camp pathway during melanogenesis is well-documented. The activation of p38 mitogen-activated protein kinase (MAPK) pathway has been recently shown to induce MITF and tyrosinase expression. 8) In order to control the abnormal pigmentation conditions, the molecular mechanisms for melanogenesis should be clearly identified. Scopoletin, 6-methoxy-7-hydroxycoumarin (C 10 H 8 O 4, Fig. 1), is a derivative of coumarin. Some studies have reported that scopoletin has various biological activity including antiallergy, anti-inflammatory, and antioxidant activity. 9 11) Recently, scopoletin has been demonstrated to activate CREB phosphorylation and tyrosinase expression, which lead to the stimulation of melanin synthesis. 12) However, the signaling pathway underlying scopoletin-
4 induced melanogenesis are not yet well defined. In this study, we investigated the molecular mechanism of scopoletin-mediated melanogenesis including camp, PKC, and p38 MAPK. MATERIALS AND METHODS Cell cultures and Cell viability assay B16 melanoma (B16F10) cells and human dermal fibroblast neonatal (HDFn) cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% (v/v) fetal bovine serum at 37, 5% CO 2. The viability of cells was determined using 3-(4,5- dimethylthiazol-2yl)-2,5- diphenyltetrazolium bromide (MTT). The cells ( cells/well) were seeded in 24-well plates and treated with scopoletin (S2500, Sigma, USA) at various concentrations (0-40 μg/ml) for 24 h. After the exposure period, the medium was changed and incubated with MTT (0.1 mg/ml) for 3 h. The number of viable cells per dish is directly proportional to the production of formazan, which was dissolved in DMSO, and measured spectrophotometrically at 570 nm. Measurement of intracellular melanin and tyrosinase activity Intracellular melanin content of B16F10 cells were measured according to the slightly modified method. 13) The colors of cell pellets were visually observed, and pellets were solubilized in 1 M NaOH containing 10% DMSO at 90 for 1 h. Spectrophotometric analysis of melanin content was performed at 405 nm absorbance. Tyrosinase activity was determined using a modification of the method described. 14) Cells ( cells/well) were cultured at 6-well plates and treated with scopoletin (0-40 μg/ml). After washing,
5 cells were lysed in 200 μl of 0.1 M sodium phosphate buffer (ph 6.8) containing 1% Triton X-100 and 1 M phenylmethylsulfonyl fluoride (PMSF). The supernatant (50 μl), 100 μl of 0.1 M sodium phosphate buffer (ph 6.8) and 50 μl of 0.1% L-DOPA were placed into a 96-well plate. Absorbance at 405 nm was read every 30 min for 1 h at 37 using an ELISA plate reader. L-DOPA staining To evaluate L-DOPA reactivity of B16F10 cells, cells were fixed in 4% paraformaldehyde in PBS for 10 min, after treatment with 100% methanol for 10 min. Cells were incubated in L- DOPA (1 mg/ml) for 4 h at 37 prior to observation using a microscope (Leica, Germany). Analyses using western blot and RT-PCR After treatment with scopoletin for 72 h, cells were lysed with RIPA buffer (1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 0.15 NaCl, 0.01 M sodium phosphate (ph 7.2), 2 mm EDTA, 50 mm sodium fluoride, 0.2 mm sodium orthovanadate, 1 mm phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, and 1 μg/ml leupeptin) for 30 min on ice. Protein concentrations of the supernatants were estimated by Bradford assay. Equal amounts of protein from samples were separated by 10% SDS-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes. Proteins were probed with tyrosinase, TRP-1, TRP-2, MITF, and phosphor-p38 antibodies (Santa Cruz Biotechnology, USA). The membranes were probed with a specific HRP-conjugated secondary antibody and detected using the enhanced chemiluminescent substrate from West zol-plus. The membrane was probed with β-actin primary antibody as a protein loading control. Total RNA was isolated from B16F10 cells using a Fast Pure RNA kit (Takara Bio,
6 Japan). The first-strand cdna was synthesized from 1 μg of total RNA with Maxime RT PreMix Oligo dt primer (intron Biotechnology, Korea). The following primers were used for amplification: Tyrosinase, forward 5 -ATT GAT TTT GCC CAT GAA GC-3 and reverse 5 -GGC AAA TCC TTC CAG TGT GT-3, TRP-1, forward 5 -GTC ATT GCC ACA AGG AGG TT-3 and reverse 5 -CCC AGT TGC AAA ATT CCA GT-3, TRP-2 (Dct), forward 5 -TGT GCA AGA TTG CCT GTC TC-3 and reverse 5 -GTT GCT CTG CGG TTA GGA AG-3, MITF, forward 5 -AGC GTG TAT TTT CCC CAC AG-3 and reverse 5 -CCT TAG CTC GTT GCT GTT CC-3, B-actin, foward; 5 -TCA GAA GGA CTC CTA TGT GG-3 and reverse 5 -TCT CTT TGA TGT CAG CAC G- 3. PCR products were electrophoresed on 2 % agarose gels containing ethidium bromide (EtBr). Radioimmunoassay of cyclic AMP Intracellular camp level was assayed in B16F10 cells with scopoletin or α-msh (10 nm). In order to inhibit phosphodiesterase activity, cells were lysed in 0.1 M of HCl. The supernatants were extracted with two volumes of water-saturated diethylether and concentrated with Speed-vac concentrator (Savant Instrument, USA). camp content was measured by an equilibrated radioimmunoassay as described previously. 15) Standards or samples were introduced in a final volume of 100 μl of 50 mm sodium acetate buffer (ph 4.8), added 100 μl of diluted camp antiserum (1:1000, Calbiochem-Novabiochem Co., USA) and iodinated camp (10,000 cpm/ 100 μl), and incubated overnight at 4. The bound form was separated from the free form by charcoal suspension. Results were discribed as femtomoles of camp generated per microgram of protein (fmol/μg of protein).
7 Gene silencing by sirna transfection The sirna of p38 MAPK (Ambion, USA) was transfected into B16F10 cells with Lipofectamine (Invitrogen, CA, USA) according to the manufactuer s protocol. Briefly, the cells were grown to 50% confluence in antibiotic-free medium, then the medium was replaced with Opti-MEMTM followed by the transfection with p38 MAPK sirna or control sirna using Lipofectamine. The cells were replaced with growth medium after transfection for 24 h. After scopoletin treatment, the cells were then subjected to Western blot assay. Statistical analysis Means ± S.D. of the means were calculated; statistical analysis of results was performed using Student's t-test for independent samples. Values of *p < 0.05, and **p < 0.01 were considered significant. RESULTS Scopoletin induced melanin synthesis via up-regulation of tyrosinase activity and MITF We first confirmed the effects of scopoletin on intracellular melanin content and tyrosinase activity. When B16F10 cells were treated with 20 or 40 μg/ml of scopoletin for 72 h, tyrosinase activity was significantly increased in a dose-dependent manner (Fig. 2A). The color of cell pellets was darker after being treated with scopoletin. Accordingly, intracellular melanin was enhanced by scopoletin when examined by microscopy after DOPA staining (Fig. 2B). α-melanocyte-stimulating hormone (α-msh) was used as a positive control. The effect of scopoletin on the expression of melanogenic enzymes was determined by
8 western blot analysis. Scopoletin significantly induced tyrosinase and TRP-1 protein levels in a dose-dependent manner (Fig. 2C). mrna level of tyrosinase was increased after scopoletin treatment, indicating that the induction of this gene expression was occurred at transcription level. As a key transcription factor for melanogenic proteins is MITF, we examined whether MITF is also involved in the scopoletin-induced tyrosinase protein expression. As expected, the mrna level of MITF was increased by scopoletin (Fig. 2D). Scopoletin induced camp production and p38 MAPK activation Previous studies have demonstrated that α-msh activates the camp/pka pathway, which in turn up-regulates MITF transcript to enhance melanin synthesis. 16) To examine the molecular mechanisms involved in the melanogenic effect of scopoletin, we first compared scopoletinmediated camp production with α-msh-mediated response. After treatment with 40 μg/ml of scopoletin, camp production was increased in B16F10 cells (Fig. 3A). Induction of camp was observed as early as 15 min after scopoletin treatment and it was reached a peak at 30 min. A similar effect on camp production was observed in α-msh treated cells (Fig. 3B). This result suggests that scopoletin induces melanin synthesis through an elevation of camp levels. Next, we examined whether scopoletin could induce the phosphorylation of p38 MAPK. Scopoletin significantly elevated the phosphorylation of p38 MAPK in B16F10 cells (Fig. 4). This result indicates that p38 MAPK activation contributes to the melanogenic effect of scopoletin. Scopoletin stimulated melanin synthesis through camp/pka pathway and partially activation of p38 MAPK Using selective inhibitors, including H-89 and KT5720 (PKA inhibitors), Ro (PKC
9 inhibitor), and SB (p38 MAPK inhibitor), we further investigated the molecular mechanism by which scopoletin enhances melanogenesis. Melanin content increased by scopoletin was completely decreased by H-89 and KT5720, while Ro had no effect and SB partially blocked the scopoletin-induced melanin synthesis (Fig. 5A & B). Also, the level of tyrosinase protein was completely suppressed by H-89 and KT5720, but its expression level was not altered by Ro and partially blocked by SB (Fig. 6A & B). Furthermore, we investigated whether cell-permeable camp analog, dibutyryl camp (dbcamp), could mimic the effect of scopoletin on melanogenesis. dbcamp increased tyrosinase activity and melanin content in B16F10 cells. Scopoletin synergistically with dbcamp significantly induced tyrosinase activity and melanin content (Fig. 7). The contribution of p38 MAPK to melanogenic effect of scopoletin was tested by introducing p38 MAPK targeting sirna into B16F10 cells. The silencing of p38 MAPK by sirna decreased the scopoletin-induced tyrosinase expression in B16F10 cells (Fig. 8). These results suggest that scopoletin stimulated melanin synthesis through camp/pka pathway and partially p38 MAPK activation in B16F10 cells. DISCUSSION We investigated the molecular events of scopoletin on melanogenesis pathway including camp, PKC, and p38 MAPK. First, we confirmed that scopoletin induced melanin biosynthesis and tyrosinase activity in B16F10 cells. Here, we found that scopoletin-induced melanogenesis occurs via the camp/pka signaling pathway and partially p38 MAPK activation.
10 Since melanin is synthesized by an enzymatic cascade of melanogenic enzymes, we ascetained the effect of scopoletin on the expression of these enzymes. Scopoletin augmented the protein levels of tyrosinase and TRP-1. Especially the mrna level of tyrosinase was increased after scopoletin treatment, indicating that the induction of this gene expression was occurred at transcription level. MITF is a key transcription factor of melanogenic proteins, 2 4) scopoletin significantly increased the expression of MITF mrna. These data suggest that scopoletin up-regulated tyrosinase and MITF at the transcription level. camp is a key factor in the sequential processes required for melanin synthesis, the activations of PKA and CREB, followed by the expression of MITF. 4,17) However, it has been recently reported that transforming growth factor β (TGF-β) activates PKA via a campindependent pathway, which is mediated by the smad3/4 complex. 18,19) Thus, we investigated whether scopoletin-induced melanin synthesis is regulated by camp-dependent pathway. In our study, the camp levels increased when cells were treated with 40 μg/ml of scopoletin. dbcamp increased tyrosinase activity and melanin content, and scopoletin synergistically with dbcamp significantly induced melanin synthesis. This result shows that scopoletin stimulate melanin synthesis through an increase in camp levels. Moreover, scopoletininduced intracellular melanin and tyrosinase expression were significantly reduced by specific inhibitors of PKA treatment, suggesting that the induction of melanin synthesis by scopoletin was markedly inhibited when camp/pka pathway was blocked by inhibition of PKA. Although the biological effects of camp inducing agents are mostly regulated by campdependent PKA activation, some studies have reported that there are cross-talk between the PKA and PKC signaling pathway. 20,21) For example, bee venom has augmented melanin biosynthesis via phospholipase A 2 (spla 2 ) activation and camp production, suggesting that the effect of bee venom is mediated by PKC as well as PKA. 22,23) In our study, the inhibition
11 of PKC by Ro had no effect on melanin synthesis and tyrosinase protein expression. This result suggests that the induction of melanin synthesis by scopoletin is not mediated to the activation of PKC. The MAPK family proteins, including p38 MAPK, ERK, and JNK, are known to play important roles in melanin synthesis. The ERK and/or JNK/SAPK pathways cause downregulation of melanin synthesis. 24) On the other hand, the phosphorylation of p38 MAPK activates MITF and eventually stimulates melannogenesis. 25) In our experiment, the p38 MAPK phosphorylation was elevated by scopoletin. Treatment of cells with SB203580, a p38 MAPK inhibitor, partially blocked the scopoletin-stimulated melanin content and tyrosinase protein expression. Although SB is widely used as a specific inhibitor of p38 MAPK, there are many reports that SB activates other signaling molecules including JNK/SAPK and Raf-1. In this study, we showed that sirna-mediated knockdown of p38 MAPK significantly eliminated the scopoletin-induced tyrosinase expression in B16F10 cells. These results mean that the induction of melanin synthesis by scopoletin is partially mediated to the p38 MAPK activation. In conclusion, we confirmed that the melanogenic activity of scopoletin was mediated by the camp production and p38 MAPK activation. PKA inhibitors completely blocked scopoletin-mediated increase of melanin synthesis and tyrosinase expression, while partially blocked by SB and p38 MAPK sirna. Collectively, these results suggest that scopoletin can stimulate melanogenesis by the camp/pka pathway and partially p38 MAPK activation in B16F10 cells.
12 Acknowledgements This work was supported by the National Research Foundation of Korea [NRF] grant funded by the Korea government [MSIP] [No ] and the NRF grant funded by the MSIP [No. 2015M3A9E ]. Conflict of Interest The authors declare no conflict of interest.
13 REFERENCES 1) Busca R, Ballotti R. Cyclic AMP a key messenger in the regulation of skin pigmentation. Pigment Cell Res., 13, (2000). 2) Bentley NJ, Eisen T, Goding CR. Melanocyte-specific expression of the humantyrosinase promoter: activation by the microphthalmia gene product and role of the initiator. Mol. Cell Biol., 14, (1994). 3) Saito H, Yasumoto KI, Takeda K, Takahashi K, Yamamoto H, Shibahara S. Microphthalmia-associated transcription factor in the Wnt signaling pathway. Pigment Cell Res., 16, (2003). 4) Windlund HR, Fisher DE. Microphthalmia-associated transcription factor: a critical regulator of pigment cell development and survival. Oncogene 22, (2003). 5) Fuller BB, Lunsford JB, Iman DS. Alpha-melanocyte-stimulating hormone regulation of tyrosinase in Cloudman S-91 mouse melanoma cell cultures. J. Biol. Chem., 262, (1987). 6) Hearing VJ, Tsukamoto K. Enzymatic control of pigmentation in mammals. FASEB J. 5, (1991). 7) Park HY, Gilchrest BA. Signaling pathways mediating melanogenesis. Cell Mol. Biol., 45, (1999). 8) Hirata N, Naruto S, Ohguchi K, Akao Y, Nozawa Y, Iinuma M, Matsuda H. Mechanism of the melanogenesis stimulation activity of (-)-cubebin in murine B16 melanoma cells. Bioorg. Med. Chem., 15, (2007). 9) Shaw CY, Chen CH, Hsu CC, Chen CC, Tsai YC. Antioxidant properties of scopoletin isolated from Sinomonium acutum. Phytother. Res., 17, (2003). 10) Moon PD, Lee BH, Jeong HJ, An HJ, Park SJ, Kim HR, Ko SG, Um JY, Hong SH, Kim
14 HM. Use of scopoletin to inhibit the production of inflammatory cytokines through inhibition of the IkappaB/NF-kappaB signal cascade in the human mast cell line HMC-1. Eur. J. Pharmacol., 555, (2007). 11) Cheng AS, Cheng YH, Chang TL. Scopoletin attenuates allergy by inhibiting Th2 cytokines production in EL-4 T cells. Food Funct., 3, (2012). 12) Ahn MJ, Hur SJ, Kim EH, Lee SH, Shin JS, Kim MK, Uchizono JA, Whang WK, Kim DS. Scopoletin from Cirsium setidens increases melanin synthesis via CREB phosphorylation in B16F10 cells. Korean J. Physiol. Pharmacol., 18, (2014). 13) Hosoi J, Abe E, Suda T, Kuroki T. Regulation of melanin synthesis of B16 mouse melanoma cells by 1 alpha, 25-dihydroxyvitamin D3 and retinoic acid. Cancer Res., 45, (1985). 14) Martineze-Esparza M, Jimenez-Cervantes C, Solano F, Lozano JA, Garcia-Borron JC. Mechanisms of melanogenesis inhibition by tumor necrosis factor-alpha in B16/F10 mouse melanoma cells. Eur. J. Biochem., 255, (1998). 15) Kim DH, Lerner A. Type 4 cyclic adenosine monophosphate phosphodiesterase as a therapeutic target in chronic lymphocytic leukemia. Blood, 92, (1998). 16) Bentley NJ, Eisen T, Goding CR. Melanocyte-specific expression of the humantyrosinase promoter: activation by the microphthalmia gene product and role of the initiator. Mol. Cell Biol., 14, (1994). 17) Ding Z, Dai Y, Wang Z. Hypouricemic action of scopoletin arising from xanthine oxidase inhibiton and uricosuric activity. Planta Med., 71, (2005). 18) Dulin NO, Niu J, Browning DD, Ye RD, Voyno-Yasenetskaya T. Cyclic AMPindependent activation of protein kinase A by vasoactive peptides. J. Biol. Chem., 276, (2001). 19) Bertolotto C, Abbe P, Hemesath TJ, Bille K, Fisher DE, Ortonne TP, Ballotti R.
15 Microphthalmia gene product as a signal transducer in camp-induced differentiation of melanocytes. J. Cell Biol., 42, (1998). 20) Park HY, Wu C, Yonomoto L, Murphy-Smith M, Wu H, Stachur CM, Gilchrest BA. MITF mediates camp-induced protein kinase C-beta expression in human melanocytes. Biochem. J., 395, (2006). 21) Lee AY, Noh M. The regulation of epidermal melanogenesis via camp and/or PKC signaling pathways: insights for the development of hypopigmenting agents. Arch. Pharm. Res., 36, (2013). 22) Jeon S, Kim NH, Koo BS, Lee HJ, Lee AY. Bee venom stimulates human melanocyte proliferation, melanogenesis, dendricity and migration. Exp. Mol. Med., 39, (2007). 23) Lee AY, Noh M. The regulation of epidermal melanogenesis via camp and/or PKC signaling pathways: insights for the development of hypopigmenting agents. Arch. Pharm. Res., 36, (2013). 24) Kono M, Dunn IS, Durda PJ, Butera D, Rose LB, Haggerty TJ, Benson EM, Kurnick JT. Role of the mitogen activated protein kinase signaling pathway in the regulation of human melanocytic antigen expression. Mol. Cancer Res., 4, (2006). 25) Kim DS, Jeong YM, Park IK, Hahn HG, Lee HK, Kwon SB, Jeong JH, Yang SJ, Sohn UD, Park KC. A new 2-imino-1,3-thiazoline derivative, KHG22394, inhibits melanin synthesis in mouse B16bmelanoma cells. Biol. Pharm. Bull., 30, (2007).
16 Figure Legends Fig. 1. Chemical structure of scopoletin (6-methoxy-7-hydroxycoumarin, C 10 H 8 O 4 ) Fig. 2. Effects of scopoletin on tyrosinase, melanin content and MITF Cells were treated with scopoletin at 20 and 40 μg/ml, or 10 nm α-msh for 72 h. At the end of treatment, tyrosinase activity (A) was measured as Materials and Methods. (B) Intracellular melanin was observed by color of cell pellets and examined by a light microscope after DOPA staining. (C) The expression of tyrosinase, TRP-1, and TRP-2 protein were detected by western blotting using specific antibodies. (D) The transcript of tyrosinase and MITF were detected by RT-PCR. Results are the mean ± SD from three independent experiments. p<0.01 versus untreated cells. Fig. 3. Effect of scopoletin on intracellular camp level Intracellular camp levels were determined using a radioimmunoassay. B16F10 cells were treated with scopoletin 40 μg/ml (A) and α-msh 1 nm (B). Results are the mean ± SD from triplicate determination. p<0.01 versus untreated cells. I.T.: Incubation time. Fig. 4. Effect of scopoletin on p38 phosphorylation After incubation of B16F10 cells with 40 μg/ml scopoletin for the indicated time periods, whole-cell lysates were subjected western blot analysis using specific antibody against phosphor-p38. Equal protein loadings were confirmed using β actin antibodies.
17 Fig. 5. Effect of various kinase inhibitors on scopoletin-enhanced melanin synthesis Cells were incubated with or without scopoletin (40 μg/ml) for 72 h either in the presence and absence of H-89, KT5720, Ro and SB Melanin content was determined as described in the Materials and Methods (A). Intracellular melanin was observed by DOPA staining (B). Results are the mean ± SD from triplicate determination. p<0.01 versus untreated cells, #p<0.01 versus scopoletin treated cells. Fig. 6. Effect of various kinase inhibitors on scopoletin-enhanced tyrosinase expression Cells were incubated with or without scopoletin (40 μg/ml) for 72 h either in the presence and absence of H-89, KT5720, Ro and SB Tyrosinase expression was detected by western blotting using specific antibodies (A). Fold increases over the control were determined by densitometric analysis (B). Results are the mean ± SD from triplicate determination. p<0.01 versus untreated cells, #p<0.05, ##p<0.01 versus scopoletin treated cells. Fig. 7. Effect of camp analog and scopoletin on melanin synthesis Cells were treated with scopoletin (40 μg/ml), or dbcamp (500 μm) for 48 h. At the end of treatment, tyrosinase activity (A) and melanin content (B) were measured as Materials and Methods. Results are the mean ± SD from three independent experiments. p<0.05, p<0.01 versus untreated cells. Fig. 8. Effect of p38 MAPK sirna on scopoletin-enhanced tyrosinase expression Cells were transfected with a specific sirna of p38 MAPK or a non-silencing control. Following transfection for 24 h, the cells were incubated with or without scopoletin (40 μg/ml) for 72 h.
18 The knockdown was evaluated by Western blotting. Results are the mean ± SD from triplicate determination. p<0.01 versus untreated cells, ##p<0.01 versus scopoletin treated cells.
19
20
21
22
23
24
25
26
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationSupplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationExperience The Magic of Science. DermaPep UL. Multi-functional whitening active. Experience the magic of science
Experience The Magic of Science Multi-functional whitening active DermaP ep Experience the magic of science Anti-aging DermaPep A35 DermaPep A42 DermaPep A44 DermaPep A53 Whitening DermaPep A35 DermaPep
More informationCD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationToluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationSupplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationSupplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
More informationCitation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationPhylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationTable S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
More informationSupplementary Information
Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationSupplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationMcAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
More informationSupplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
More informationACTIVE.LITE. Patent-Pending Technology + Visibly Perceivable Results in Less than 14 Days. Tomorrow s Vision Today!
ACTIVE.LITE Patent-Pending Technology + Visibly Perceivable Results in Less than 14 Days Tomorrow s Vision Today! AESTHETIC PERFECTION IS THE STANDARD Aesthetic skin perfection is now the consumer standard
More informationSupplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
More informationLuisant Mela X Free from AGEs-Induced Epidermal Pigmentation
Free from -Induced Epidermal Pigmentation Find plant extract solution with NEW APPROACH TO FIGHT AGAINST MELANOGENESIS Skin Pigmentation Many people have been striving to obtain lighter, brighter and healthier-looking
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationExpression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
More informationSupplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
More informationCulture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
More informationice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed
More informationJournal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationAstaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
More informationBIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3
Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein
More informationFormylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationElectrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB
Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.
More informationSupporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationSUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
More informationTetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
More information3-O-Ethyl Ascorbic Acid: A Stable, Vitamin C-Derived Agent for Skin Whitening
Formulating http://www.cosmeticsandtoiletries.com/formulating/function/active/ premium-3-o-ethyl-ascorbic-acid-a-stable-vitamin-c-derived- Agent-for-Skin-Whitening-225540872.html?c=n 3-O-Ethyl Ascorbic
More informationSupplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
More informationDevelopment of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients
Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients Sangjung Park The Graduate School Yonsei University Department of Biomedical Laboratory
More informationBeta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More informationBeta-carboline alkaloids harmaline and harmalol induce melanogenesis through p38 mitogen-activated protein kinase in B16F10 mouse melanoma cells
BMB reports Beta-carboline alkaloids harmaline and harmalol induce melanogenesis through p38 mitogen-activated protein kinase in B16F10 mouse melanoma cells Sun Young Park 1,2, Young Hun Kim 1, Young Hee
More informationERK Activation by Fucoidan Leads to Inhibition of Melanogenesis in Mel-Ab Cells
Korean J Physiol Pharmacol Vol 19: 29-34, January, 2015 http://dx.doi.org/10.4196/kjpp.2015.19.1.29 ERK Activation by Fucoidan Leads to Inhibition of Melanogenesis in Mel-Ab Cells Yu Seok Song 1,2, Marie
More informationEffects of COX-2 Inhibitor on the Proliferation of MCF-7 and LTED MCF-7 Cells
Mahidol University Journal of Pharmaceutical Sciences 2008; 35(1-4): 47-51. Original Article Effects of COX-2 Inhibitor on the Proliferation of MCF-7 and LTED MCF-7 Cells K. Poemsantitham, N. Sookvanichsilp
More informationCIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationSupplemental Methods Supplemental Table 1. Supplemental Figure 1. Supplemental Figure 2. Supplemental Figure 3. Supplemental Figure 4.
Supplemental Methods TGF-B1 ELISA Supernatants were collected from AT2 cells cultured for 1, 2, 3, or 4 days and frozen at -80 degrees C until use in the ELISA. A commercially available mouse TGF-B1 Duo
More informationRecommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness
World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)
More informationIsolate Sexual Idiomorph Species
SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationMutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationTable S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes
Table S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes Forward primer (5 3 ) Rervese primer (5 3 ) U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 5S TACGGCCATACCACCCTGAA
More informationAssessment of the in vitro skin irritation of chemicals using the Vitrolife-Skin human skin model
AATEX 14, Special Issue, 417-423 Proc. 6th World Congress on Alternatives & Animal Use in the Life Sciences August 21-25, 2007, Tokyo, Japan Assessment of the in vitro skin irritation of chemicals using
More informationInfluence of plasma-activated compounds on melanogenesis and tyrosinase activity
Supporting file Influence of plasma-activated compounds on melanogenesis and tyrosinase activity Anser Ali 1,2, Zaman Ashraf 3,4, Naresh Kumar 1,2, Muhammad Rafiq 3, Farukh Jabeen 6,7, Jihoon Park 5, Ki
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationLezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationHypopigmenting agents
An in-depth review on the biological and chemical aspects of hyperpigmentation and contemporary strategies for achieving even skin tone Hypopigmenting agents Melanin Pigment that provides color to skin,
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationResistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
More informationSupplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
More informationAnti-Melanogenic Activities of Sargassum muticum via MITF Downregulation
ORIENTAL JOURNAL OF CHEMISTRY An International Open Free Access, Peer Reviewed Research Journal www.orientjchem.org ISSN: 0970-020 X CODEN: OJCHEG 2017, Vol. 33, No. (4): Pg. 1589-1594 Anti-Melanogenic
More informationSupplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
More informationwww.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
More informationTranexamic Acid Diminishes Laser-Induced Melanogenesis
Ann Dermatol Vol. 27, No. 3, 2015 http://dx.doi.org/10.5021/ad.2015.27.3.250 ORIGINAL ARTICLE Tranexamic Acid Diminishes Laser-Induced Melanogenesis Myoung Shin Kim, Seung Hyun Bang 1, Jeong-Hwan Kim 2,
More information