Supplementary data Comparison of transcriptomes of chilling- and drought-tolerant and intolerant Nicotiana tabacum

Hao D. H., Ma W. G., Sheng Y. L., Zhang J. B., Jin Y. F., Yang H. Q., Li Z. G., Wang S. S., GONG Ming*

Comparison of transcriptomes and gene expression profiles of two chilling- and drought-tolerant and intolerant Nicotiana tabacum varieties under low temperature and drought stress Hao D. H., Ma W. G.,

Involvement of Antioxidant Systems in Heat-Shock-Induced Heat Tolerance in Maize Seedlings

2007, 29 (2) : 231 236 Acta Botanica Yunnanica, (, 650092 ) : 42 4 h 4 h, 4 h, ( CAT), ( SOD), ( GR), ( APX) ( GPX) ( ASA) ( GSH),, : ; ; ; ; : Q 945 : A : 0253-2700 (2007) 02-231 - 06 Involvement of Antioxidant

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

www.academicjournals.com OPEN ACCESS Asian Journal of Animal and Veterinary Advances ISSN 1683-9919 DOI: 10.3923/ajava.2017.61.70 Research Article Flaxseed Oil Alleviates Toxic Effects of Subacute Exposure

Supplementary Material

10.1071/FP14336_AC CSIRO 2015 Supplementary Material: Functional Plant Biology, 2015, 42(7), 630 642. Supplementary Material The role of oxidative stress in determining the level of viability of black

ANTIOXIDATIVE DEFENCE IN WINTER WHEAT PLANTS DURING EARLY COLD ACCLIMATION

GEN. APPL. PLANT PHYSIOLOGY, SPECIAL ISSUE, 2006, 101-108 101 ANTIOXIDATIVE DEFENCE IN WINTER WHEAT PLANTS DURING EARLY COLD ACCLIMATION P. Apostolova, I. Yaneva* Acad. M. Popov Institute of Plant Physiology,

RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice

SUPPLEMENTARY INFORMATION RNA interference induced hepatotoxicity results from loss of the first synthesized isoform of microrna-122 in mice Paul N Valdmanis, Shuo Gu, Kirk Chu, Lan Jin, Feijie Zhang,

Lecture 8 Understanding Transcription RNA-seq analysis. Foundations of Computational Systems Biology David K. Gifford

Lecture 8 Understanding Transcription RNA-seq analysis Foundations of Computational Systems Biology David K. Gifford 1 Lecture 8 RNA-seq Analysis RNA-seq principles How can we characterize mrna isoform

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM. Fatty Acid Elongation and Desaturation

ANSC/NUTR 618 LIPIDS & LIPID METABOLISM I. Fatty acid elongation A. General 1. At least 60% of fatty acids in triacylglycerols are C18. 2. Free palmitic acid (16:0) synthesized in cytoplasm is elongated

Aging and nutrition 03/11/2012. Why do people age? Oxidative stress and damage

Aging and nutrition % of elderly people in Canadian population is increasing more than for other age groups within the elderly age group there is great variability in terms health, metabolism, physical

[U- 13 C5] glutamine. Glutamate. Acetyl-coA. Citrate. Citrate. Malate. Malate. Isocitrate OXIDATIVE METABOLISM. Oxaloacetate CO2.

Supplementary Figures a. Relative mrna levels Supplementary Figure 1 (Christofk) 3.0 2.5 2.0 1.5 1.0 0.5 0.0 LAT1 Fumarate Succinate Palmitate Acetyl-coA Oxaloacetate OXIDATIVE METABOLISM α-ketoglutarate

Comparative Transcriptome Profiling of Two Tomato Genotypes in Response to Potassium-Deficiency Stress

Article Comparative Transcriptome Profiling of Two Tomato Genotypes in Response to Potassium-Deficiency Stress Xiaoming Zhao 1,2, Yang Liu 1, Xin Liu 1, * and Jing Jiang 1, * 1 The Key Laboratory of Protected

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.

RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant

Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and

Copyright is owned by the Author of the thesis. Permission is given for a copy to be downloaded by an individual for the purpose of research and private study only. The thesis may not be reproduced elsewhere

Effect of NaCl stress on H 2 O 2 metabolism in rice leaves

Plant Growth Regulation 30: 151 155, 2000. 2000 Kluwer Academic Publishers. Printed in the Netherlands. 151 Short cmmunication Effect of NaCl stress on H 2 O 2 metabolism in rice leaves Chuan Chi Lin &

Chun-Fang Li 1,2, Yan-Xia Xu 1, Jian-Qiang Ma 1, Ji-Qiang Jin 1, Dan-Juan Huang 1, Ming-Zhe Yao 1, Chun-Lei Ma 1 and Liang Chen 1*

Li et al. BMC Plant Biology (2016) 16:195 DOI 10.1186/s12870-016-0885-2 RESEARCH ARTICLE Open Access Biochemical and transcriptomic analyses reveal different metabolite biosynthesis profiles among three

Ulva as a Model for the Study of Environmental stress in Intertidal Macroalgae

Kuroshio Science 61, 115119, 2012 Ulva as a Model for the Study of Environmental stress in Intertidal Macroalgae TseMin Lee*, TsureMeng Wu, MingShiuan Sung, YuanTing Hsu, HsuehLing Chang, ChengYang Kang.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas.

Supplementary Figure 1 Experimental design and workflow utilized to generate the WMG Protein Atlas. (a) Illustration of the plant organs and nodule infection time points analyzed. (b) Proteomic workflow

Anti-Cancer & Anti-HIV effects of ALKA V-6

Anti-Cancer & Anti-HIV effects of ALKA V-6 Dr. C. Reed Richardson & Dr. Dhiraj Vattem TEXAS STATE UNIVERSITY San Marcos Texas OBJECTIVES The overall objective of this research was to determine Cancer chemotherapeutic

Effects of genotype and environment on metabolite profiling of Nicotiana tabacum

Effects of genotype and environment on metabolite profiling of Nicotiana tabacum China Tobacco Gene Research Center Jingjing JIN 2017.10.23 Outline Background Method Result Conclusion 1 / 22 Genotype,

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

Tobacco responds to salt stress by increased activity of antioxidant enzymes

801 Tobacco responds to salt stress by increased activity of antioxidant enzymes Ali Asghar Hatamnia 1, *, Nasser Abbaspour 1, Reza Darvishzadeh 2, Fatemeh Rahmani 1, Reza Heidari 1 1. Department of Biology,

De novo transcriptome sequencing and gene expression profiling of Elymus nutans under cold stress

Fu et al. BMC Genomics (2016) 17:870 DOI 10.1186/s12864-016-3222-0 RESEARCH ARTICLE Open Access De novo transcriptome sequencing and gene expression profiling of Elymus nutans under cold stress Juanjuan

Antioxidants from Cereal Grain and Their Byproduct Proteins

Antioxidants from Cereal Grain and Their Byproduct Proteins Yonghui Li, Assistant Professor Petfood R&D Showcase 2018 Manhattan, KS, Oct. 10 Department of Grain Science and Industry 1 Antioxidant Classification

Chapter 4 Plant Molecular Adaptations and Strategies Under Drought Stress

Chapter 4 Plant Molecular Adaptations and Strategies Under Drought Stress Sávio Pinho dos Reis, Deyvid Novaes Marques, Aline Medeiros Lima and Cláudia Regina Batista de Souza 4.1 Introduction Growth and

Serum Superoxide dismutase activity in thalassemia patients and healthy subjects with new method

The 5 th International & 10 th National Congress on Quality Improvement in Clinical Laboratories Serum Superoxide dismutase activity in thalassemia patients and healthy subjects with new method Elham Ghahramanlu,

number Done by Corrected by Doctor Nayef Karadsheh

number 17 Done by Abdulrahman Alhanbali Corrected by Lara Abdallat Doctor Nayef Karadsheh 1 P a g e Pentose Phosphate Pathway (PPP) Or Hexose Monophosphate Shunt In this lecture We will talk about the

Maly J., Masojidek J., Pinto V., Masci A. Sugiura M. and Pilloton R.

Polyaniline mediated electron transport between the histidine tagged photosystem II and gold electrode - evidence for peroxidase activity of cytochrome b-559 Maly J., Masojidek J., Pinto V., Masci A. Sugiura

Expression of programmed death ligand-1 on tumor cells varies pre and post

Expression of programmed death ligand-1 on tumor cells varies pre and post chemotherapy in non-small cell lung cancer Jin Sheng 1,2,3,*, Wenfeng Fang 1,2,3,*, Juan Yu 3, Yunpeng Yang 1,2,3, Yuxiang Ma

molecular function. The right hand y-axis indicates the number of annotated unigenes.

Takemura et al. Supplementary Fig.S1 Supplementary Fig. S1. GO assignment of all unigenes. The unigenes were mapped to three main categories: iological process, cellular component and molecular function.

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated

Functional mechanisms of drought tolerance in maize

Functional mechanisms of drought tolerance in maize Nepolean Thirunavukkarasu Division of Genetics Indian Agricultural Research Institute New Delhi-110012 tnepolean@iari.resi.in tnepolean@gmail.com Mt

The effect of micronutrients on antioxidant enzymes metabolism in Sunflower ( Helianthus annaus L. ) under drought stress

The effect of micronutrients on antioxidant enzymes metabolism in Sunflower ( Helianthus annaus L. ) under drought stress Majid Rahimizadeh, Scientific staff member, Department of Agriculture, Islamic

Biologic Oxidation BIOMEDICAL IMPORTAN

Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron

Drug repurposing and therapeutic anti-mirna predictions in oxldl-induced the proliferation of vascular smooth muscle cell associated diseases

Drug repurposing and therapeutic anti-mirna predictions in oxldl-induced the proliferation of vascular smooth muscle cell associated diseases Shun-Tsung Chen, Chien-Hung Huang, Victor C. Kok, Chi-Ying

Genotypic Variation and Heritability of Antioxidant related Traits in Wheat Landraces of Iran

ISSN No. (Print): 0975-1130 ISSN No. (Online): 2249-3239 Genotypic Variation and Heritability of Antioxidant related Traits in Wheat Landraces of Iran Ali Vosough*, Roza Ghouchani** and Armin Saed-Moucheshi***

Supplementary Materials and Methods

Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph

Molecular mechanism of the extended oil accumulation phase contributing to the high seed oil content for the genotype of tung tree (Vernicia fordii)

Zhang et al. BMC Plant Biology (2018) 18:248 https://doi.org/10.1186/s12870-018-1458-3 RESEARCH ARTICLE Molecular mechanism of the extended oil accumulation phase contributing to the high seed oil content

Cd 2+ stress induces two waves of H 2 O 2 accumulation associated with ROS-generating system and ROS-scavenging system in cultured tobacco cells

AJCS (5):-53 (212) ISSN:135-277 Cd 2+ stress induces two waves of H 2 O 2 accumulation associated with ROS-generating system and ROS-scavenging system in cultured tobacco cells Jin-Fen Wen 1,2, Ming-hua

Oxidative Stress Tolerance by Calcium and Histidine in Two Tomato Cultivars Under Nickel Stress

Journal of Stress Physiology & Biochemistry, Vol. 10 No. 2 2014, pp. 102-124 ISSN 1997-0838 Original Text Copyright 2014 by Mozafari, Asrar, Rezanejad, Pourseyedi and Yaghoobi ORIGINAL ARTICLE Oxidative

WT siz1-2 siz1-3. WT siz1-2 siz1-3. -Pi, 0.05 M IAA. -Pi, 2.5 M NPA

A WT siz1-2 siz1-3 B WT siz1-2 siz1-3 -Pi C +Pi WT siz1-2 siz1-3 D WT siz1-2 siz1-3 E +Pi, 0.05 M IAA -Pi, 0.05 M IAA WT siz1-2 siz1-3 WT siz1-2 siz1-3 F +Pi, 2.5 M NPA -Pi, 2.5 M NPA Supplemental Figure

Supporting Information

Supporting Information Supplemental Figure Legends Supplementary Figure 1. Experimental Design. A. To benchmark the performance of software parameter sets proteins were extracted from a pool of Arabidopsis

9 of Marine Environment and Ecology, Ocean University of China, Qingdao , China

Electronic Supplementary Material (ESI) for Environmental Science: Nano. This journal is The Royal Society of Chemistry 218 1 Supplementary Information 2 3 Interaction of CuO Nanoparticles with Plant Cells:

fl/+ KRas;Atg5 fl/+ KRas;Atg5 fl/fl KRas;Atg5 fl/fl KRas;Atg5 Supplementary Figure 1. Gene set enrichment analyses. (a) (b)

KRas;At KRas;At KRas;At KRas;At a b Supplementary Figure 1. Gene set enrichment analyses. (a) GO gene sets (MSigDB v3. c5) enriched in KRas;Atg5 fl/+ as compared to KRas;Atg5 fl/fl tumors using gene set

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB

RNA-Seq Preparation Comparision Summary: Lexogen, Standard, NEB CSF-NGS January 22, 214 Contents 1 Introduction 1 2 Experimental Details 1 3 Results And Discussion 1 3.1 ERCC spike ins............................................

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1.

Genesis of cerebellar interneurons and the prevention of neural DNA damage require XRCC1. Youngsoo Lee, Sachin Katyal, Yang Li, Sherif F. El-Khamisy, Helen R. Russell, Keith W. Caldecott and Peter J. McKinnon.

Cornstarch

Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes

Broad H3K4me3 is associated with increased transcription elongation and enhancer activity at tumor suppressor genes Kaifu Chen 1,2,3,4,5,10, Zhong Chen 6,10, Dayong Wu 6, Lili Zhang 7, Xueqiu Lin 1,2,8,

Supplemental Information

Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies

Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

Analysis of Fish Oil as Potential Oxidative Stress Inhibitor in C57BL/6 Mice

Available online at www.ijpab.com Khan et al Int. J. Pure App. Biosci. 4 (3): 104-111 (2016) ISSN: 2320 7051 DOI: http://dx.doi.org/10.18782/2320-7051.2312 ISSN: 2320 7051 Int. J. Pure App. Biosci. 4 (3):

Hydrogen Sulfide Stimulates Wheat Grain Germination and Counteracts the Effect of Oxidative Damage Caused by Salinity Stress

Cereal Research Communications 43(2), pp. 213 224 (2015) DOI: 10.1556/CRC.2014.0037 First published online 4 February, 2015 Hydrogen Sulfide Stimulates Wheat Grain Germination and Counteracts the Effect

Effect of exogenous Gama-aminobutyric acid on physiological tolerance of wheat seedlings exposed to chilling stress

611 Effect of exogenous Gama-aminobutyric acid on physiological tolerance of wheat seedlings exposed to chilling stress Praviz Malekzadeh*, Jalil Khara and Reza Heidari Faculty of Science, Urmia University,

shehab Moh Tarek ... ManarHajeer

3 shehab Moh Tarek... ManarHajeer In the previous lecture we discussed the accumulation of oxygen- derived free radicals as a mechanism of cell injury, we covered their production and their pathologic

Vessel wall differences between middle cerebral artery and basilar artery. plaques on magnetic resonance imaging

Vessel wall differences between middle cerebral artery and basilar artery plaques on magnetic resonance imaging Peng-Peng Niu, MD 1 ; Yao Yu, MD 1 ; Hong-Wei Zhou, MD 2 ; Yang Liu, MD 2 ; Yun Luo, MD 1

THESIS OF DOCTORAL DISSERTATION. Abiotic and biotic stress effects on barley and tobacco plants. Borbála Dorottya Harrach

THESIS OF DOCTORAL DISSERTATION Abiotic and biotic stress effects on barley and tobacco plants Borbála Dorottya Harrach Plant Protection Institute of the Hungarian Academy of Sciences Budapest 2009 Ph.D.

Linlin Liu 1, Yingying Li 1, Guangbiao She 1, Xianchen Zhang 1, Brian Jordan 2, Qi Chen 1, Jian Zhao 1* and Xiaochun Wan 1*

Liu et al. BMC Plant Biology (2018) 18:233 https://doi.org/10.1186/s12870-018-1440-0 RESEARCH Open Access Metabolite profiling and transcriptomic analyses reveal an essential role of UVR8- mediated signal

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Johnson DB, Balko JM, Compton ML, et al. Fulminant myocarditis

WATER TRANSPORT IN PLANTS: FROM MOLECULES TO WHOLE PLANT M.

WATER TRANSPORT IN PLANTS: FROM MOLECULES TO WHOLE PLANT M. Katsuhara Institute of Plant Science and Resources, Okayama University, Kurashiki, Japan E-mail: kmaki@rib.okayama-u.ac.jp Abstract Aquaporins

A deficiency of biotin, commonly seen in alcoholics, can cause neurological symptoms

Water-soluble vitamins Vitamin deficiencies Metabolism General Diseases etc. A deficiency of biotin, commonly seen in alcoholics, can cause neurological symptoms Levels of folate are particularly low in

ROLE OF MINERAL NUTRITION IN ALLEVIATING DETRIMENTAL EFFECTS OF ENVIRONMENTAL STRESSES ON CROP PRODUCTION

ROLE OF MINERAL NUTRITION IN ALLEVIATING DETRIMENTAL EFFECTS OF ENVIRONMENTAL STRESSES ON CROP PRODUCTION by Ismail CAKMAK Sabanci University Istanbul, Turkiye HUGE INCREASES IN WORLD POPULATION FOOD SECURITY

2. BALcanOSH MEDNARODNA KONFERENCA ZA REGIONALNO SODELOVANJE, BLED, SLOVENIJA

Vita Dolžan 1, Metoda Dodič-Fikfak 2, Alenka Franko 2 1 Pharmacogenetics Lab., Inst. of Biochemistry, Faculty of Medicine, University of Ljubljana, Slovenia 2 Clinical Institute of Occupational Medicine,University

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

The study on the Antioxidation of EM-X in Liver of Rat in vivo

The study on the Antioxidation of EM-X in Liver of Rat in vivo Cao Jun a), Cong Huifang b), Sun Ziaojun c), Ke Bin d) a) Department of Biochemistry, Qiqihar Medical College, P.R. Chin, 161042 b) Second

6. SUMMARY AND CONCLUSION

6. SUMMARY AND CONCLUSION Free radicals are chemical species containing one or more unpaired electrons, like hydrogen atom, most transition metal ions, nitric oxide and oxygen, with two unpaired electrons.

Supplementary Figures and Tables

Supplementary Figures and Tables Supplementary Figure 1. Study design and sample collection. S.japonicum were harvested from C57 mice at 8 time points after infection. Total number of samples for RNA-Seq:

Whole liver transcriptome analysis for the metabolic adaptation of dairy cows

Whole liver transcriptome analysis for the metabolic adaptation of dairy cows Ngoc-Thuy Ha Animal Breeding and Genetics Group Department of Animal Sciences Georg-August-University Goettingen, Germany 1

Cadmium stress on antioxidant activity of two Alternanthera sp.

Journal 55 of Scientific & Industrial Research J SCI IND RES VOL 7 SEPT - OCT 13 Vol. 7, September - October 13, pp. 55-5 Cadmium stress on antioxidant activity of two Alternanthera sp. M Devi Chinmayee,

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

Control MMC MMC+Vit-E MMC+ALCAR MMC+Vit-E +ALCAR

TABLE 12:- Alteration in the levels of Lipid Peroxide (LPO) in different tissues of rats, following 14 day treatment of Methylmercury Chloride (MMC) 2mg/kg body weight via gavage. Recovery displayed by

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

Digitizing the Proteomes From Big Tissue Biobanks

Digitizing the Proteomes From Big Tissue Biobanks Analyzing 24 Proteomes Per Day by Microflow SWATH Acquisition and Spectronaut Pulsar Analysis Jan Muntel 1, Nick Morrice 2, Roland M. Bruderer 1, Lukas

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with

SUPPLEMENTARY MATERIAL. Samy Selim a,c*, Soad Al Jaouni a. University, Sakaka, P.O. 2014, Saudi Arabia

SUPPLEMENTARY MATERIAL Anti-Inflammatory, Antioxidant and Anti-Angiogenic Activities of Diosgenin Isolated from Traditional Medicinal Plant, Costus speciosus (Koen ex.retz.) Sm Samy Selim a,c*, Soad Al

FAM83H and casein kinase I regulate the organization of. the keratin cytoskeleton and formation of desmosomes

FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes Takahisa Kuga, Mitsuho Sasaki, Toshinari Mikami, Yasuo Miake, Jun Adachi, Maiko Shimizu, Youhei

Mercury induced oxidative stress of antioxidants in Clitoria ternatea L.

International Letters of Natural Sciences Online: 2014-08-19 ISSN: 2300-9675, Vol. 23, pp 1-8 doi:10.18052/www.scipress.com/ilns.23.1 2014 SciPress Ltd., Switzerland Mercury induced oxidative stress of

Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples

DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Selective depletion of abundant RNAs to enable transcriptome analysis of lowinput and highly-degraded RNA from FFPE breast cancer samples LIBRARY

Information concerning patients Practical advice and costs

(downloaded from www.hese project.org) Information concerning patients Practical advice and costs A redox analysis of your serum is only possible in our laboratory. But your personal presence is not needed!

Global Epigenetic and Transcriptional Trends among Two Rice Subspecies and Their Reciprocal Hybrids W

The Plant Cell, Vol. 22: 17 33, January 2010, www.plantcell.org ã 2010 American Society of Plant Biologists RESEARCH ARTICLES Global Epigenetic and Transcriptional Trends among Two Rice Subspecies and

Supplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis

Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,

SUPPLEMENTARY INFORMATION

doi:10.1038/nature12198 1. Supplementary results 1.1. Associations between gut microbiota, glucose control and medication Women with T2D who used metformin had increased levels of Enterobacteriaceae (i.e.

ANSC/NUTR 618 Lipids & Lipid Metabolism

I. Overall concepts A. Definitions ANC/NUTR 618 Lipids & Lipid Metabolism 1. De novo synthesis = synthesis from non-fatty acid precursors a. Carbohydrate precursors (glucose, lactate, and pyruvate) b.

Identification of drought-responsive mirnas and physiological characterization of tea plant (Camellia sinensis L.) under drought stress

Guo et al. BMC Plant Biology (2017) 17:211 DOI 10.1186/s12870-017-1172-6 RESEARCH ARTICLE Identification of drought-responsive mirnas and physiological characterization of tea plant (Camellia sinensis

Evaluation of Phenolics and Antioxidant Enzyme Systems for Phytophthora Blight in Resistant and Susceptible Variety of Sesame (Sesamum indicum L.

International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 8 (2017) pp. 2344-2352 Journal homepage: http://www.ijcmas.com Original Research Article https://doi.org/10.20546/ijcmas.2017.608.277

Lipid Oxidation in Muscle Foods

Lipid Oxidation in Muscle Foods Unique Challenges with Oxidation in Muscle Foods Rancidity is a major shelf-life limiting factor in frozen muscle foods NaCl generally accelerates oxidation Oxidation accelerates

Activities of antioxidants in plants under environmental stress

Activities of antioxidants in plants Akram Ali and fahad Alqurainy Activities of antioxidants in plants under environmental stress Akram Ali* Fahad Alqurainy Department of Botany and Microbiology, Faculty

EVALUATION OF STROBILURIN ON BIOPHYSICAL, BIOCHEMICAL PARAMETERS IN SOYBEAN [GLYCINE MAX (L.) MERRILL]

Plant Archives Vol. 17 No. 2, 2017 pp. 1123-1129 ISSN 0972-5210 EVALUATION OF STROBILURIN ON BIOPHYSICAL, BIOCHEMICAL PARAMETERS IN SOYBEAN [GLYCINE MAX (L.) MERRILL] S. P. Banakar, Renuka Herkal and D.

Free Radicals in Biology and Medicine

Free Radicals in Biology and Medicine 0 \ Second Edition BARRY HALLIWELL Professor of Medical Biochemistry, University of London King's College and JOHN M.C. GUTTERIDGE Senior Scientist, National Institute

Supporting Information

Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing

Department of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada.

Phosphoproteome dynamics of Saccharomyces cerevisiae under heat shock and cold stress Evgeny Kanshin 1,5, Peter Kubiniok 1,2,5, Yogitha Thattikota 1,3, Damien D Amours 1,3 and Pierre Thibault 1,2,4 * 1

Simple, rapid, and reliable RNA sequencing

Simple, rapid, and reliable RNA sequencing RNA sequencing applications RNA sequencing provides fundamental insights into how genomes are organized and regulated, giving us valuable information about the

Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination

Int. J. Mol. Sci. 2016, 17, 1139; doi:.3390/ijms17071139 S1 of S5 Supplementary Materials: Global Transcriptomic Analysis Reveals the Mechanism of Phelipanche Aegyptiaca Seed Germination Zhaoqun Yao, Fang

MITOCHONDRIAL FUNCTION & RELATED TESTS

North Cottage 11 Dovers Green Road Reigate Surrey RH2 8BU Tel: 01737 226338 MITOCHONDRIAL FUNCTION & RELATED TESTS Chronic fatigue syndrome (CFS) is a syndrome - that is a combination of symptoms and signs

Morphological and Physiological Responses of Cotton (Gossypium hirsutum L.) Plants to Salinity

Morphological and Physiological Responses of Cotton (Gossypium hirsutum L.) Plants to Salinity Lei Zhang, Huijuan Ma, Tingting Chen, Jun Pen, Shuxun Yu*, Xinhua Zhao* State Key Laboratory of Cotton Biology,

Responses of Photosynthetic Functions to Low Temperature in Flag Leaves of Rice Genotypes at the Milky Stage

Rice Science, 26, 13(2): 113-119 113 http://www.ricesci.cn; www.ricescience.org Responses of Photosynthetic Functions to Low Temperature in Flag Leaves of Rice Genotypes at the Milky Stage WANG Jing 1,

Soy Isoflavones Modulated Antioxidant Defense Systems and Decreased Lipid Peroxidation in Rats and Humans

Soy Isoflavones Modulated Antioxidant Defense Systems and Decreased Lipid Peroxidation in Rats and Humans By Chung-Yen Chen Dissertation submitted to the Graduate Faculty of the Virginia Polytechnic Institute

Rice in vivo RNA structurome reveals RNA secondary structure conservation and divergence in plants

Rice in vivo RN structurome reveals RN secondary structure conservation and divergence in plants Hongjing Deng 1,2,,5, Jitender heema 3, Hang Zhang 2, Hugh Woolfenden 2, Matthew Norris 2, Zhenshan Liu