Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
|
|
- Brittney Price
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). The map was generated using the reference map by KEGG. CO represents entry number of compound. Pentose and glucuronate interconversions (panel B); Starch and sucrose metabolism (panel C); Cysteine and methionine metabolism (panel D) (details in Table S1). 1
2 Fig. S2. ICA analysis of isobaric tags for relative and absolute quantitation (itraq) proteome data of alcoholic fatty liver disease. Green, control; red: 12W; 2
3 Fig. S3. An updated view of the pathway and signaling network by Gene Ontology. The differentially expressed proteins were classified among three categories: biological process (A), molecular function (B), and cellular component (C). 3
4 Fig.S4 Pathogenic mechanisms of alcoholic liver disease proposed based in animal models evidence, and p53 signaling pathway 4
5 Supplementary table 1. Result from ingenuity pathway analysis with MetPA. No. Pathway Name Total Expected Hits Raw p Impact 1 Starch and sucrose metabolism Riboflavin metabolism Nicotinate and nicotinamide metabolism Pentose and glucuronate interconversions Cysteine and methionine metabolism Arginine and proline metabolism minoacyl-trna biosynthesis Note: Total is the total number of compounds in the pathway; the Hits is the actually matched number from the user uploaded data; the Raw p is the original p value calculated from the enrichment analysis; the Impact is the pathway impact value calculated from pathway topology analysis. 5
6 Supplementary Table 2. Differentially expressed proteins in alcoholic fatty liver disease identified by itraq. No. Accession(gi) Description Score Coverage Proteins Unique Peptides PSMs AAs MW calc. C/M Peptides [kda] pi 1 P49000 Muellerian-inhibiting factor % Q68FQ0 T-complex protein 1 subunit epsilon % Q80T18 Glia maturation factor gamma % Q9JLT0 Myosin % P protein eta % Q920G0 Src kinase-associated % phosphoprotein 2 7 P58775 Tropomyosin beta chain % Q63083 Nucleobindin % Q9JK11 Reticulon % Q00715 Histone H2B type % P50115 Protein S100-A % Q kda heat- and acid-stable % phosphoprotein 13 Q5RKI1 Eukaryotic initiation factor 4A-II % P60901 Proteasome subunit alpha type % P50116 Protein S100-A % P06759 Apolipoprotein C-III % P31394 Vitamin K-dependent protein C % P28480 T-complex protein 1 subunit alpha % P18418 Calreticulin % P01015 Angiotensinogen % P24594 Insulin-like growth factor-binding % protein 5 22 P15978 Class I histocompatibility antigen, % Non-RT1.A alpha-1 chain 23 Q9WV63 Kinesin-like protein KIF2A % P85108 Tubulin beta-2a chain % P08932 T-kininogen % Q9WUK5 Inhibin beta C chain % Q62975 Protein Z-dependent protease % inhibitor 28 Q5M8C6 Fibrinogen-like protein % Q9Z244 GMP reductase % P07756 Carbamoyl-phosphate synthase % [ammonia], mitochondrial 31 P04276 Vitamin D-binding protein % P62804 Histone H % P protein beta/alpha % P25236 Selenoprotein P % Q8R2H5 Phosphatidylinositol-glycan-specific % phospholipase D 36 P24090 Alpha-2-HS-glycoprotein % P04041 Glutathione peroxidase % P26644 Beta-2-glycoprotein % P62630 Elongation factor 1-alpha % Q9EQV9 Carboxypeptidase B % P23593 Apolipoprotein D % Q63276 Bile acid-coa:amino acid N % acyltransferase 43 Q63520 Synaptonemal complex protein % P55314 Complement component C8 beta % chain 45 P05545 Serine protease inhibitor A3K % P04639 Apolipoprotein A-I % Q9QX79 Fetuin-B % P55159 Serum paraoxonase/arylesterase % P21744 Insulin-like growth factor-binding % protein 4 50 P23680 Serum amyloid P-component % O35460 Angiopoietin % Q6IFU7 Keratin, type I cytoskeletal % P48032 Metalloproteinase inhibitor % P35572 Insulin-like growth factor-binding % protein 6 55 Q64640 Adenosine kinase % P02091 Hemoglobin subunit beta % Q4FZU2 Keratin, type II cytoskeletal 6A % P10760 Adenosylhomocysteinase % P20762 Ig gamma-2c chain C region % P15473 Insulin-like growth factor-binding % protein 3 61 Q6IG04 Keratin, type II cytoskeletal % Q6IG02 Keratin, type II cytoskeletal % epidermal 63 Q4KM35 Proteasome subunit beta type % Q09429 ATP-binding cassette transporter % sub-family C member 8 65 Q63484 RAC-gamma serine/threonineprotein kinase % P59996 Proprotein convertase %
7 subtilisin/kexin type 9 67 P55797 Apolipoprotein C-IV % P01836 Ig kappa chain C region, A allele % P09034 Argininosuccinate synthase % P ketoacyl-CoA thiolase B, % peroxisomal 71 P10354 Chromogranin-A % Q6IMF3 Keratin, type II cytoskeletal % Q6IG03 Keratin, type II cytoskeletal % P05964 Protein S100-A % P08025 Insulin-like growth factor I % Q6IFW6 Keratin, type I cytoskeletal % P oxo-5-beta-steroid % dehydrogenase 78 P18757 Cystathionine gamma-lyase % Q6P6Q2 Keratin, type II cytoskeletal % Q9QZR6 Septin % P06757 Alcohol dehydrogenase % P19939 Apolipoprotein C-I % Q6IFU8 Keratin, type I cytoskeletal % P85411 Keratinocyte differentiationassociated protein % P04638 Apolipoprotein A-II %
Metabolomic Data Analysis with MetaboAnalystR
Metabolomic Data Analysis with MetaboAnalystR Name: guest623839008349489450 February 7, 2018 1 Background Understanding the functional importance of metabolites in untargeted metabolomics is limited due
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationTECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive
TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)
More informationSupporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with
More informationTable S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts
Table S1. page 1/4 Phase 1 Exploratory Study, List of proteins identified by LC-ESI-MS/MS after 1DE separation and their relative quantitation by spectral count UniProt Entry SwissProt- CRC case Pool Control
More informationSUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.
SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body
More informationPublished on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )
Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.
More informationSupporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural
More informationNitrogen Metabolism. Overview
Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak
More informationNitrogen Metabolism. Pratt and Cornely Chapter 18
Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak
More informationSupplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan
More informationCornstarch
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the
More informationBiological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
More informationBiological Molecules. Carbohydrates, Proteins, Lipids, and Nucleic Acids
Biological Molecules Carbohydrates, Proteins, Lipids, and Nucleic Acids Organic Molecules Always contain Carbon (C) and Hydrogen (H) Carbon is missing four electrons Capable of forming 4 covalent bonds
More informationNitrogen Metabolism. Overview
Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak
More informationUntargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-120.
Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-0. Thomas J Velenosi, Anzel Hennop, David A Feere, Alvin Tieu, Andrew S Kucey, Polydoros Kyriacou, Laura E McCuaig,
More informationBiochemistry 2 Recita0on Amino Acid Metabolism
Biochemistry 2 Recita0on Amino Acid Metabolism 04-20- 2015 Glutamine and Glutamate as key entry points for NH 4 + Amino acid catabolism Glutamine synthetase enables toxic NH 4 + to combine with glutamate
More informationProteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).
Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in
More informationQuantitative Proteomics. Quantitative Proteomics
Quantitative Proteomics Liwen Zhang Mass Spectrometry and Proteomics Facility The Ohio State University Summer Workshop 216 Quantitative Proteomics Quantitation in proteomics has become a popular area
More informationProtein Class/Name KEGG Pathways
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Supplemental Table 4. Proteins Increased in Either Soil medium at 37 o C and 25 o C Table 4A. Proteins
More informationPosttranslational Modification of Proteins
Posttranslational Modification of Proteins Expanding Natures Inventory Christopher T. Walsh Harvard Medical School RoBERTS AND CoMPANY PuBLISHERS Englewood, Col ~1 ado,. Brief Contents Preface xv Reviewers
More informationProtein name Location Family MW (kda)
Supplementary Information, Table S1. Proteomic results from LC-MS/MS analysis of MC/9 exosomes. Proteins of MC/9 exosomes were collected in the stacking parts of an SDS-PAGE, cut out, trypsinated and analysed
More informationProtein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
More information1.4. Lipids - Advanced
1.4. Lipids - Advanced www.ck12.org In humans, triglycerides are a mechanism for storing unused calories, and their high concentration in blood correlates with the consumption of excess starches and other
More informationthe nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
More informationDental Students Biochemistry Exam V Questions ( Note: In all cases, the only correct answer is the best answer)
Dental Students Biochemistry Exam V Questions - 2006 ( Note: In all cases, the only correct answer is the best answer) 1. Essential fatty acids are: A. precursors of biotin B. precursors of tyrosine C.
More informationBIOLOGY 103 Spring 2001 MIDTERM LAB SECTION
BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your
More informationChapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002
Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse
More informationSynthesis of Fatty Acids and Triacylglycerol
Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationMBBS First Professional (Part-I Examination) BIOCHEMISTRY Model Paper
MBBS FIRST PROFESSIONAL (PART I) Biochemistry (MCQs) Maximum Marks: 35 Time Allowed: 45 minutes Q 1. What is not correct about cell membrane? A. Contains two layers of phospholipids B. May contain receptor
More informationFormalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds
Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed
More informationEnergy storage in cells
Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen
More informationSwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4
P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationNBCE Mock Board Questions Biochemistry
1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation
More informationOxidation of Long Chain Fatty Acids
Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,
More informationGMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS
GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationThe three important structural features of proteins:
The three important structural features of proteins: a. Primary (1 o ) The amino acid sequence (coded by genes) b. Secondary (2 o ) The interaction of amino acids that are close together or far apart in
More informationProtein Class/Name. Pathways. bat00250, bat00280, bat00410, bat00640, bat bat00270, bat00330, bat00410, bat00480
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Supplemental Table 1. Proteins Increased in Either Soil or Laboratory media Table 1A. Proteins Increased
More informationProtein Classification based upon Biological functions
PROTEINS (a) The light produced by fireflies is the result of a reaction involving the protein luciferin and ATP, catalyzed by the enzyme luciferase. (b) Erythrocytes contain large amounts of the oxygen-transporting
More informationSupplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases
Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin
More informationAmino Acid Metabolism
Amino Acid Metabolism Last Week Most of the Animal Kingdom = Lazy - Most higher organisms in the animal kindom don t bother to make all of the amino acids. - Instead, we eat things that make the essential
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 31 Amino Acid Synthesis 2013 W. H. Freeman and Company Chapter 31 Outline Although the atmosphere is approximately 80% nitrogen,
More informationSupplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
More informationBiologic Oxidation BIOMEDICAL IMPORTAN
Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron
More informationLipid Metabolism. Catabolism Overview
Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water
More informationAMINO ACID METABOLISM
AMINO ACID METABOLISM PHL-285 Biochemistry-2 Mahmoud N. Nagi, Ph.D. Professor of Biochemistry Overview of amino acid metabolism. Classification of amino acids. Biosynthesis of nonessential amino acids.
More informationBio 366: Biological Chemistry II Test #1, 100 points (7 pages)
Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationChapter 7 Cellular Respiration and Fermentation*
Chapter 7 Cellular Respiration and Fermentation* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. Life Is Work
More informationBCM 221 LECTURES OJEMEKELE O.
BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX
More informationOxidation and Methylation in Human Brain: Implications for vaccines
Oxidation and Methylation in Human Brain: Implications for vaccines 1 Life can be viewed through the perspective of oxidation and reduction, which involves the loss and gain of electrons, respectively.
More informationnumber Done by Corrected by Doctor Faisal Al-Khatibe
number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationLecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III
Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS
More informationMimi Roy, PhD Senior Director & Site Head Caprion Proteomics US LLC. ISBER, Orlando May 23, 2014
Controlled Analysis of Preanalytical Variables in CSF and Blood Sample Collection, Processing and Storage: Implications for Best Practices in Clinical Research Mimi Roy, PhD Senior Director & Site Head
More informationBIOL 158: BIOLOGICAL CHEMISTRY II
BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an
More informationSupporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation
Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,
More informationMBB 115:511 and 694:407 Final Exam Niederman/Deis
MBB 115:511 and 694:407 Final Exam Niederman/Deis Tue. Dec. 19, 2006 Name Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth two points.
More informationTriose-P isomerase Enolase
Select the single best answer. 1 onsider the catabolism of glucose to carbon dioxide and water. In this metabolic direction, which of these enzymes catalyzes a reaction where the PRUTS have one more "high-energy"
More informationMITOCW watch?v=ddt1kusdoog
MITOCW watch?v=ddt1kusdoog The following content is provided under a Creative Commons license. Your support will help MIT OpenCourseWare continue to offer high-quality educational resources for free. To
More informationBIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.
BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In
More informationAMINO ACID METABOLISM
AMINO ACID METABOLISM Synthesis of Urea in Liver The series of reactions that form urea is known as the Urea Cycle or the Krebs-Henseleit Cycle. The urea cycle operates only to eliminate excess nitrogen.
More informationSystems biology approaches and pathway tools for investigating cardiovascular disease
Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk
More informationSo where were we? But what does the order mean? OK, so what's a protein? 4/1/11
So where were we? We know that DNA is responsible for heredity Chromosomes are long pieces of DNA DNA turned out to be the transforming principle We know that DNA is shaped like a long double helix, with
More informationDense and Dynamic Polyethylene Glycol Shells Cloak Nanoparticles. from Uptake by Liver Endothelial Cells for Long Blood Circulation
Dense and Dynamic Polyethylene Glycol Shells Cloak Nanoparticles from Uptake by Liver Endothelial Cells for Long Blood Circulation Hao Zhou, Zhiyuan Fan, Peter Y. Li, Junjie Deng,, Dimitrios C. Arhontoulis,
More informationSupplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
More informationBiochemistry: A Short Course
Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer
More informationAmino Acid Oxidation and the Urea Cycle
Amino Acid Oxidation and the Urea Cycle Amino Acids: Final class of biomolecules whose oxidation contributes significantly to the generation of energy Undergo oxidation in three metabolic circumstances
More informationNAME KEY ID # EXAM 3a BIOC 460. Wednesday April 10, Please include your name and ID# on each page. Limit your answers to the space provided!
EXAM 3a BIOC 460 Wednesday April 10, 2002 Please include your name and ID# on each page. Limit your answers to the space provided! 1 1. (5 pts.) Define the term energy charge: Energy charge refers to the
More informationLIPID METABOLISM
LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-
More informationf(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationPROTEIN METABOLISM: NITROGEN CYCLE; DIGESTION OF PROTEINS. Red meat is an important dietary source of protein nitrogen
PROTEIN METABOLISM: NITROGEN CYCLE; DIGESTION OF PROTEINS Red meat is an important dietary source of protein nitrogen The Nitrogen Cycle and Nitrogen Fixation Nitrogen is needed for amino acids, nucleotides,
More informationGlycogen Metabolism Dr. Mohammad Saadeh
Glycogen Metabolism Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy I. overview Glucose is energy source for Brain.
More informationCO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
More informationSupplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
More informationChapter 2. Chemical Composition of the Body
Chapter 2 Chemical Composition of the Body Carbohydrates Organic molecules that contain carbon, hydrogen and oxygen General formula C n H 2n O n -ose denotes a sugar molecule Supply energy Glucose Complex
More informationAmino acid metabolism I
Amino acid metabolism I Jana Novotná Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ. Metabolic relationship of amino acids DIETARY PROTEINS GLYCOLYSIS
More informationUniversity of Guelph Department of Chemistry and Biochemistry Structure and Function In Biochemistry
University of Guelph Department of Chemistry and Biochemistry 19-356 Structure and Function In Biochemistry Final Exam, April 21, 1997. Time allowed, 120 min. Answer questions 1-30 on the computer scoring
More informationMOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD
MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD 1) 37% molecular weight of about 97KDa 2) 14.6% molecular weight of about 45 KDa 3+4) 27.4% molecular weight
More informationJana Novotná, Bruno Sopko. Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ.
Amino acid metabolism II. Urea cycle Jana Novotná, Bruno Sopko Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ. Nitrogen balance Tissue proteins
More informationSupporting Information
Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng
More informationDisaccharides. Compound dehydration synthesis puts sugars together Hydrolysis (hydro-water, lysisbreakdown)
Carbohydrate Carbo-hydrate -carbon, water Cn(H2O) n Monosaccharides Hexose hex = 6 [carbons], "-ose" means sugar Glucose monosaccaccharide usually assume a ring structure Disaccharides Compound dehydration
More informationThe source of protein structures is the Protein Data Bank. The unit of classification of structure in SCOP is the protein domain.
UNIT 14 PROTEINS DEFINITION A large molecule composed of one or more chains of amino acids in a specific order; the order is determined by the base sequence of nucleotides in the gene that codes for the
More informationSynthesis of Fatty Acids and Triacylglycerol
Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationEnzyme Regulation I. Dr. Kevin Ahern
Enzyme Regulation I Dr. Kevin Ahern Enzyme Regulation Mechanisms Enzyme Regulation Mechanisms 1. Allosterism Enzyme Regulation Mechanisms 1. Allosterism 2. Covalent Modification Enzyme Regulation Mechanisms
More informationLecture 13 (10/13/17)
Lecture 13 (10/13/17) Reading: Ch6; 187-189, 204-205 Problems: Ch4 (text); 2, 3 NXT (after xam 2) Reading: Ch6; 190-191, 194-195, 197-198 Problems: Ch6 (text); 5, 6, 7, 24 OUTLIN NZYMS: Binding & Catalysis
More informationAhmad Ulnar. Faisal Nimri ... Dr.Faisal
24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of
More informationA cell has enough ATP to last for about three seconds.
Energy Transformation: Cellular Respiration Outline 1. Energy and carbon sources in living cells 2. Sources of cellular ATP 3. Turning chemical energy of covalent bonds between C-C into energy for cellular
More informationMidterm 2 Results. Standard Deviation:
Midterm 2 Results High: Low: Mean: Standard Deviation: 97.5% 16% 58% 16.3 Lecture 17 Amino Acid Metabolism Urea Cycle N and S assimilation Last cofactors: THF and SAM Dietary (Exogenous) Proteins Hydrolyzed
More informationAmino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
More informationPhenotypic analysis of primary colorectal cancer to inform the management of metastatic disease
Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease Paul Sutton CR(UK) Clinical Research Training Fellow Chester Colorectal Research Disclosures Holder of CR(UK)
More informationSeparation of Main Proteins in Plasma and Serum
BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover
More informationTala Saleh. Razi Kittaneh ... Nayef Karadsheh
Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty
More informationDepartment of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada.
Phosphoproteome dynamics of Saccharomyces cerevisiae under heat shock and cold stress Evgeny Kanshin 1,5, Peter Kubiniok 1,2,5, Yogitha Thattikota 1,3, Damien D Amours 1,3 and Pierre Thibault 1,2,4 * 1
More information