Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).

Size: px
Start display at page:

Download "Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A)."

Transcription

1 Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A). The map was generated using the reference map by KEGG. CO represents entry number of compound. Pentose and glucuronate interconversions (panel B); Starch and sucrose metabolism (panel C); Cysteine and methionine metabolism (panel D) (details in Table S1). 1

2 Fig. S2. ICA analysis of isobaric tags for relative and absolute quantitation (itraq) proteome data of alcoholic fatty liver disease. Green, control; red: 12W; 2

3 Fig. S3. An updated view of the pathway and signaling network by Gene Ontology. The differentially expressed proteins were classified among three categories: biological process (A), molecular function (B), and cellular component (C). 3

4 Fig.S4 Pathogenic mechanisms of alcoholic liver disease proposed based in animal models evidence, and p53 signaling pathway 4

5 Supplementary table 1. Result from ingenuity pathway analysis with MetPA. No. Pathway Name Total Expected Hits Raw p Impact 1 Starch and sucrose metabolism Riboflavin metabolism Nicotinate and nicotinamide metabolism Pentose and glucuronate interconversions Cysteine and methionine metabolism Arginine and proline metabolism minoacyl-trna biosynthesis Note: Total is the total number of compounds in the pathway; the Hits is the actually matched number from the user uploaded data; the Raw p is the original p value calculated from the enrichment analysis; the Impact is the pathway impact value calculated from pathway topology analysis. 5

6 Supplementary Table 2. Differentially expressed proteins in alcoholic fatty liver disease identified by itraq. No. Accession(gi) Description Score Coverage Proteins Unique Peptides PSMs AAs MW calc. C/M Peptides [kda] pi 1 P49000 Muellerian-inhibiting factor % Q68FQ0 T-complex protein 1 subunit epsilon % Q80T18 Glia maturation factor gamma % Q9JLT0 Myosin % P protein eta % Q920G0 Src kinase-associated % phosphoprotein 2 7 P58775 Tropomyosin beta chain % Q63083 Nucleobindin % Q9JK11 Reticulon % Q00715 Histone H2B type % P50115 Protein S100-A % Q kda heat- and acid-stable % phosphoprotein 13 Q5RKI1 Eukaryotic initiation factor 4A-II % P60901 Proteasome subunit alpha type % P50116 Protein S100-A % P06759 Apolipoprotein C-III % P31394 Vitamin K-dependent protein C % P28480 T-complex protein 1 subunit alpha % P18418 Calreticulin % P01015 Angiotensinogen % P24594 Insulin-like growth factor-binding % protein 5 22 P15978 Class I histocompatibility antigen, % Non-RT1.A alpha-1 chain 23 Q9WV63 Kinesin-like protein KIF2A % P85108 Tubulin beta-2a chain % P08932 T-kininogen % Q9WUK5 Inhibin beta C chain % Q62975 Protein Z-dependent protease % inhibitor 28 Q5M8C6 Fibrinogen-like protein % Q9Z244 GMP reductase % P07756 Carbamoyl-phosphate synthase % [ammonia], mitochondrial 31 P04276 Vitamin D-binding protein % P62804 Histone H % P protein beta/alpha % P25236 Selenoprotein P % Q8R2H5 Phosphatidylinositol-glycan-specific % phospholipase D 36 P24090 Alpha-2-HS-glycoprotein % P04041 Glutathione peroxidase % P26644 Beta-2-glycoprotein % P62630 Elongation factor 1-alpha % Q9EQV9 Carboxypeptidase B % P23593 Apolipoprotein D % Q63276 Bile acid-coa:amino acid N % acyltransferase 43 Q63520 Synaptonemal complex protein % P55314 Complement component C8 beta % chain 45 P05545 Serine protease inhibitor A3K % P04639 Apolipoprotein A-I % Q9QX79 Fetuin-B % P55159 Serum paraoxonase/arylesterase % P21744 Insulin-like growth factor-binding % protein 4 50 P23680 Serum amyloid P-component % O35460 Angiopoietin % Q6IFU7 Keratin, type I cytoskeletal % P48032 Metalloproteinase inhibitor % P35572 Insulin-like growth factor-binding % protein 6 55 Q64640 Adenosine kinase % P02091 Hemoglobin subunit beta % Q4FZU2 Keratin, type II cytoskeletal 6A % P10760 Adenosylhomocysteinase % P20762 Ig gamma-2c chain C region % P15473 Insulin-like growth factor-binding % protein 3 61 Q6IG04 Keratin, type II cytoskeletal % Q6IG02 Keratin, type II cytoskeletal % epidermal 63 Q4KM35 Proteasome subunit beta type % Q09429 ATP-binding cassette transporter % sub-family C member 8 65 Q63484 RAC-gamma serine/threonineprotein kinase % P59996 Proprotein convertase %

7 subtilisin/kexin type 9 67 P55797 Apolipoprotein C-IV % P01836 Ig kappa chain C region, A allele % P09034 Argininosuccinate synthase % P ketoacyl-CoA thiolase B, % peroxisomal 71 P10354 Chromogranin-A % Q6IMF3 Keratin, type II cytoskeletal % Q6IG03 Keratin, type II cytoskeletal % P05964 Protein S100-A % P08025 Insulin-like growth factor I % Q6IFW6 Keratin, type I cytoskeletal % P oxo-5-beta-steroid % dehydrogenase 78 P18757 Cystathionine gamma-lyase % Q6P6Q2 Keratin, type II cytoskeletal % Q9QZR6 Septin % P06757 Alcohol dehydrogenase % P19939 Apolipoprotein C-I % Q6IFU8 Keratin, type I cytoskeletal % P85411 Keratinocyte differentiationassociated protein % P04638 Apolipoprotein A-II %

Metabolomic Data Analysis with MetaboAnalystR

Metabolomic Data Analysis with MetaboAnalystR Metabolomic Data Analysis with MetaboAnalystR Name: guest623839008349489450 February 7, 2018 1 Background Understanding the functional importance of metabolites in untargeted metabolomics is limited due

More information

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS

SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding

More information

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with

More information

Table S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts

Table S1. CRC case Pool Control Pool Name UniProt No. FC b VIP value d Spectral Counts Spectral Counts Table S1. page 1/4 Phase 1 Exploratory Study, List of proteins identified by LC-ESI-MS/MS after 1DE separation and their relative quantitation by spectral count UniProt Entry SwissProt- CRC case Pool Control

More information

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice.

SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. SUPPLEMENTARY DATA Supplementary Figure 1. Body weight and fat mass of AdicerKO mice. Twelve week old mice were subjected to ad libitum (AL) or dietary restriction (DR) regimens for three months. (A) Body

More information

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.

More information

Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma

Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural

More information

Nitrogen Metabolism. Overview

Nitrogen Metabolism. Overview Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak

More information

Nitrogen Metabolism. Pratt and Cornely Chapter 18

Nitrogen Metabolism. Pratt and Cornely Chapter 18 Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak

More information

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan

More information

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase

Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2

More information

Biological Molecules. Carbohydrates, Proteins, Lipids, and Nucleic Acids

Biological Molecules. Carbohydrates, Proteins, Lipids, and Nucleic Acids Biological Molecules Carbohydrates, Proteins, Lipids, and Nucleic Acids Organic Molecules Always contain Carbon (C) and Hydrogen (H) Carbon is missing four electrons Capable of forming 4 covalent bonds

More information

Nitrogen Metabolism. Overview

Nitrogen Metabolism. Overview Nitrogen Metabolism Pratt and Cornely Chapter 18 Overview Nitrogen assimilation Amino acid biosynthesis Nonessential aa Essential aa Nucleotide biosynthesis Amino Acid Catabolism Urea Cycle Juicy Steak

More information

Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-120.

Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-120. Untargeted plasma and tissue metabolomics in rats with chronic kidney disease given AST-0. Thomas J Velenosi, Anzel Hennop, David A Feere, Alvin Tieu, Andrew S Kucey, Polydoros Kyriacou, Laura E McCuaig,

More information

Biochemistry 2 Recita0on Amino Acid Metabolism

Biochemistry 2 Recita0on Amino Acid Metabolism Biochemistry 2 Recita0on Amino Acid Metabolism 04-20- 2015 Glutamine and Glutamate as key entry points for NH 4 + Amino acid catabolism Glutamine synthetase enables toxic NH 4 + to combine with glutamate

More information

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000). Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in

More information

Quantitative Proteomics. Quantitative Proteomics

Quantitative Proteomics. Quantitative Proteomics Quantitative Proteomics Liwen Zhang Mass Spectrometry and Proteomics Facility The Ohio State University Summer Workshop 216 Quantitative Proteomics Quantitation in proteomics has become a popular area

More information

Protein Class/Name KEGG Pathways

Protein Class/Name KEGG Pathways Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Supplemental Table 4. Proteins Increased in Either Soil medium at 37 o C and 25 o C Table 4A. Proteins

More information

Posttranslational Modification of Proteins

Posttranslational Modification of Proteins Posttranslational Modification of Proteins Expanding Natures Inventory Christopher T. Walsh Harvard Medical School RoBERTS AND CoMPANY PuBLISHERS Englewood, Col ~1 ado,. Brief Contents Preface xv Reviewers

More information

Protein name Location Family MW (kda)

Protein name Location Family MW (kda) Supplementary Information, Table S1. Proteomic results from LC-MS/MS analysis of MC/9 exosomes. Proteins of MC/9 exosomes were collected in the stacking parts of an SDS-PAGE, cut out, trypsinated and analysed

More information

Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B

Protein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein

More information

1.4. Lipids - Advanced

1.4. Lipids - Advanced 1.4. Lipids - Advanced www.ck12.org In humans, triglycerides are a mechanism for storing unused calories, and their high concentration in blood correlates with the consumption of excess starches and other

More information

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids

the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma

More information

Dental Students Biochemistry Exam V Questions ( Note: In all cases, the only correct answer is the best answer)

Dental Students Biochemistry Exam V Questions ( Note: In all cases, the only correct answer is the best answer) Dental Students Biochemistry Exam V Questions - 2006 ( Note: In all cases, the only correct answer is the best answer) 1. Essential fatty acids are: A. precursors of biotin B. precursors of tyrosine C.

More information

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION

BIOLOGY 103 Spring 2001 MIDTERM LAB SECTION BIOLOGY 103 Spring 2001 MIDTERM NAME KEY LAB SECTION ID# (last four digits of SS#) STUDENT PLEASE READ. Do not put yourself at a disadvantage by revealing the content of this exam to your classmates. Your

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Synthesis of Fatty Acids and Triacylglycerol Lippincott s Chapter 16 Fatty Acid Synthesis Mainly in the Liver Requires Carbon Source: Acetyl CoA Reducing Power: NADPH 8 CH 3 COO C 15 H 33 COO Energy Input:

More information

Chemistry 107 Exam 4 Study Guide

Chemistry 107 Exam 4 Study Guide Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and

More information

MBBS First Professional (Part-I Examination) BIOCHEMISTRY Model Paper

MBBS First Professional (Part-I Examination) BIOCHEMISTRY Model Paper MBBS FIRST PROFESSIONAL (PART I) Biochemistry (MCQs) Maximum Marks: 35 Time Allowed: 45 minutes Q 1. What is not correct about cell membrane? A. Contains two layers of phospholipids B. May contain receptor

More information

Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds

Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed after two rounds Supplementary figure legends Supplementary Figure 1 Fah + hepatocytes in a Fah -/- mouse transplanted with sorted cells. Formalin-fixed paraffin-embedded sections of liver from a recipient mouse sacrificed

More information

Energy storage in cells

Energy storage in cells Energy storage in cells Josef Fontana EC - 58 Overview of the lecture Introduction to the storage substances of human body Overview of storage compounds in the body Glycogen metabolism Structure of glycogen

More information

SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4

SwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4 P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor

More information

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name

Validated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name 5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)

More information

NBCE Mock Board Questions Biochemistry

NBCE Mock Board Questions Biochemistry 1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation

More information

Oxidation of Long Chain Fatty Acids

Oxidation of Long Chain Fatty Acids Oxidation of Long Chain Fatty Acids Dr NC Bird Oxidation of long chain fatty acids is the primary source of energy supply in man and animals. Hibernating animals utilise fat stores to maintain body heat,

More information

GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS

GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

The three important structural features of proteins:

The three important structural features of proteins: The three important structural features of proteins: a. Primary (1 o ) The amino acid sequence (coded by genes) b. Secondary (2 o ) The interaction of amino acids that are close together or far apart in

More information

Protein Class/Name. Pathways. bat00250, bat00280, bat00410, bat00640, bat bat00270, bat00330, bat00410, bat00480

Protein Class/Name. Pathways. bat00250, bat00280, bat00410, bat00640, bat bat00270, bat00330, bat00410, bat00480 Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2017 Supplemental Table 1. Proteins Increased in Either Soil or Laboratory media Table 1A. Proteins Increased

More information

Protein Classification based upon Biological functions

Protein Classification based upon Biological functions PROTEINS (a) The light produced by fireflies is the result of a reaction involving the protein luciferin and ATP, catalyzed by the enzyme luciferase. (b) Erythrocytes contain large amounts of the oxygen-transporting

More information

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases

Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin

More information

Amino Acid Metabolism

Amino Acid Metabolism Amino Acid Metabolism Last Week Most of the Animal Kingdom = Lazy - Most higher organisms in the animal kindom don t bother to make all of the amino acids. - Instead, we eat things that make the essential

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 31 Amino Acid Synthesis 2013 W. H. Freeman and Company Chapter 31 Outline Although the atmosphere is approximately 80% nitrogen,

More information

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.

Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain

More information

Biologic Oxidation BIOMEDICAL IMPORTAN

Biologic Oxidation BIOMEDICAL IMPORTAN Biologic Oxidation BIOMEDICAL IMPORTAN Chemically, oxidation is defined as the removal of electrons and reduction as the gain of electrons. Thus, oxidation is always accompanied by reduction of an electron

More information

Lipid Metabolism. Catabolism Overview

Lipid Metabolism. Catabolism Overview Lipid Metabolism Pratt & Cornely, Chapter 17 Catabolism Overview Lipids as a fuel source from diet Beta oxidation Mechanism ATP production Ketone bodies as fuel 1 High energy More reduced Little water

More information

AMINO ACID METABOLISM

AMINO ACID METABOLISM AMINO ACID METABOLISM PHL-285 Biochemistry-2 Mahmoud N. Nagi, Ph.D. Professor of Biochemistry Overview of amino acid metabolism. Classification of amino acids. Biosynthesis of nonessential amino acids.

More information

Bio 366: Biological Chemistry II Test #1, 100 points (7 pages)

Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) Bio 366: Biological Chemistry II Test #1, 100 points (7 pages) READ THIS: Take a numbered test and sit in the seat with that number on it. Remove the numbered sticker from the desk, and stick it on the

More information

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

More information

Chapter 7 Cellular Respiration and Fermentation*

Chapter 7 Cellular Respiration and Fermentation* Chapter 7 Cellular Respiration and Fermentation* *Lecture notes are to be used as a study guide only and do not represent the comprehensive information you will need to know for the exams. Life Is Work

More information

BCM 221 LECTURES OJEMEKELE O.

BCM 221 LECTURES OJEMEKELE O. BCM 221 LECTURES BY OJEMEKELE O. OUTLINE INTRODUCTION TO LIPID CHEMISTRY STORAGE OF ENERGY IN ADIPOCYTES MOBILIZATION OF ENERGY STORES IN ADIPOCYTES KETONE BODIES AND KETOSIS PYRUVATE DEHYDROGENASE COMPLEX

More information

Oxidation and Methylation in Human Brain: Implications for vaccines

Oxidation and Methylation in Human Brain: Implications for vaccines Oxidation and Methylation in Human Brain: Implications for vaccines 1 Life can be viewed through the perspective of oxidation and reduction, which involves the loss and gain of electrons, respectively.

More information

number Done by Corrected by Doctor Faisal Al-Khatibe

number Done by Corrected by Doctor Faisal Al-Khatibe number 24 Done by Mohammed tarabieh Corrected by Doctor Faisal Al-Khatibe 1 P a g e *Please look over the previous sheet about fatty acid synthesis **Oxidation(degradation) of fatty acids, occurs in the

More information

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III

Lecture 16. Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III Lecture 16 Finish lipid metabolism (Triglycerides, Isoprenoids/Steroids, Glyoxylate cycle) Amino acid metabolism (Urea cycle) Google Man III The Powertrain of Human Metabolism (verview) CARBHYDRATES PRTEINS

More information

Mimi Roy, PhD Senior Director & Site Head Caprion Proteomics US LLC. ISBER, Orlando May 23, 2014

Mimi Roy, PhD Senior Director & Site Head Caprion Proteomics US LLC. ISBER, Orlando May 23, 2014 Controlled Analysis of Preanalytical Variables in CSF and Blood Sample Collection, Processing and Storage: Implications for Best Practices in Clinical Research Mimi Roy, PhD Senior Director & Site Head

More information

BIOL 158: BIOLOGICAL CHEMISTRY II

BIOL 158: BIOLOGICAL CHEMISTRY II BIOL 158: BIOLOGICAL CHEMISTRY II Lecture 5: Vitamins and Coenzymes Lecturer: Christopher Larbie, PhD Introduction Cofactors bind to the active site and assist in the reaction mechanism Apoenzyme is an

More information

Supporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation

Supporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,

More information

MBB 115:511 and 694:407 Final Exam Niederman/Deis

MBB 115:511 and 694:407 Final Exam Niederman/Deis MBB 115:511 and 694:407 Final Exam Niederman/Deis Tue. Dec. 19, 2006 Name Row Letter Seat Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth two points.

More information

Triose-P isomerase Enolase

Triose-P isomerase Enolase Select the single best answer. 1 onsider the catabolism of glucose to carbon dioxide and water. In this metabolic direction, which of these enzymes catalyzes a reaction where the PRUTS have one more "high-energy"

More information

MITOCW watch?v=ddt1kusdoog

MITOCW watch?v=ddt1kusdoog MITOCW watch?v=ddt1kusdoog The following content is provided under a Creative Commons license. Your support will help MIT OpenCourseWare continue to offer high-quality educational resources for free. To

More information

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc.

BIOSYNTHESIS OF FATTY ACIDS. doc. Ing. Zenóbia Chavková, CSc. BIOSYNTHESIS OF FATTY ACIDS doc. Ing. Zenóbia Chavková, CSc. The pathway for the of FAs is not the reversal of the oxidation pathway Both pathways are separated within different cellular compartments In

More information

AMINO ACID METABOLISM

AMINO ACID METABOLISM AMINO ACID METABOLISM Synthesis of Urea in Liver The series of reactions that form urea is known as the Urea Cycle or the Krebs-Henseleit Cycle. The urea cycle operates only to eliminate excess nitrogen.

More information

Systems biology approaches and pathway tools for investigating cardiovascular disease

Systems biology approaches and pathway tools for investigating cardiovascular disease Systems biology approaches and pathway tools for investigating cardiovascular disease Craig E. Wheelock 1,2*, Åsa M. Wheelock 2,3,4, Shuichi Kawashima 5, Diego Diez 2, Minoru Kanehisa 2,5, Marjan van Erk

More information

So where were we? But what does the order mean? OK, so what's a protein? 4/1/11

So where were we? But what does the order mean? OK, so what's a protein? 4/1/11 So where were we? We know that DNA is responsible for heredity Chromosomes are long pieces of DNA DNA turned out to be the transforming principle We know that DNA is shaped like a long double helix, with

More information

Dense and Dynamic Polyethylene Glycol Shells Cloak Nanoparticles. from Uptake by Liver Endothelial Cells for Long Blood Circulation

Dense and Dynamic Polyethylene Glycol Shells Cloak Nanoparticles. from Uptake by Liver Endothelial Cells for Long Blood Circulation Dense and Dynamic Polyethylene Glycol Shells Cloak Nanoparticles from Uptake by Liver Endothelial Cells for Long Blood Circulation Hao Zhou, Zhiyuan Fan, Peter Y. Li, Junjie Deng,, Dimitrios C. Arhontoulis,

More information

Supplemental Table 1 Age and gender-specific cut-points used for MHO.

Supplemental Table 1 Age and gender-specific cut-points used for MHO. Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 28 Fatty Acid Synthesis 2013 W. H. Freeman and Company Chapter 28 Outline 1. The first stage of fatty acid synthesis is transfer

More information

Amino Acid Oxidation and the Urea Cycle

Amino Acid Oxidation and the Urea Cycle Amino Acid Oxidation and the Urea Cycle Amino Acids: Final class of biomolecules whose oxidation contributes significantly to the generation of energy Undergo oxidation in three metabolic circumstances

More information

NAME KEY ID # EXAM 3a BIOC 460. Wednesday April 10, Please include your name and ID# on each page. Limit your answers to the space provided!

NAME KEY ID # EXAM 3a BIOC 460. Wednesday April 10, Please include your name and ID# on each page. Limit your answers to the space provided! EXAM 3a BIOC 460 Wednesday April 10, 2002 Please include your name and ID# on each page. Limit your answers to the space provided! 1 1. (5 pts.) Define the term energy charge: Energy charge refers to the

More information

LIPID METABOLISM

LIPID METABOLISM LIPID METABOLISM LIPOGENESIS LIPOGENESIS LIPOGENESIS FATTY ACID SYNTHESIS DE NOVO FFA in the blood come from :- (a) Dietary fat (b) Dietary carbohydrate/protein in excess of need FA TAG Site of synthesis:-

More information

f(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.

f(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31. 14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

PROTEIN METABOLISM: NITROGEN CYCLE; DIGESTION OF PROTEINS. Red meat is an important dietary source of protein nitrogen

PROTEIN METABOLISM: NITROGEN CYCLE; DIGESTION OF PROTEINS. Red meat is an important dietary source of protein nitrogen PROTEIN METABOLISM: NITROGEN CYCLE; DIGESTION OF PROTEINS Red meat is an important dietary source of protein nitrogen The Nitrogen Cycle and Nitrogen Fixation Nitrogen is needed for amino acids, nucleotides,

More information

Glycogen Metabolism Dr. Mohammad Saadeh

Glycogen Metabolism Dr. Mohammad Saadeh Glycogen Metabolism Presented by Dr. Mohammad Saadeh The requirements for the Pharmaceutical Biochemistry II Philadelphia University Faculty of pharmacy I. overview Glucose is energy source for Brain.

More information

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems

CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven

More information

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler

Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7

More information

Chapter 2. Chemical Composition of the Body

Chapter 2. Chemical Composition of the Body Chapter 2 Chemical Composition of the Body Carbohydrates Organic molecules that contain carbon, hydrogen and oxygen General formula C n H 2n O n -ose denotes a sugar molecule Supply energy Glucose Complex

More information

Amino acid metabolism I

Amino acid metabolism I Amino acid metabolism I Jana Novotná Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ. Metabolic relationship of amino acids DIETARY PROTEINS GLYCOLYSIS

More information

University of Guelph Department of Chemistry and Biochemistry Structure and Function In Biochemistry

University of Guelph Department of Chemistry and Biochemistry Structure and Function In Biochemistry University of Guelph Department of Chemistry and Biochemistry 19-356 Structure and Function In Biochemistry Final Exam, April 21, 1997. Time allowed, 120 min. Answer questions 1-30 on the computer scoring

More information

MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD

MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD MOLECULAR WEIGHT OF DIFFERENT PROTEINS PRESENT IN ZEBRAFISH EMBRYO DURING GASTRULATION PERIOD 1) 37% molecular weight of about 97KDa 2) 14.6% molecular weight of about 45 KDa 3+4) 27.4% molecular weight

More information

Jana Novotná, Bruno Sopko. Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ.

Jana Novotná, Bruno Sopko. Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ. Amino acid metabolism II. Urea cycle Jana Novotná, Bruno Sopko Department of the Medical Chemistry and Clinical Biochemistry The 2nd Faculty of Medicine, Charles Univ. Nitrogen balance Tissue proteins

More information

Supporting Information

Supporting Information Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng

More information

Disaccharides. Compound dehydration synthesis puts sugars together Hydrolysis (hydro-water, lysisbreakdown)

Disaccharides. Compound dehydration synthesis puts sugars together Hydrolysis (hydro-water, lysisbreakdown) Carbohydrate Carbo-hydrate -carbon, water Cn(H2O) n Monosaccharides Hexose hex = 6 [carbons], "-ose" means sugar Glucose monosaccaccharide usually assume a ring structure Disaccharides Compound dehydration

More information

The source of protein structures is the Protein Data Bank. The unit of classification of structure in SCOP is the protein domain.

The source of protein structures is the Protein Data Bank. The unit of classification of structure in SCOP is the protein domain. UNIT 14 PROTEINS DEFINITION A large molecule composed of one or more chains of amino acids in a specific order; the order is determined by the base sequence of nucleotides in the gene that codes for the

More information

Synthesis of Fatty Acids and Triacylglycerol

Synthesis of Fatty Acids and Triacylglycerol Fatty Acid Synthesis Synthesis of Fatty Acids and Triacylglycerol Requires Carbon Source: Reducing Power: NADPH Energy Input: ATP Why Energy? Why Energy? Fatty Acid Fatty Acid + n(atp) ΔG o : -ve Fatty

More information

CELLS. Cells. Basic unit of life (except virus)

CELLS. Cells. Basic unit of life (except virus) Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

More information

Enzyme Regulation I. Dr. Kevin Ahern

Enzyme Regulation I. Dr. Kevin Ahern Enzyme Regulation I Dr. Kevin Ahern Enzyme Regulation Mechanisms Enzyme Regulation Mechanisms 1. Allosterism Enzyme Regulation Mechanisms 1. Allosterism 2. Covalent Modification Enzyme Regulation Mechanisms

More information

Lecture 13 (10/13/17)

Lecture 13 (10/13/17) Lecture 13 (10/13/17) Reading: Ch6; 187-189, 204-205 Problems: Ch4 (text); 2, 3 NXT (after xam 2) Reading: Ch6; 190-191, 194-195, 197-198 Problems: Ch6 (text); 5, 6, 7, 24 OUTLIN NZYMS: Binding & Catalysis

More information

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal

Ahmad Ulnar. Faisal Nimri ... Dr.Faisal 24 Ahmad Ulnar Faisal Nimri... Dr.Faisal Fatty Acid Synthesis - Occurs mainly in the Liver (to store excess carbohydrates as triacylglycerols(fat)) and in lactating mammary glands (for the production of

More information

A cell has enough ATP to last for about three seconds.

A cell has enough ATP to last for about three seconds. Energy Transformation: Cellular Respiration Outline 1. Energy and carbon sources in living cells 2. Sources of cellular ATP 3. Turning chemical energy of covalent bonds between C-C into energy for cellular

More information

Midterm 2 Results. Standard Deviation:

Midterm 2 Results. Standard Deviation: Midterm 2 Results High: Low: Mean: Standard Deviation: 97.5% 16% 58% 16.3 Lecture 17 Amino Acid Metabolism Urea Cycle N and S assimilation Last cofactors: THF and SAM Dietary (Exogenous) Proteins Hydrolyzed

More information

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group

Amino acids. Side chain. -Carbon atom. Carboxyl group. Amino group PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (

More information

Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease

Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease Phenotypic analysis of primary colorectal cancer to inform the management of metastatic disease Paul Sutton CR(UK) Clinical Research Training Fellow Chester Colorectal Research Disclosures Holder of CR(UK)

More information

Separation of Main Proteins in Plasma and Serum

Separation of Main Proteins in Plasma and Serum BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover

More information

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh

Tala Saleh. Razi Kittaneh ... Nayef Karadsheh Tala Saleh Razi Kittaneh... Nayef Karadsheh β-oxidation of Fatty Acids The oxidation of fatty acids occurs in 3 steps: Step 1: Activation of the Fatty acid FA + HS-CoA + ATP FA-CoA + AMP + PPi - The fatty

More information

Department of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada.

Department of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada. Phosphoproteome dynamics of Saccharomyces cerevisiae under heat shock and cold stress Evgeny Kanshin 1,5, Peter Kubiniok 1,2,5, Yogitha Thattikota 1,3, Damien D Amours 1,3 and Pierre Thibault 1,2,4 * 1

More information