Production, Recovery and Bioequivalence of Human Insulin and other Biopharmaceuticals from Transgenic Oilseeds
|
|
- Milo Pitts
- 6 years ago
- Views:
Transcription
1 Production, Recovery and Bioequivalence of Human Insulin and other Biopharmaceuticals from Transgenic Oilseeds Translational Seed Biology: From Model Crop Systems to Crop Improvement UC Davis Symposium September 17-20, 2007 Joseph Boothe and Maurice Moloney SemBioSys Genetics Inc Calgary, Canada
2 The promise of plant made pharmaceuticals First reports of the production of mammalian proteins in plants appear in the literature in the late 1980 s Concept of Plant Molecular Farming harnessing the potential of plants as biological factories The questions: - Can it be done technically? - Will it be possible to meet pharma manufacturing standards? - Is it economically feasible?
3 Why plants? Advantages of plant systems: Higher capacity production and lower production costs for bulk protein Economical Manufacture of large volume products Seed-based expression systems: Seeds have evolved as natural storage organs with high capacity for protein Low hydrolytic environment provides for stable storage Enables production to be decoupled from processing
4 Testing and production vehicles Arabidopsis Well-characterized, model oilseed Small size and easily maintained for simplified production in growth facilities Easily transformed through floral dipping Rapid cycling: - Expression results in approximately 3 mos. - Sufficient protein for biochemical / functionality testing in 6 mos. Safflower Safflower: Carthamus tinctorius, Family: Asteraceae Origin: Central Asia Semi-arid regions of Asia, Mexico, Australia and North America Advantages for PMP production: Low production acreages (200,000 acres in N. America, forward contracted) Predominantly self-pollinating Few weedy relatives found in the Americas Poor volunteer, low seed dormancy, low vegetative dispersal
5 Targeting for optimal expression Adapted from: Figure 1.14 Biochemistry and Molecular Biology of Plants 2000; Eds., Buchanan, Gruissem, Jones
6 Seed oilbodies Cross-section of safflower seed
7 Targeting and capture of recombinant proteins on oilbodies
8 Partitioning recombinant proteins using oilbodies Coomassie Stained Protein Gel roleosin-fp Oleosins
9 Proof of Principle with Human Growth Hormone
10 Expression of hgh in Arabidopsis A MWt. (KDa) Std wt wt hgh Fusion hgh (A) Coomassie-stained SDS- PAGE of oil body preps and aqueous phase (AP) from hgh transgenic Arab. seed 10 B MWt. (KDa) Std wt wt hgh Fusion hgh (B) corresponding Western blot probed with monoclonal anti-hgh antibody
11 Characterization of seed-derived hgh N-terminal sequence analysis of product obtained from cleavage: N-terminal of hgh 4252 cleavage product 4253 cleavage product Phe-Pro-Thr-Ile-Pro Arg-Phe-Pro-Thr-Ile-Pro Gly-Ser-Phe-Pro-Thr-Ile-Pro Oilbody associated and cleaved hgh product shown to bind soluble receptor in immunofunctional assay.
12 Cumulative Weight Gain (g) Bioactivity In vivo: Growth studies in little mice Cumulative Gain - SemBioSys Study 4 (10 mice per group) Day Unmanipulated Humatrope IP Plant-derived hgh IP Sterile Water IP Recombinant plant-derived hgh delivered by intraperitoneal (IP) injection resulted in statistically significant weight gain of little mice versus control (sterile water IP) similar to results obtained with pharmaceutical grade rhgh (Humatrope).
13 hgh expression in safflower Coomassie blue stained gel of oilbody proteins from T1 safflower lines expressing rhgh.
14 Production of Human Insulin in Plants
15 Why insulin? Diabetes a global epidemic: 246 million cases (20 million in US alone, 5.1% of the population aged 20-79) Together with complications (e.g. kidney and cardio-vascular disease, blindness, amputations) constitutes one the largest health care problems in industrialized countries Need vs. Consumption: Developed world with 20% of the diabetic population consumes 70% of the world s insulin
16 Insulin volumes 16,000 kg 6,000 kg
17 Expression construct Construct LB Pha P Ins FP Pha T Ubi P PAT Ubi T RB Fusion Protein Insulin insulin expression: under β-phaseolin promoter/terminator selectable marker: pat gene under ubiquitin promoter/terminator for PPT resistance transformation: into Agrobacterium EHA101 then into the plant using the flower dipping method (Arabidopsis) or infection of explants (safflower) post-extraction maturation of insulin: functional insulin (5.7 kda) generated by in vitro processing of fusion protein
18 Insulin expression in Arabidopsis ER Apoplast Oilbodies Gel Blot Gel Blot Gel Blot Coomassie blue stained gels and western blots (anti-insulin mab) of total seed protein
19 Insulin expression in safflower Expression screen of individual T1 seeds Insulin accumulation to levels of >1% of total seed protein
20 Insulin - chemical equivalence Electrospray Mass Spectrometry Commercial pharmaceuticalgrade insulin: Molecular mass 5807 Da Safflowerderived insulin: Molecular mass 5807 Da V8 Peptide Digest
21 % Initial Blood Glucose % Maximum Bound Insulin in vitro and in vivo functionality Insulin (ng/ml) IC 50 (ng/ml) Insulin Receptor Binding Humulin-R USP Insulin Insulin (SemBioSys) Saline 80 Insulin Tolerance Test Minutes Post Injection error bars = +/- SEM
22 Scale-up ~ 1ton of seed per acre Pilot scale process
23 Regulatory framework Product regulatory: FDA and EMEA have both published guidelines on the manufacture of biologics in plants Provided established standards of quality are met there are no barriers to the approval plant-made products Challenges: e.g. dealing with variation in expression, platformspecific impurities, etc. Environmental regulatory (field production): Need to meet regulatory requirements and address public concerns regarding containment of transgenic crop through: - Judicious selection of production host - Developing and implementing rigorous procedures for field production (GMP starts in the field!!!)
24 Concluding remarks Considerable progress has been made on the technical front with the demonstration that plants can produce biopharmaceutical proteins at commercially-relevant levels With proper attention to quality there is a clear path forward for approval of these products Work is proceeding on demonstrating that plant-based systems can deliver on the economics. Product selection key: - Capitalize on the advantages of plants by focusing on high volume products where COGs is important. - Initial focus on well-characterized proteins may speed development Success will transform the way some drugs are made and offer real socio-economic benefits.
25 SemBioSys Cory Nykiforuk, Phil Kuhlman, Yin Shen (Biochemistry) Chao Jiang (Arabidopsis) Indra Harry (Safflower) Maria Meier (Molecular Characterization) Liz Murray & Amanda Bodero (Bioassays) Brent Pollock (Process Development) Rick Keon (Plant Growth Operations) University of Calgary Joe Goren (Dept. Biochemistry and Molecular Biology, Medicine) Doug Morck (Dept. Biological Sciences, Science / Veterinary Medicine)
Nature Methods: doi: /nmeth Supplementary Figure 1
Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated
More informationComparability of Insulins Produced by Second Generation Processes
Comparability of Insulins Produced by Second Generation Processes WCBP 2009 Lene Hørlyck Novo Nordisk A/S Slide no 2 Novo Nordisk at a glance More than 25,500 employees in 80 countries A world leader in
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationTesting the ABC floral-organ identity model: expression of A and C function genes
Objectives: Testing the ABC floral-organ identity model: expression of A and C function genes To test the validity of the ABC model for floral organ identity we will: 1. Use the model to make predictions
More informationCell wall components:
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. The Cell Wall The primary cell wall is capable of rapid expansion during
More informationMain differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure.
Main differences between plant and animal cells: Plant cells have: cell walls, a large central vacuole, plastids and turgor pressure. Animal cells have a lysosome (related to vacuole) and centrioles (function
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 4 Protein Sequence
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 4 Protein Sequence 2 3 4 Are You Getting It?? A molecule of hemoglobin is compared with a molecule of lysozyme. Which characteristics do they share?
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
More informationOncology Program. Chlorotoxin Technology Platform. Corporate Partnering Opportunities
TransMolecular, Inc. A Neuroscience Biotechnology Company Oncology Program Chlorotoxin Technology Platform Corporate Partnering Opportunities Background TransMolecular, Inc. (TMI) is a neuroscience biotechnology
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationBiomarkers of Pancreatic -cell Mass, Function, and Diabetes Treatment Selection
Biomarkers of Pancreatic -cell Mass, Function, and Diabetes Treatment Selection Creative Partnerships in Biopharmaceutical Research CQDM / Montreal in vivo Meeting 8 June, 2009 1 THE TEAM Marc Prentki
More informationLinnaeus Plant Sciences. Optimizing Oil Seed Potential for Industrial Applications
Linnaeus Optimizing Oil Seed Potential for Industrial Applications Jack Grushcow www.linnaeus.net Overview Plant Bio-technology overview Castor Case Study HFY Applications Production Issues Future Directions
More informationAmino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
More informationExpression constructs
Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression
More informationStructural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB
Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,
More informationOutline. Ø Standard Recommendations. Ø Minimum / Optimal / Maximum CONFUSION? Ø Quality Ø Impact of Shifting from Animal to Plant-Based Proteins
Protein 101 Outline Ø Standard Recommendations Ø Minimum / Optimal / Maximum CONFUSION? Ø Quality Ø Impact of Shifting from Animal to Plant-Based Proteins Dietary Reference Intakes (DRI) Dietary Guidelines
More informationRecombinant Trypsin, Animal Origin Free
Recombinant Trypsin, Animal Origin Free PRODUCT INFORMATION: BioGenomics r-trypsin powder is ready to use, animal origin free optimized for cell culture applications. It is derived by r-dna technology.
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationDear Valuable Readers, Thank you for the support
Newsletter Dear Valuable Readers, Inside the issue- Message from the promoter Directors PSA-Glycan YBL-Top Renal Markers Our upcoming Products CA 15-3 Validation reports Welcome to our second newsletter
More informationab Dipeptidyl peptidase IV (DPP4) Inhibitor Screening Assay Kit
ab133081 Dipeptidyl peptidase IV (DPP4) Inhibitor Screening Assay Kit Instructions for Use For screening DPP4 inhibitors. This product is for research use only and is not intended for diagnostic use. 1
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationBASF Plant Science Amflora Facts. Content
BASF Plant Science Amflora Facts October 29, 2009 Dr. Ralf-Michael Schmidt Phone: +49 621-60-28183 Fax: +49 621-60-28685 ralf-michael.schmidt@basf.com Content page 1. Background information "Amflora a
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Folate stability in GA9.15
Supplementary Figure 1 Folate stability in GA9.15 Total folate levels in GA9.15 until 7 months of storage at 28 C. Seeds of the sixth (T5) generation (upon harvest stored at -80 C) were used to confirm
More informationGuar: a potential alternate crop in New Mexico
Guar: a potential alternate crop in New Mexico The New Mexico Sustainable Agriculture Conference December 13, 2017 Los Lunas, NM Kulbhushan Grover Plant and Environmental Sciences Department New Mexico
More informationAFRICAN AND BLACK DIASPORA GLOBAL NETWORK ON HIV AND AIDS ABDGN AIDS 2012 HIGHLIGHTS
AFRICAN AND BLACK DIASPORA GLOBAL NETWORK ON HIV AND AIDS ABDGN AIDS 2012 HIGHLIGHTS AGENDA Brief overview of ABDGN HIV and Migration Affiliated Event Black Diaspora Regional Working Group Black Diaspora
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationAre seed proteins a problem or a boon?
Are seed proteins a problem or a boon?, Biochemist Department of AgriFood Molecular Sciences Faculty of Agriculture University of Milan, Italy Main sources Production Concluding remarks Seed proteins Protein
More informationDECISION DOCUMENT. Food and Feed Safety Assessment of Soybean Event MON x MON (OECD: MON-877Ø1-2 x MON )
DECISION DOCUMENT Food and Feed Safety Assessment of Soybean Event MON 87701 x MON 89788 (OECD: MON-877Ø1-2 x MON- 89788-1) Directorate of Agrifood Quality Office of Biotechnology and Industrialized Agrifood
More informationThe Structure and Function of Large Biological Molecules Part 4: Proteins Chapter 5
Key Concepts: The Structure and Function of Large Biological Molecules Part 4: Proteins Chapter 5 Proteins include a diversity of structures, resulting in a wide range of functions Proteins Enzymatic s
More informationVENTURA COMMODITIES PVT.LTD. BRIEF REPORT ON CASTORSEED AND CASTOR OIL
VENTURA COMMODITIES PVT.LTD. BRIEF REPORT ON CASTORSEED AND CASTOR OIL CASTOR SEED INTRODUCTION Castor (Ricinus communis L.) is cultivated around the world because of the commercial importance of its oil.
More informationAmylin Pharmaceuticals: Creating Value as a Leader in the Treatment of Diabetes
Amylin Pharmaceuticals: Creating Value as a Leader in the Treatment of Diabetes Daniel M. Bradbury President & Chief Executive Officer JPMorgan Healthcare Conference January 12, 2009 Safe Harbor Statement
More informationMedicinal Marijuana Forum Mona School of Business & Management Aug. 30 th, Kamau Chionesu
Medicinal Marijuana Forum Mona School of Business & Management Aug. 30 th, 2017 Kamau Chionesu kamau.chionesu02@uwimona.edu.jm Questions 1. What are the likely key requirements for successful participation
More informationQuality and yield of Indian mustard genotypes as influenced by different fertility levels
Quality and yield of Indian mustard genotypes as influenced by different fertility levels R.S.Banga, Kamal Dhawan and Dhiraj Singh Oilseeds Section, Department of Plant Breeding, CCS Haryana Agricultural.University,
More informationShaping our future: a call to action to tackle the diabetes epidemic and reduce its economic impact
Shaping our future: a call to action to tackle the diabetes epidemic and reduce its economic impact Task Force for the National Conference on Diabetes: The Task Force is comprised of Taking Control of
More informationChemical Biology, Option II Mechanism Based Proteomic Tagging Case History CH1
Proteome Wide Screening of Serine Protease Activity Proc Natl Acad Sci 1999, 97, 14694; Proteomics 2001, 1, 1067; Proc Natl Acad Sci 2002, 99, 10335; Biochemistry 2001, 40, 4005; J. Am. Chem. Soc., 2005,
More informationAmino acid composition and mineral bioavailability: Important feed quality traits in cereals
Amino acid composition and mineral bioavailability: Important feed quality traits in cereals Preben Bach Holm University of Aarhus Faculty of Agricultural Sciences Department of Genetics and Biotechnology
More informationADM to Acquire Neovia and Probiotics International Limited. July 2, 2018
ADM to Acquire Neovia and Probiotics International Limited July 2, 2018 Safe Harbor Statement 2 Some of our comments constitute forward-looking statements that reflect management s current views and estimates
More informationCONSIDERATIONS IN PROTEIN INGREDIENT USE: THE IMPACT OF PROCESSING AND MOLECULAR INTERACTIONS
CONSIDERATIONS IN PROTEIN INGREDIENT USE: THE IMPACT OF PROCESSING AND MOLECULAR INTERACTIONS Baraem (Pam) Ismail Associate Professor Department of Food Science and Nutrition University of Minnesota May
More informationSENATE BILL No. 676 AMENDED IN SENATE APRIL 28, 2011 AMENDED IN SENATE MARCH 31, Introduced by Senator Leno.
AMENDED IN SENATE APRIL, 0 AMENDED IN SENATE MARCH, 0 SENATE BILL No. Introduced by Senator Leno February, 0 An act to add Division (commencing with Section 000) to the Food and Agricultural Code, and
More informationAbout the Kits...2 Description 2 Components 3 Storage 3. Factors That Influence Factor Xa Activity... 4
Novagen User Protocol TB205 Rev. C 0107 1 of 9 Factor Xa Kits Table of Contents About the Kits...2 Description 2 Components 3 Storage 3 Factors That Influence Factor Xa Activity... 4 Factor Xa Cleavage...5
More informationMonsanto s s Pipeline for Biotech Crops. Vice President, Consumer Traits Monsanto Company
Monsanto s s Pipeline for Biotech Crops David M Stark Ph D David M. Stark, Ph.D. Vice President, Consumer Traits Monsanto Company 2 3 850+ million hungry grain consumption has exceeded production 7/10
More informationImportant Notices. BASIS CPD Points PN/50971/1516/g
Chilli pepper results May 2016 1 Important Notices BASIS CPD Points PN/50971/1516/g This document is produced for information only and not in connection with any specific or proposed offer (the Offer )
More information1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled
Protein Targeting Objectives 1. to understand how proteins find their destination in prokaryotic and eukaryotic cells 2. to know how proteins are bio-recycled As a protein is being synthesized, decisions
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationHELPING THE WORLD WORK. DUST METAL OXIDE FINES USZINC.com
HELPING THE WORLD WORK DUST METAL OXIDE FINES USZINC.com Headquartered in Houston, Texas for more than 65 years, U.S. Zinc has grown into the premier global leader in the added value zinc products market.
More informationFor personal use only
AusCann Makes Major Progress Towards Production of Cannabinoid Medicines During FY18 Highlights Undertook comprehensive pharmaceutical development project to create an optimal dosage form cannabinoid medicine
More informationPEP Review BIO-BASED ISOPRENE By Sudeep Vaswani (December 2011)
PEP Review 2011-09 BIO-BASED ISOPRENE By Sudeep Vaswani (December 2011) ABSTRACT Isoprene is an essential starting material for a variety of synthetic polymers, most notably synthetic rubbers. A major
More informationA Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS
A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationBiochemistry 2 Recita0on Amino Acid Metabolism
Biochemistry 2 Recita0on Amino Acid Metabolism 04-20- 2015 Glutamine and Glutamate as key entry points for NH 4 + Amino acid catabolism Glutamine synthetase enables toxic NH 4 + to combine with glutamate
More informationThe Structure and Func.on of Macromolecules Proteins GRU1L6
The Structure and Func.on of Macromolecules Proteins GRU1L6 Proteins Proteins Most structurally & functionally diverse group Function: involved in almost everything enzymes (pepsin, DNA polymerase) structure
More informationPractical application of analytical tools for characterization of an impurity-related particle formation mechanism
Practical application of analytical tools for characterization of an impurity-related particle formation mechanism Jared S. Bee, Ph.D. Protein aggregation measurement in biotherapeutics Maryland Center
More informationCHAPTER 5 RESULTS Previous study: cell culture and organotypical slices
45 CHAPTER 5 RESULTS 5.1. Previous study: cell culture and organotypical slices Initial experiments have been conducted to ensure that the tet-on system works. A neuronal cell culture from mice expressing
More informationNutrient digestibility in canola meal for broilers: Effects of oil extraction method and fractionation by air classification
Nutrient digestibility in canola meal for broilers: Effects of oil extraction method and fractionation by air classification Matt Oryschak *1, Doug Korver 2 and Eduardo Beltranena 1,2 1 Alberta Agriculture
More informationLife Sciences METABOLISM. Transform Your Metabolic Research
METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationInsulin mrna to Protein Kit
Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Student Handout www.3dmoleculardesigns.com Insulin mrna to Protein Kit Contents Becoming Familiar with the Data...
More informationLC-MS/MS for the quantification of Peptide biomarker and mixture of closely related Protein in formulation
EUROPEAN BIOANALYSIS FORUM Barcelona, November 14-16, 2012 LC-MS/MS for the quantification of Peptide biomarker and mixture of closely related Protein in formulation Luc-Alain SAVOY CONTENT Part I: SGS
More informationLeader in custom manufacturing. for the pharmaceutical and nutraceutical industries.
Leader in custom manufacturing for the pharmaceutical and nutraceutical industries. Since its inception in April 1994, Viva Pharmaceutical Inc. has built a reputation as a leading manufacturer committed
More informationLYGUS BUG MANAGEMENT IN SEED ALFALFA. Eric T. Natwick and M. Lopez 1 ABSTRACT
LYGUS BUG MANAGEMENT IN SEED ALFALFA Eric T. Natwick and M. Lopez 1 ABSTRACT Lygus bugs, Lygus spp., are a common pest of alfalfa grown for seed in California. Alfalfa seed producers and their pest control
More informationSupplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
More informationISPM No. 9 GUIDELINES FOR PEST ERADICATION PROGRAMMES (1998)
ISPM No. 9 INTERNATIONAL STANDARDS FOR PHYTOSANITARY MEASURES ISPM No. 9 GUIDELINES FOR PEST ERADICATION PROGRAMMES (1998) Produced by the Secretariat of the International Plant Protection Convention FAO
More informationProgram Growth. Colorado s Industrial Hemp Program Update Aug 15,2017 National Plant Board Meeting. Year Registered Land Area Harvest
Program Growth Colorado s Industrial Hemp Program Update Aug 15,2017 National Plant Board Meeting Year Registered Land Area Harvest Resources Utilized Colorado s Industrial Hemp Program is a part of the
More informationPlant tissue extraction kit. For extraction of soluble protein and other biomolecules and metabolites from plant tissues.
ab206999 Plant tissue extraction kit Instructions for use: For extraction of soluble protein and other biomolecules and metabolites from plant tissues. This product is for research use only and is not
More informationSTRATEGIES FOR SUSTAINING EXPOSURE OF PEPTIDE THERAPEUTICS: CASE STUDIES
STRATEGIES FR SUSTAINING EXPSURE F PEPTIDE THERAPEUTICS: CASE STUDIES ASIA TIDES KYT JAPAN 23 FEBRUARY 2017 CHRISTPHER A. RHDES, PH.D. PRESENTATIN UTLINE Delivery Technologies for Sustained Exposure of
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationPlant Cell Biology; Identification and manipulation of plant quality traits
Plant Cell Biology; Identification and manipulation of plant quality traits Phil Morris, Mark Robbins, Joe Gallagher and Ana Winters Mechanisms of protein protection in forages 30 Determining the constraints
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationFigure S1. Effect of bafilomycin on EGF-induced Akt and Erk signaling. Effect of chloroquine on EGF-stimulated mtorc1, Akt and Erk
EGF induced VATPase assembly and mtorc1 activation Supplemental Information Supplemental Figure Legends Figure S1. Effect of bafilomycin on EGFinduced Akt and Erk signaling. A. Hepatocytes were treated
More informationAlgal Biofuels Research: Using basic science to maximize fuel output. Jacob Dums, PhD candidate, Heike Sederoff Lab March 9, 2015
Algal Biofuels Research: Using basic science to maximize fuel output Jacob Dums, PhD candidate, jtdums@ncsu.edu Heike Sederoff Lab March 9, 2015 Outline Research Approach Dunaliella Increase Oil Content
More informationMoorpark College Chemistry 11 Fall Instructor: Professor Gopal. Examination # 5: Section Five May 7, Name: (print)
Moorpark College Chemistry 11 Fall 2013 Instructor: Professor Gopal Examination # 5: Section Five May 7, 2013 Name: (print) Directions: Make sure your examination contains TEN total pages (including this
More information8. Maring Fag Dag. - Using marine offcuts to penetrate the high value nutrition market. 29. November 2012
8. Maring Fag Dag - Using marine offcuts to penetrate the high value nutrition market 29. November 2012 Hofseth BioCare overveiw - From off cuts to premium ingredients Roots go back to 2000 Significant
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationManaging cost considerations and access to technology for cost effective vaccine manufacture in developing countries.
Managing cost considerations and access to technology for cost effective vaccine manufacture in developing countries. Amol R. Dindokar Serum Institute of India ltd. Overview Disease Control Priorities
More informationTRANSFORMATIONS IN THE FOOD INDUSTRY: REDUCING TRANS FAT IN THE DIET. Robert M. Reeves, President Institute of Shortening and Edible Oils
Agricultural Outlook Forum 2005 Presented Thursday, February 24, 2005 TRANSFORMATIONS IN THE FOOD INDUSTRY: REDUCING TRANS FAT IN THE DIET Robert M. Reeves, President Institute of Shortening and Edible
More informationInternational Partnership for Microbicides. Microbicides: New HIV Protection for Women Global Diseases: Voices from the Vanguard
International Partnership for Microbicides Microbicides: New HIV Protection for Women Global Diseases: Voices from the Vanguard Dr. Zeda Rosenberg February 20, 2007 The Face of HIV Globally Increasingly
More informationThe science behind generic drugs
The science behind generic drugs Are generics manufactured to the same high quality standards? Are generics equivalent to the pioneer? Do pioneer drugs go through more testing? Should I feel confident
More informationSchwarz et al. Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis
Schwarz et al Activity-Dependent Ubiquitination of GluA1 Mediates a Distinct AMPAR Endocytosis and Sorting Pathway Supplemental Data Supplemental Fie 1: AMPARs undergo activity-mediated ubiquitination
More informationDiabetic Retinopathy Position Paper SightFirst Long Range Planning (SFLRP) Working Group August 2008
Diabetic Retinopathy Position Paper SightFirst Long Range Planning (SFLRP) Working Group August 2008 Introduction The mission of the Lions SightFirst program is to support the development of comprehensive
More informationQuantitative LC-MS/MS Analysis of Glucagon. Veniamin Lapko, Ph.D June 21, 2011
Quantitative LC-MS/MS Analysis of Glucagon Veniamin Lapko, Ph.D June 21, 2011 Contents Comparison with small molecule LC-MS/MS LC-MS/MS sensitivity of peptides detection Stability: neat vs. matrix solutions
More informationMULTI-NUTRIENT FERTILIZER DEMAND IN LATIN AMERICA
MULTI-NUTRIENT FERTILIZER DEMAND IN LATIN AMERICA poly4.com siriusminerals.com MEETING THE CHALLENGE OF NUTRIENT DEFICIENCIE is a naturally-occurring, low-chloride, multi-nutrient fertilizer. It includes
More informationENKORTEN metenkefalin + tridecactide
metenkefalin + tridecactide A novel drug with immunomodulatory and anti-inflammatory activity : two endogenous immunomodulatory neuropeptides Combination of two neuropeptides, metenkefalin and tridecactide
More informationNATIONAL RENDERERS ASSOCIATION, Inc.
NATIONAL RENDERERS ASSOCIATION, Inc. 22A, Circle Tower, 28 Tang Lung St., Causeway Bay, Hong Kong Tel:(852)2890-2529 Fax:(852)2576-8045 Email:nrahkg@nrahongkong.com.hk Effect of replacement of fish meal
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationGrowth Factors. BIT 230 Walsh Chapter 7
Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of
More informationIntroduction to Avian Influenza
Introduction to Avian Influenza David L. Suarez D.V.M., Ph.D. Research Leader Exotic and Emerging Avian Viral Disease Research Unit Agricultural Research Service United States Department of Agriculture
More informationCOOPERATIVE EXTENSION UNIVERSITY OF CALIFORNIA, DAVIS
UC CE COOPERATIVE EXTENSION UNIVERSITY OF CALIFORNIA, DAVIS Dried Corn Distillers Grains in Dairy Cattle Feeding Part 2 Nutrient Profiles, Variability and Key Impacts on Cattle P.H. Robinson Cooperative
More informationDECISION DOCUMENTAL. Food and feed safety assessment of maize event MIR604 OECD: SYN-IR6Ø4-5. Directorate of Agrifood Quality
DECISION DOCUMENTAL Food and feed safety assessment of maize event MIR604 OECD: SYN-IR6Ø4-5 Directorate of Agrifood Quality Office of Biotechnology and Industrialized Agrifood Products INDEX SUMMARY AND
More informationProtein Safety Assessments Toxicity and Allergenicity
Protein Safety Assessments Toxicity and Allergenicity Laura Privalle, Ph.D. BAYER CropScience HESI PATC ILSI IFBiC September 20, 2013 Biotechnology is an Extension of Traditional Plant Breeding TRADITIONAL
More informationTable S1. Sequence of human and mouse primers used for RT-qPCR measurements.
Table S1. Sequence of human and mouse primers used for RT-qPCR measurements. Ca9, carbonic anhydrase IX; Ndrg1, N-myc downstream regulated gene 1; L28, ribosomal protein L28; Hif1a, hypoxia inducible factor
More informationWhat's Needed to Fix the American Diet? Antioxidant Capacity of Foods. Antioxidant Capacity of Foods. Meeting Antioxidant Needs
FOOD QUALITY and Why Food Quality Matters WHY IT MATTERS Chuck Benbrook The Organic Center Troy, OR Farming for Food Quality Symposium Tilth Producers of Washington and Americans are overfed and undernourished
More informationRequest for Letters of Intent. International Development of H5N1 Influenza Vaccines
Request for Letters of Intent International Development of H5N1 Influenza Vaccines The World Health Organization (WHO) intends to provide funding to developing (1) country vaccine manufacturers to develop
More informationPersonal Care. Product Portfolio
Personal Care Product Portfolio Kemin Personal Care, Naturals in the Field Choosing natural ingredients for your products should be achievable without compromise. At Kemin, the relentless search for solutions
More information