VALIDATION DATA. Multiplex CVD II 96 96

Size: px
Start display at page:

Download "VALIDATION DATA. Multiplex CVD II 96 96"

Transcription

1 VALIDATION DATA Multiplex CVD II 96 96

2 Table of contents 1. INTRODUCTION Technology Quality Controls Data analysis 3 2. PERFORMANCE CHARACTERISTICS Sample types Analytical Measurement 4 Detection limit 4 High dose hook effect 4 Measuring range Precision 8 Repeatability 8 Reproducibility Analytical Specificity 8 Assay readout specificity 8 Endogenous interference Scalability 9 3. REFERENCES 10 TECHNICAL SUPPORT For technical support, please contact us at support@olink.com or

3 1. Introduction Proseek Multiplex CVD II is a reagent kit measuring 92 cardiovascular disease (CVD) related human protein biomarkers simultaneously. The analytical performance of the product has been carefully validated and the results are presented below. 1.1 TECHNOLOGY The Proseek Multiplex reagents are based on the Proximity Extension Assay (PEA) technology 1-2, where 92 oligonucleotide labeled antibody probe pairs are allowed to bind to their respective target protein present in the sample. A PCR reporter sequence is formed by a proximity dependent DNA polymerization event, amplified, and subsequently detected and quantified using real-time PCR. The assay is performed in a homogeneous 96 well format without any need for washing steps, see Figure QUALITY CONTROLS Internal and external controls have been developed by Olink for data normalization and quality control purposes. These controls have been designed to enable monitoring of the technical assay performance, as well as the quality of individual samples, providing information at each step of the Proseek Multiplex protocol (see Figure 1). The internal controls are added to each sample and include two Immunoassay controls, one Extension control and one Detection control. The Immunoassay controls (two non-human proteins) monitor all three steps starting with the immunoreaction. The Extension Control (an antibody linked to two matched oligonucleotides for immediate proximity independent of antigen binding) monitors the extension and readout steps and is used for data normalization across samples. Finally, the Detection control (a synthetic double-stranded template) monitors the readout step. Samples for which one or more of the internal control values deviate from a pre-determined range will be flagged and may be removed before statistical analysis. An external control, inter-plate control (IPC), is included on each plate and used in a second normalization step. This control is made up of a pool of probes similar to the Extension control (Ext Ctrl), but generated with 92 matching oligonucleotide pairs. Furthermore, the improves inter-assay precision and allows for optimal comparison of data derived from multiple runs. The term Normalized Protein expression (NPX) refers to normalized data as described above. 1.3 DATA ANALYSIS Data analysis was performed by employing a preprocessing normalization procedure. For each sample and data point, the corresponding Cq-value for the Extension control was substracted, thus normalizing for technical variation within one run. Normalization between runs is then performed for each assay by substracting the corresponding dcq-value for the Interplate Control (IPC) from the dcq-values generated. In the final step of the pre-processing procedure the values are set relative to a correction factor determined by Olink. The generated Normalized Protein expression (NPX) unit is on a log2 scale where a larger number represents a higher protein level in the sample, typically with the background level at around zero. Linearization of data is performed by the mathematical operation 2^NPX. Coefficient of variation (CV) calculations were performed on linearized values. IMMUNOASSAY Allow the 92 antibody probe pairs to bind to their respective proteins in your samples. EXTENSION Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. DETECTION Quantify each biomarker s DNA reporter using high throughput real-time qpcr. Immunoassay control Extension control Detection control Fig 1. Proseek Multiplex assay procedure (above) and controls (below). The internal controls enables monitoring of the three core steps in the Proseek Multiplex assay and used for quality control and data normalization. Read out is performed by using the Fluidigm Biomark or the Fluidigm Biomark HD system. Proseek Multiplex CVD II Validation Data 3

4 2. Performance characteristics 2.1 SAMPLE TYPES The ability to use different sample types was evaluated with Proseek Multiplex CVD II by collecting matched serum, EDTA, acid citrate dextrose (ACD), and sodium heparin plasma samples from 4 healthy individuals. Table 1 summarizes response values for 20 normal EDTA plasma samples expressed in NPX, as well as relative differences compared to EDTA plasma. Variations observed between responses in heparin, citrate plasma and serum, as compared to EDTA plasma, were generally small, and all assays will therefore function without limitation in these sample types. 2.2 ANALYTICAL MEASUREMENT DETECTION LIMIT Calibrator curves were determined for 91 out of 92 biomarkers simultaneously in a multiplex format. One protein biomarker (NEMO) lacked accessible recombinant antigen. Limit of detection (LOD) was defined as 3 standard deviations above background and reported in pg/ml for all assays where recombinant protein antigen was available, see Table 1 and Figure 2. A) B) NPX NPX LOD: pg/ml LLOQ: pg/ml ULOQ: pg/ml Hook: pg/ml Range: 2.11 log10 ADM LLOQ LOD: 0.48 pg/ml LLOQ: 0.48 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 5.12 log10 Concentration (pg/ml) IL-18 ULOQ ULOQ LOD HIGH DOSE HOOK EFFECT The high dose hook effect is a state of antigen excess relative to the reagent antibodies, resulting in falsely lower values. In such cases, a significantly lower value can be reported which leads to misinterpretation of results. Therefore, the hook effect was determined for each analyte, here reported in pg/ml for 91 out of 92 assays, see Table 1. C) 4 2 LLOQ LOD Concentration (pg/ml) 18 MMP-7 MEASURING RANGE The analytical measuring range was defined by the lower limit of quantification (LLOQ) and upper limit of quantification (ULOQ) and reported in order of log10, see Table 1. The upper and lower limits of quantification, ULOQ and LLOQ, respectively were calculated with the following trueness and precision criteria; relative error 30% and CV 30%, of backcalculated values, and reported in pg/ml, see Table 1. Three assays with their analytical data are shown in Figure 2 and the distribution of measuring ranges of 90 assays and endogenous plasma levels are shown in Figure 3. Separate calibrator curves established for each assay may be viewed at NPX LOD: 7.63 pg/ml LLOQ: 7.63 pg/ml ULOQ: pg/ml Hook: pg/m Range: 3.61 log10 LLOQ ULOQ LOD Concentration (pg/ml) Fig 2. Calibrator curves from 3 assays and their corresponding analytical measurement data. 4 Proseek Multiplex CVD II Validation Data

5 GT ITGB1BP2 DECR1 LEP ADM AGRP PD-L2 CTSL1 STK4 BNP PIgR MERTK SLAMF7 ANG-1 CEACAM8 HAOX1 TNFRSF13B ADAM-TS13 THBS2 SOD2 SORT1 FGF-21 FGF-23 XCL1 PARP-1 HSP 27 IL27-A IL1RL2 DCN PAR-1 THPO PAPPA CD84 SPON2 VEGF-D Protein BOC TGM2 PDGF subunit B MARCO VSIG2 GDF-2 IL16 IgG Fc receptor II-b RAGE MMP-12 CD4 Dkk-1 Gal-9 ACE2 PRELP SRC SERPINA12 CXCL1 TIE2 hoscar TM IL-4RA HO-1 REN MMP-7 PSGL-1 IL-1ra CTRC TNFRSF10A IL-17D BMP-6 FS PRSS27 SCF PTX3 KIM-1 GH CCL17 IDUA LPL GLO1 LOX-1 TNFRSF11A CD40-L CA5A IL-18 PlGF GIF HB-EGF CCL3 TF PRSS8 IL-6 TRAIL-R2 FABP Protein concentration (pg/ml) Fig 3. Distribution of analytical measuring range, defined by the lower and upper limits of quantification (LLOQ-ULOQ), and normal plasma levels for 90 out of 92 analytes. Proseek Multiplex CVD II Validation Data 5

6 Table 1. Sample Types; Normalized Protein expression (NPX), Endogenous Interference, Analytical Measurement; Limit of Detection (LOD), Lower Limit of Quantification (LLOQ), Upper Limit of Quantification (ULOQ), High Dose Effect (Hook), Range and Precision indicative of assay performance are shown for 92 analytes. Not available, NA Sample types Endogenous Interference Analytical measurement Precision Normal plasma levels (NPX) Relative to EDTA plasma (%) (mg/ml) pg/ml log10 % CV Target UniProt No 10th %tile Median 90th %tile ACD Heparin Serum Haemolysate LOD LLOQ ULOQ Hook Range Intra Inter ADM (ADM) P ,4-dienoyl-CoA reductase, mitochondrial (DECR1) A disintegrin and metalloproteinase with thrombospondin motifs 13 (ADAM-TS13) Q Q76LX Agouti-related protein (AGRP) O Alpha-L-iduronidase (IDUA) P Angiopoietin-1 (ANG-1) Q Angiopoietin-1 receptor (TIE2) Q Angiotensin-converting enzyme 2 (ACE2) Q9BYF Bone morphogenetic protein 6 (BMP-6) P Brother of CDO (Protein BOC) Q9BWV Carbonic anhydrase 5A, mitochondrial (CA5A) Carcinoembryonic antigenrelated cell adhesion molecule 8 (CEACAM8) P P Cathepsin L1 (CTSL1) P C-C motif chemokine 17 (CCL17) Q C-C motif chemokine 3 (CCL3) P CD40 ligand (CD40-L) P Chymotrypsin C (CTRC) Q C-X-C motif chemokine 1 (CXCL1) P Decorin (DCN) P Dickkopf-related protein 1 (Dkk-1) O Fatty acid-binding protein, intestinal (FABP2) P Fibroblast growth factor 21 (FGF-21) Q9NSA Fibroblast growth factor 23 (FGF-23) Q9GZV Follistatin (FS) P Galectin-9 (Gal-9) O Gastric intrinsic factor (GIF) P Gastrotropin (GT) P Growth hormone (GH) P Growth/differentiation factor 2 (GDF-2) Q9UK Heat shock 27 kda protein (HSP 27) P Heme oxygenase 1 (HO-1) P Hydroxyacid oxidase 1 (HAOX1) Q9UJM Interleukin-1 receptor antagonist protein (IL-1ra) P Interleukin-1 receptor-like 2 (IL1RL2) Q9HB Interleukin-17D (IL-17D) Q8TAD Interleukin-18 (IL-18) Q Interleukin-27 (IL27) Interleukin-4 receptor subunit alpha (IL-4RA) Q8NEV9 Q P Interleukin-6 (IL-6) P Lactoylglutathione lyase (GLO1) Q Lectin-like oxidized LDL receptor 1 (LOX-1) P Leptin (LEP) P Lipoprotein lipase (LPL) P Low affinity immunoglobulin gamma Fc region receptor II-b (IgG Fc receptor II-b) P Lymphotactin (XCL1) P Macrophage receptor MARCO (MARCO) Q9UEW Matrix metalloproteinase-12 (MMP-12) P Matrix metalloproteinase-7 (MMP-7) P Proseek Multiplex CVD II Validation Data

7 Sample types Endogenous Interference Analytical measurement Precision Normal plasma levels (NPX) Relative to EDTA plasma (%) (mg/ml) pg/ml log10 % CV Target UniProt No 10th %tile Median 90th %tile ACD Heparin Serum Haemolysate LOD LLOQ ULOQ Hook Range Intra Inter Melusin (ITGB1BP2) Q9UKP Natriuretic peptides B (BNP) P16860 NA NA NA NA NA NA NA NA NA NF-kappa-B essential modulator (NEMO) Q9Y6K NA NA NA NA NA Osteoclast-associated immunoglobulinlike receptor (hoscar) Q8IYS Pappalysin-1 (PAPPA) Q NA Pentraxin-related protein PTX3 (PTX3) P Placenta growth factor (PlGF) P Platelet-derived growth factor subunit B (PDGF subunit B) P Poly [ADP-ribose] polymerase 1 (PARP-1) P NA NA Polymeric immunoglobulin receptor (PIgR) Programmed cell death 1 ligand 2 (PD-L2) Proheparin-binding EGF-like growth factor (HB-EGF) P Q9BQ Q Pro-interleukin-16 (IL16) Q Prolargin (PRELP) P Prostasin (PRSS8) Q Protein AMBP (AMBP) P Proteinase-activated receptor 1 (PAR-1) P Protein-glutamine gammaglutamyltransferase 2 (TGM2) Proto-oncogene tyrosine-protein kinase Src (SRC) P P P-selectin glycoprotein ligand 1 (PSGL-1) Q Receptor for advanced glycosylation end products (RAGE) Q Renin (REN) P Serine protease 27 (PRSS27) Q9BQR Serine/threonine-protein kinase 4 (STK4) Q Serpin A12 (SERPINA12) Q8IW SLAM family member 5 (CD84) Q9UIB SLAM family member 7 (SLAMF7) Q9NQ Sortilin (SORT1) Q Spondin-2 (SPON2) Q9BUD Stem cell factor (SCF) P Superoxide dismutase [Mn], mitochondrial (SOD2) P Kidney injury molecule 1 (KIM-1) Q96D T-cell surface glycoprotein CD4 (CD4) P Thrombomodulin (TM) P Thrombopoietin (THPO) P Thrombospondin-2 (THBS2) P Tissue factor (TF) P TNF-related apoptosis-inducing ligand receptor 2 (TRAIL-R2) Tumor necrosis factor receptor superfamily member 10A (TNFRSF10A) Tumor necrosis factor receptor superfamily member 11A (TNFRSF11A) Tumor necrosis factor receptor superfamily member 13B (TNFRSF13B) O O Q9Y6Q O Tyrosine-protein kinase Mer (MERTK) Q Vascular endothelial growth factor D (VEGF-D) V-set and immunoglobulin domaincontaining protein 2 (VSIG2) O Q96IQ Proseek Multiplex CVD II Validation Data 7

8 2.3 PRECISION REPEATABILITY Intra-assay variation (within-run) was calculated as the mean %CV for 6 individual samples run in triplicates within each of 10 separate runs during the validation studies. Inter-assay variation (between runs) was calculated between experiments with the same operator. The reported inter-assay %CV is the average of three operators %CV. Variation calculations were performed on linearized values for 91 out of 92 analytes for which response levels could be measured in serum and normal plasma, see Table 1. Across all 91 assays, the mean intra-assay and inter-assay variations were observed to be 9.1% and 11.7%, respectively. The distribution of both intraassay and inter-assay variations are shown in Figure 4. % of protein biomarkers Intra (mean %CV 9.1) Inter (mean %CV 11.7) >40 % CV Fig 4. Distribution of intra-assay and inter-assay variations of Proseek Multiplex CVD II REPRODUCIBILITY Inter-site variations (between-site) were investigated during the validation of previous panels in betasite studies to estimate the expected variations in values between different laboratories, with different operators and using different equipment. The betasite studies have previously shown reproducibility and repeatability in line with Olink Bioscience results, and were therefore not performed for Proseek Multiplex CVD II For information on performed beta-site studies, download our Data Validation documents at ANALYTICAL SPECIFICITY ASSAY SPECIFICITY To test that the antibodies selected for use in our Proseek Multiplex CVD II assays are specific for their desired targets, we measured each assay response to all of the 92 panel-specific proteins, as well as against an additional 107 proteins (not shown). In principle, the specificity is tested by creating a test sample, consisting of a pool of antigens, which is then incubated with all 92 antibody probe pairs from the panel. Only if there is a correct match will a reporter sequence be created and serve as a template for subsequent real-time qpcr. Ten sub-pools of antigen are evaluated to cover the 92 assays in Proseek Multiplex, see Figure 5. None of the Proseek Multiplex CVD II 96x96 showed significant signal from the proteins tested NPX plex Pool 1 Pool 2 Pool 3 Pool 4 Pool 5 20 Pool 6 Pool 7 10 Pool 8 1 Pool 9 Fig 5. Assay readout specificity of the Proseek Multiplex platform. For each assay, specificity is confirmed by testing antigen sub-pools against the complete 92-plex pool as to each sub-mix. 8 Proseek Multiplex CVD II Validation Data

9 ENDOGENOUS INTERFERENCE Endogenous interference from heterophilic antibodies, e.g. human anti-mouse antibody (HAMA), and rheumatoid factor are known to cause problems in some immunoassays. Evaluation of the potential impact of this specific interference has been performed previously using a special mismatch system. The only way to generate a signal in this system is by antibody probe pairs being brought into proximity, by cross-binding substances other than antigens, e.g. heterophilic antibodies and similarly acting rheumatoid factor. No interference due to HAMA or RF could be detected for any of the samples in any of the previously tested panels, indicating sufficient blocking of these agents (data not shown). 2.5 SCALABILITY Assay performance was further evaluated with regard to scalability, meaning the capability of the Proseek Multiplex technology to maintain the same quality of performance irrespective of multiplex level. Previously, we have shown that a step-wise increase of multiplex grade (8, 24, 48, 72 and 96) does not compromise assay performance (data not shown). To further strengthen that Proseek provides consistent results, single assays for Growth Hormone (GH) and Matrix Metalloproteinase (MMP-7) were compared when run in the full Proseek Multiplex CVD II panel. The results for each assay and their observed dcq-values were plotted against the entire 96-plex reaction. The square of the correlation coefficient (R 2 ) value was generated by linear regression. MMP-7 GH 15 g/l 7.5 g/l 3.75 g/l 1.88 g/l 0.94 g/l 0.47 g/l 0.23 g/l EDTA plasma 3 2 R² = Fig 6. Endogenous interference. Levels tested for hemolysate were g/l hemoglobin. The highest hemolysate concentration translates to about 10% hemolysis. The potential impact of bilirubin, lipids and hemolysate, known interfering plasma and serum components, were evaluted at different added concentrations. An example of hemolysate levels tested is shown in Figure 6. These additions represent different patient health conditions and/or sample collection irregularities. For all assays, bilirubin and lipids could be added to concentrations corresponding to at least 8 or 10 times normal values 3, 4, respectively, without disturbing assay performance (data not shown). In 22 out of 92 assays, altered signal was observed by the addition of hemolysate. The reason is most likely due to actual analyte leaking out of the disrupted blood cells. A concentration of 15 g/l of hemolysate represents 10% hemolysis of a sample. Table 1 reports the highest concentration of hemolysate that does not have an impact on assay performance. Singleplex R² = Multiplex Fig 7. Scalability of the Proseek Mutliplex technology platform. This experiment was performed using the Proseek Multiplex CVD II panel. Human plasma samples were analyzed for two representative assays in singleplex and with the complete Proseek Multiplex CVD II panel. The observed dcq (log2) values were plotted, and the correlation coefficient R 2 value was generated by linear regression. Proseek Multiplex CVD II Validation Data 9

10 3. References 1. Assarsson E, Lundberg M, Holmquist G, Björkesten J, Bucht Thorsen S, Ekman D, Eriksson A, Rennel Dickens E, Ohlsson S, Edfeldt G, Andersson AC, Lindstedt P, Stenvang J, Gullberg M, Fredriksson S. Homogenous 96-Plex PEA Immunoassay Exhibiting High Sensitivity, Specificity, and Excellent Scalability. PLoS One April (2014). doi: /journal.pone Lundberg M, Eriksson A, Tran B, Assarsson E, Fredriksson S. Homogeneous antibody-based proximity extension assays provide sensitive and specific detection of low abundant proteins in human blood. Nucleic Acid Res June (2011). doi: /nar/gkr Proseek Multiplex CVD II Validation Data

11

12 For Research Use Only. Not for Use in Diagnostic Procedures. This product includes a license for non-commercial use of Proseek products. Commercial users may require additional licenses. Please contact Olink Proteomics AB for details. There are no warranties, expressed or implied, which extend beyond this description. Olink Proteomics AB is not liable for property damage, personal injury, or economic loss caused by this product. The following trademarks are owned by Olink AB: Olink, Olink Bioscience, Proseek. This product is covered by several patents and patent applications including US 6,511,809, US 7,306,904 and related US and foreign patents. This product is sold under license from PHRI Properties, Inc. and may be used under PHRI Properties patent rights outside the field of human in vitro diagnostics. Components in the Proseek Multiplex Probe Kit utilise Lightning-Link technology and are provided under license from Innova Biosciences. Copyright 2016 Olink Proteomics AB. All third party trademarks are the property of their respective owners. 1016, v1.3, Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden

DATA PACKAGE. Multiplex CVD I 96 96

DATA PACKAGE. Multiplex CVD I 96 96 DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit

More information

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension.

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully

More information

Data Package. Multiplex Oncology I 96 96

Data Package. Multiplex Oncology I 96 96 Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection

More information

Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies

Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Abstract Background: Cardiovascular diseases account for the largest fraction of smoking-induced

More information

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

PERIOSTIN ELISA CONTENTS

PERIOSTIN ELISA CONTENTS PERIOSTIN ELISA for the quantitative determination of Periostin in human serum, EDTA plasma, heparin plasma, and citrate plasma Cat. No. BI-20433. 12 x 8 tests CONTENTS ASSAY CHARACTERISTICS Summary...

More information

DKK-1 ELISA, Cat.No. BI For the quantitative determination of DKK-1 in human serum

DKK-1 ELISA, Cat.No. BI For the quantitative determination of DKK-1 in human serum DKK-1 ELISA, Cat.No. BI-20413 For the quantitative determination of DKK-1 in human serum ASSAY CHARACTERISTICS Method Standard range Conversion factor Sample volume / well Incubation time, temp. Sensitivity

More information

Hexagon PSA. Design Verification. Contents

Hexagon PSA. Design Verification. Contents Design Verification Hexagon PSA Contents 1. Function...2 2. Sensitivity, Dynamic Range and Traceability...2 Description of Control Materials...2 Analytical Sensitivity...2 3. Clinical Evaluation...3 Evaluation

More information

Nori Rabbit IL-2 ELISA Kit DataSheet

Nori Rabbit IL-2 ELISA Kit DataSheet Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the

More information

9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay

9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay AssayGate, Inc. 9607 Dr. Perry Road Suite 103. Ijamsville, MD 21754. Tel: (301)874-0988. Fax: (301)560-8288. Ultrasensitive Samoa Human IL-33 Immunoassay INTRODUCTION Interleukin-33 (IL-33), a cytokine

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Human Neurology 3-Plex A

Human Neurology 3-Plex A Human Neurology 3-Plex A SUMMARY AND EXPLANATION OF THE TEST The Human N3PA assay is a digital immunoassay for the quantitative determination of total Tau, Aβ42, and Aβ40 in human plasma and CSF. Determination

More information

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)

More information

BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples

BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples ASSAY CHARACTERISTICS Method Competitive Enzyme Immunoassay, HRP/TMB. Microtiter plates are coated with a polyclonal

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:

More information

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic September 9, 2017 Patricia W Bedard, Jason Lapetoda, Jagadeesha Dammanahalli, Jessica Van Allen, Susan Lin, Lee Landeen

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma P909 Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma Tedeschi R, Bidoli E 2, Bortolin MT, Pratesi C, Basaglia G, Zanussi

More information

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents 2016 SomaLogic, Inc. Florence Pinet, Inserm UMR1167, Univ Lille, Ins?tut Pasteur de Lille, Lille - FRANCE florence.pinet@pasteur-

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it. Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of rat TNF-alpha concentrations in cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

Free Fatty Acid Assay Kit (Fluorometric)

Free Fatty Acid Assay Kit (Fluorometric) Product Manual Free Fatty Acid Assay Kit (Fluorometric) Catalog Number STA-619 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type of lipid

More information

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on. CUBE analyser (CA0100)

Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on. CUBE analyser (CA0100) Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on CUBE analyser (CA0100) Location Location: Eurolyser Diagnostica GmbH Operators: Simone Wieser; Franz Helminger; Michael Gruber Date: July-November

More information

SUPPLEMENTARY FIG. S2. b-galactosidase staining of

SUPPLEMENTARY FIG. S2. b-galactosidase staining of SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived

More information

LDL (Human) ELISA Kit

LDL (Human) ELISA Kit LDL (Human) ELISA Kit Cat. No.:DEIA3864 Pkg.Size:96T Intended use This immunoassay kit allows for the specific measurement of human low density lipoprotein, LDL concentrations in cell culture supernates,

More information

Human Hemoglobin Colorimetric Detection Kit

Human Hemoglobin Colorimetric Detection Kit Human Hemoglobin Colorimetric Detection Kit CATALOG NO: IRAAKT2522 LOT NO: SAMPLE INTENDED USE The Hemoglobin detection kit is designed to quantitatively measure all forms of hemoglobin present in blood

More information

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

2 Screen Islet Cell Autoantibody Human ELISA

2 Screen Islet Cell Autoantibody Human ELISA 2 Screen Islet Cell Autoantibody Human ELISA Cat. No.:DEIA4453 Pkg.Size:96T Intended use The 2 Screen Islet Cell autoantibody (2 Screen) ELISA kit is intended for use by professional persons only, for

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Insulin ELISA. For the quantitative determination of insulin in serum and plasma

Insulin ELISA. For the quantitative determination of insulin in serum and plasma Insulin ELISA For the quantitative determination of insulin in serum and plasma For In Vitro Diagnostic use within the United States of America. This product is for Research Use Only outside of the United

More information

Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed and Secreted (CCL5 / RANTES) Kit

Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed and Secreted (CCL5 / RANTES) Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed

More information

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

Human LDL ELISA Kit. Innovative Research, Inc.

Human LDL ELISA Kit. Innovative Research, Inc. Human LDL ELISA Kit Catalog No: IRKTAH2582 Lot No: SAMPLE INTRODUCTION Human low-density lipoprotein (LDL) transports cholesterol from the liver to tissues where it is incorporated into cell membranes.

More information

REPRODUCTIVE CYCLE OF FEMALE MAMMAL

REPRODUCTIVE CYCLE OF FEMALE MAMMAL REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space

More information

Colorectal cancer - CEA

Colorectal cancer - CEA Colorectal cancer - CEA What is carcinoembryonic antigen? Human carcinoembryonic antigen (CEA) (MW = 175000 200000 g/mol) is a glycoprotein involved in cell adhesion. It is normally produced during fetal

More information

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets (TaqMan Real-time ' FAM ' BHQ1

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

WideScreen BeadPlex Multiplex Assays. Spring 2010

WideScreen BeadPlex Multiplex Assays. Spring 2010 WideScreen BeadPlex Multiplex Assays Spring 2010 Cancer Panels Cancer Biomarkers Cancer Panel 1 (Biomarkers) Cancer Panel 2 (Growth Factors) MMP Panel Cat No: BPHCP001-6 CA 125 CEA (Carcinoembryonic Antigen)

More information

Supplemental Material

Supplemental Material Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin

More information

Insulin ELISA. For the quantitative determination of insulin in serum and plasma.

Insulin ELISA. For the quantitative determination of insulin in serum and plasma. Insulin ELISA For the quantitative determination of insulin in serum and plasma. For In Vitro Diagnostic use within the United States of America. This product is for Research Use Only outside of the United

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human TNF-alpha in serum, plasma and cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

Mouse GLP-2 EIA. Cat. No. KT-374. For the quantitative determination of GLP-2 in mouse serum or plasma. For Research Use Only. 1 Rev.

Mouse GLP-2 EIA. Cat. No. KT-374. For the quantitative determination of GLP-2 in mouse serum or plasma. For Research Use Only. 1 Rev. Mouse GLP-2 EIA For the quantitative determination of GLP-2 in mouse serum or plasma. Cat. No. KT-374 For Research Use Only. 1 Rev. 11357374 PRODUCT INFORMATION Mouse GLP-2 EIA Cat. No. KT-374 INTENDED

More information

Mercodia Equine Insulin ELISA

Mercodia Equine Insulin ELISA Mercodia Equine Insulin ELISA Directions for Use 10-1205-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden EXPLANATION OF SYMBOLS USED ON LABELS =

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

LC-MS/MS for the quantification of Peptide biomarker and mixture of closely related Protein in formulation

LC-MS/MS for the quantification of Peptide biomarker and mixture of closely related Protein in formulation EUROPEAN BIOANALYSIS FORUM Barcelona, November 14-16, 2012 LC-MS/MS for the quantification of Peptide biomarker and mixture of closely related Protein in formulation Luc-Alain SAVOY CONTENT Part I: SGS

More information

Dilution Factor Serum Plasma Urine CSF (Other)

Dilution Factor Serum Plasma Urine CSF (Other) R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations

More information

S4. Summary of the GALNS assay validation. Intra-assay variation (within-run precision)

S4. Summary of the GALNS assay validation. Intra-assay variation (within-run precision) S4. Summary of the GALNS assay validation (i.) Intra-assay variation (within-run precision) Intra-assay variation was determined by measuring standard blood samples (low activity standard; medium activity

More information

Product Manual. Human LDLR ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures

Product Manual. Human LDLR ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures Product Manual Human LDLR ELISA Kit Catalog Number STA-386 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is an essential component of cellular membranes,

More information

Reducing Sample Volume and Increasing Sensitivity for the Quantification of Human Insulin and 5 Analogs in Human Plasma Using ionkey/ms

Reducing Sample Volume and Increasing Sensitivity for the Quantification of Human Insulin and 5 Analogs in Human Plasma Using ionkey/ms Reducing Sample Volume and Increasing Sensitivity for the Quantification of Human Insulin and 5 Analogs in Human Plasma Using ionkey/ms Erin E. Chambers and Kenneth J. Fountain Waters Corporation, Milford,

More information

Human Hydrogen Peroxide Fluorescent Detection Kit

Human Hydrogen Peroxide Fluorescent Detection Kit Human Hydrogen Peroxide Fluorescent Detection Kit CATALOG NO: IRAAKT2525 LOT NO: SAMPLE INTENDED USE The Hydrogen Peroxide Fluorescent Detection Kit is designed to quantitatively measure H₂O₂ in a variety

More information

Mercodia Porcine C-peptide ELISA

Mercodia Porcine C-peptide ELISA Mercodia Porcine C-peptide ELISA Directions for Use 10-1256-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden INTENDED USE Mercodia Porcine C-peptide

More information

Porcine/Canine Insulin ELISA

Porcine/Canine Insulin ELISA Porcine/Canine Insulin ELISA For the quantitative determination of insulin in porcine or canine serum and plasma. Please read carefully due to Critical Changes, e.g., Calculation of Results. For Research

More information

DBC s panel of thyroid hormone immunoassays is now more comprehensive with the new Reverse T3 ELISA kit. Test Your Hormones

DBC s panel of thyroid hormone immunoassays is now more comprehensive with the new Reverse T3 ELISA kit. Test Your Hormones DBC s panel of thyroid hormone immunoassays is now more comprehensive with the new Reverse T3 ELISA kit Test Your Hormones INTRODUCTION For years thyroid hormone testing has been concentrated on TSH and

More information

Mouse C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-Cell Expressed, and Secreted (mccl5/rantes) Kit

Mouse C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-Cell Expressed, and Secreted (mccl5/rantes) Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Mouse C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-Cell Expressed,

More information

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint

Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint APPLICATION NOTE AlphaLISA Technology Authors: Matthew Marunde Stephen Hurt PerkinElmer, Inc. Hopkinton, MA Utilizing AlphaLISA Technology to Screen for Inhibitors of the CTLA-4 Immune Checkpoint Introduction

More information

Mercodia Glucagon ELISA

Mercodia Glucagon ELISA Mercodia Glucagon ELISA Directions for Use 10-1271-01 REAGENTS FOR 96 DETERMINATIONS For Research Use Only Manufactured by Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Sweden EXPLANATION OF SYMBOLS

More information

Insulin (Porcine/Canine) ELISA

Insulin (Porcine/Canine) ELISA Insulin (Porcine/Canine) ELISA For the quantitative measurement of insulin in Porcine/Canine serum and plasma (EDTA) For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 80-INSPO-E01

More information

Mercodia Ultrasensitive Rat Insulin ELISA

Mercodia Ultrasensitive Rat Insulin ELISA Mercodia Ultrasensitive Rat Insulin ELISA Directions for Use 10-1251-01 REAGENTS FOR 96 DETERMINATIONS 10-1251-10 REAGENTS FOR 10 X 96 DETERMINATIONS For Research Use only Not for Use in Diagostic Procedure

More information

Proseek Multiplex Inflammation I 96 96

Proseek Multiplex Inflammation I 96 96 Proseek Multiplex Inflammation I 96 96 Adenosine Deaminase (ADA) P00813 Fibroblast growth factor 5 (FGF-5) Q8NF90 Artemin (ARTN) Q5T4W7 Fms-related tyrosine kinase 3 ligand (Flt3L) P49771 Axin-1 (AXIN1)

More information

CTLA-4 (Human) AlphaLISA Detection Kit

CTLA-4 (Human) AlphaLISA Detection Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Research Use Only. Not for use in diagnostic procedures. CTLA-4 (Human) AlphaLISA Detection Kit Product No.: AL3050 Contents Product Information... 2 Quality

More information

RayBio Human Thyroglobulin ELISA Kit

RayBio Human Thyroglobulin ELISA Kit RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Mouse C-Peptide ELISA Kit

Mouse C-Peptide ELISA Kit Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and

More information

Morinaga Mouse C-peptide ELISA Kit

Morinaga Mouse C-peptide ELISA Kit Morinaga Mouse C-peptide ELISA Kit For the quantitative determination of C-peptide in mouse serum, plasma, and fluid 96wells For Laboratory Use Only, not for use in diagnostic procedure Please read full

More information

Life Sciences METABOLISM. Transform Your Metabolic Research

Life Sciences METABOLISM. Transform Your Metabolic Research METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,

More information

ProcartaPlex multiplex immunoassays for the Luminex platform

ProcartaPlex multiplex immunoassays for the Luminex platform ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate

More information

Mercodia Porcine C-peptide ELISA

Mercodia Porcine C-peptide ELISA Mercodia Porcine C-peptide ELISA Directions for Use 10-1256-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB, Sylveniusgatan 8A, SE-754 50 Uppsala, Sweden EXPLANATION OF SYMBOLS USED ON LABELS

More information

Free Glycerol Assay Kit (Colorimetric)

Free Glycerol Assay Kit (Colorimetric) Product Manual Free Glycerol Assay Kit (Colorimetric) Catalog Number STA-398 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Glycerol is the backbone of Triglycerides

More information

AmoyDx TM BRAF V600E Mutation Detection Kit

AmoyDx TM BRAF V600E Mutation Detection Kit AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background

More information

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5

More information

Tissue repair. (3&4 of 4)

Tissue repair. (3&4 of 4) Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid

More information

[ APPLICATION NOTE ] High Sensitivity Intact Monoclonal Antibody (mab) HRMS Quantification APPLICATION BENEFITS INTRODUCTION WATERS SOLUTIONS KEYWORDS

[ APPLICATION NOTE ] High Sensitivity Intact Monoclonal Antibody (mab) HRMS Quantification APPLICATION BENEFITS INTRODUCTION WATERS SOLUTIONS KEYWORDS Yun Wang Alelyunas, Henry Shion, Mark Wrona Waters Corporation, Milford, MA, USA APPLICATION BENEFITS mab LC-MS method which enables users to achieve highly sensitive bioanalysis of intact trastuzumab

More information

Growth Factors. BIT 230 Walsh Chapter 7

Growth Factors. BIT 230 Walsh Chapter 7 Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of

More information

Instant ELISA Kits. Accelerate Time to Result

Instant ELISA Kits. Accelerate Time to Result Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable

More information

Mouse Leptin ELISA Kit Instructions

Mouse Leptin ELISA Kit Instructions V.6/Mar/2008 CRYSTAL CHEM INC. Mouse Leptin ELISA Kit Instructions For the quantitative determination of leptin in mouse serum or plasma and fluid Catalog #: 90030 96 Assays For Research Use Only. Not

More information

The Impact of Preanalytical Variables in Blood: Enabling High Quality Protein Analysis

The Impact of Preanalytical Variables in Blood: Enabling High Quality Protein Analysis The Impact of Preanalytical Variables in Blood: Enabling High Quality Protein Analysis David Craft, PhD Senior Manager Biological Sciences R&D BD Life Sciences Preanalytical Systems 2016 BD. BD, the BD

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

ProcartaPlex Multiplex Immunoassays

ProcartaPlex Multiplex Immunoassays ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a

More information

Bio-Plex Pro Cell Signaling Assays

Bio-Plex Pro Cell Signaling Assays Acute Phase Response Cancer Cardiovascular Disease Diabetes Cytokines, Chemokines, Growth Factors Immunology/Inflammation Immunoglobulin Isotyping Cell Signaling Toxicology Bio-Plex Pro Cell Signaling

More information

To compare the relative amount of of selected gene expression between sham and

To compare the relative amount of of selected gene expression between sham and Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

human Total Cathepsin B Catalog Number: DY2176

human Total Cathepsin B Catalog Number: DY2176 human Total Cathepsin B Catalog Number: DY2176 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant human Total

More information

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit

Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit Mouse Hydrogen Peroxide (H2O2) Fluorescent Detection Kit CATALOG NO: IRAAKT2552 LOT NO: SAMPLE INTENDED USE The Hydrogen Peroxide Fluorescent Detection Kit is designed to quantitatively measure H2O2 in

More information

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles

More information

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets Real- (TaqMan time ' FAM ' BHQ1

More information

Bovine Insulin ELISA

Bovine Insulin ELISA Bovine Insulin ELISA For quantitative determination of insulin in bovine serum and plasma. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 80-INSBO-E01 Size: 96 wells Version:

More information

Hepatitis B Virus Surface antigen (HBsAg) AlphaLISA Detection Kit

Hepatitis B Virus Surface antigen (HBsAg) AlphaLISA Detection Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Research Use Only. Not for use in diagnostic procedures. Hepatitis B Virus Surface antigen (HBsAg) AlphaLISA Detection Kit Product No.: AL3083 HV/C/F Contents

More information

New Formulation of Amb a 1 ELISA 2.0 and MARIA

New Formulation of Amb a 1 ELISA 2.0 and MARIA Stephanie Filep Director of Laboratory Services 700 Harris Street Charlottesville VA 22903 U.S.A. TEL: (1) (434) 984 2304 FAX: (1) (434) 984 2709 www.inbio.com March 23, 2018 New Formulation of Amb a 1

More information