Proseek Multiplex Inflammation I 96 96
|
|
- Brent Stafford
- 5 years ago
- Views:
Transcription
1 Proseek Multiplex Inflammation I Adenosine Deaminase (ADA) P00813 Fibroblast growth factor 5 (FGF-5) Q8NF90 Artemin (ARTN) Q5T4W7 Fms-related tyrosine kinase 3 ligand (Flt3L) P49771 Axin-1 (AXIN1) O15169 Fractalkine (CX3CL1 ) P78423 Beta-nerve growth factor (Beta-NGF) P01138 Glial cell line-derived neurotrophic factor (GDNF) P39905 Brain-derived neurotrophic factor (BDNF) P23560 Hepatocyte growth factor (HGF) P14210 Caspase 8 (CASP-8 ) Q14790 Interferon gamma (IFN-gamma) P01579 C-C motif chemokine 19 (CCL19) Q99731 Interleukin-1 alpha (IL-1 alpha) P01583 C-C motif chemokine 20 (CCL20) P78556 Interleukin-10 (IL-10) P22301 C-C motif chemokine 23 (CCL23) P55773 Interleukin-10 receptor subunit alpha (IL-10RA) Q13651 C-C motif chemokine 25 (CCL25) O15444 Interleukin-10 receptor subunit beta (IL-10RB) Q08334 C-C motif chemokine 28 (CCL28) Q9NRJ3 Interleukin-12 subunit beta (IL-12B) P29460 C-C motif chemokine 3 (CCL3) P10147 Interleukin-13 (IL-13) P35225 C-C motif chemokine 4 (CCL4 ) P13236 Interleukin-15 receptor subunit alpha (IL-15RA) Q13261 CD40L receptor (CD40) P25942 Interleukin-17A (IL-17A) Q16552 CUB domain-containing protein 1 (CDCP1) Q9H5V8 Interleukin-17C (IL-17C) Q9P0M4 C-X-C motif chemokine 1 (CXCL1) P09341 Interleukin-18 (IL-18) Q14116 C-X-C motif chemokine 10 (CXCL10) P02778 Interleukin-18 receptor 1 (IL-18R1) Q13478 C-X-C motif chemokine 11 (CXCL11) O14625 Interleukin-2 (IL-2) P60568 C-X-C motif chemokine 5 (CXCL5) P42830 Interleukin-2 receptor subunit beta (IL-2RB) P14784 C-X-C motif chemokine 6 (CXCL6) P80162 Interleukin-20 (IL-20) Q9NYY1 C-X-C motif chemokine 9 (CXCL9 ) Q07325 Interleukin-20 receptor subunit alpha (IL-20RA) Q9UHF4 Cystatin D (CST5) P28325 Interleukin-22 receptor subunit alpha-1 (IL-22 RA1) Q8N6P7 Delta and Notch-like epidermal growth factorrelated receptor (DNER) Q8NFT8 Interleukin-24 (IL-24) Q13007 Eotaxin-1 (CCL11) P51671 Interleukin-33 (IL-33) O95760 Eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) Q13541 Interleukin-4 (IL-4) P05112 Fibroblast growth factor 19 (FGF-19) O95750 Interleukin-5 (IL-5) P05113 Fibroblast growth factor 21 (FGF-21) Q9NSA1 Interleukin-6 (IL-6) P05231 Fibroblast growth factor 23 (FGF-23) Q9GZV9 Interleukin-7 (IL-7) P13232 Table continues on reverse
2 Proseek Multiplex Inflammation I Interleukin-8 (IL-8) P10145 Signaling lymphocytic activation molecule (SLAMF1) Q13291 Latency-associated peptide transforming growth factor beta 1 (LAP TGF-beta-1) P01137 SIR2-like protein 2 (SIRT2) Q8IXJ6 Leukemia inhibitory factor (LIF) P15018 STAM-binding protein (STAMBP) O95630 Leukemia inhibitory factor receptor (LIF-R) P42702 Stem cell factor (SCF) P21583 Macrophage colony-stimulating factor 1 (CSF-1) P09603 Sulfotransferase 1A1 (ST1A1) P50225 Matrix metalloproteinase-1 (MMP-1) P03956 T cell surface glycoprotein CD6 isoform (CD6) Q8WWJ7 Matrix metalloproteinase-10 (MMP-10) P09238 T-cell surface glycoprotein CD5 (CD5) P06127 Monocyte chemotactic protein 1 (MCP-1) P13500 Thymic stromal lymphopoietin (TSLP) Q969D9 Monocyte chemotactic protein 2 (MCP-2) P80075 TNF-beta (TNFB) P01374 Monocyte chemotactic protein 3 (MCP-3) P80098 TNF-related activation-induced cytokine (TRANCE) O14788 Monocyte chemotactic protein 4 (MCP-4) Q99616 TNF-related apoptosis-inducing ligand (TRAIL) P50591 Natural killer cell receptor 2B4 (CD244) Q9BZW8 Transforming growth factor alpha (TGF-alpha) P01135 Neurotrophin-3 (NT-3) P20783 Tumor necrosis factor (Ligand) superfamily, member 12 (TWEAK) O43508 Neurturin (NRTN) Q99748 Tumor necrosis factor (TNF) P01375 Oncostatin-M (OSM) P13725 Tumor necrosis factor ligand superfamily member 14 (TNFSF14) Osteoprotegerin (OPG) O00300 Tumor necrosis factor receptor superfamily member 9 (TNFRSF9) O43557 Q07011 Programmed cell death 1 ligand 1 (PD-L1) Q9NZQ7 Urokinase-type plasminogen activator (upa) P00749 Protein S100-A12 (EN-RAGE ) P80511 Vascular endothelial growth factor A (VEGF-A) P15692 Chemokine Immune/Inflammatory response Exploratory Cytokine Figure 1. Proseek Multiplex Inflammation I 96x96 protein biomarker categories. This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2015 Olink AB. 1029, v. 1.0, Olink Bioscience Dag Hammarskjölds v. 52B SE Uppsala, Sweden
3 Proseek Multiplex CVD I I ADM (ADM) P35318 Growth/differentiation factor 2 (GDF-2) Q9UK05 2,4-dienoyl-CoA reductase, mitochondrial (DECR1) Q16698 Heat shock 27 kda protein (HSP 27) P04792 A disintegrin and metalloproteinase with thrombospondin motifs 13 (ADAM-TS13) Q76LX8 Heme oxygenase 1 (HO-1) P09601 Agouti-related protein (AGRP) O00253 Hydroxyacid oxidase 1 (HAOX1) Q9UJM8 Alpha-L-iduronidase (IDUA) P35475 Interleukin-1 receptor antagonist protein (IL-1ra) P18510 Angiopoietin-1 (ANG-1) Q15389 Interleukin-1 receptor-like 2 (IL1RL2) Q9HB29 Angiopoietin-1 receptor (TIE2) Q02763 Interleukin-4 receptor subunit alpha (IL-4RA) P24394 Angiotensin-converting enzyme 2 (ACE2) Q9BYF1 Interleukin-6 (IL-6) P05231 Bone morphogenetic protein 6 (BMP-6) P22004 Interleukin-17D (IL-17D) Q8TAD2 Brother of CDO (Protein BOC) Q9BWV1 Interleukin-18 (IL-18) Q14116 Carbonic anhydrase 5A, mitochondrial (CA5A) P35218 Interleukin-27 (IL-27) Q8NEV9, Q14213 Carcinoembryonic antigenrelated cell adhesion molecule 8 (CEACAM8) P31997 Lactoylglutathione lyase (GLO1) Q04760 Cathepsin L1 (CTSL1) P07711 Lectin-like oxidized LDL receptor 1 (LOX-1) P78380 C-C motif chemokine 3 (CCL3) P10147 Leptin (LEP) P41159 C-C motif chemokine 17 (CCL17) Q92583 Lipoprotein lipase (LPL) P06858 CD40 ligand (CD40-L) P29965 Low affinity immunoglobulin gamma Fc region receptor II-b (IgG Fc receptor II-b) P31994 Chymotrypsin C (CTRC) Q99895 Lymphotactin (XCL1) P47992 C-X-C motif chemokine 1 (CXCL1) P09341 Macrophage receptor MARCO (MARCO) Q9UEW3 Decorin (DCN) P07585 Matrix metalloproteinase-7 (MMP-7) P09237 Dickkopf-related protein 1 (Dkk-1) O94907 Matrix metalloproteinase-12 (MMP-12) P39900 Fatty acid-binding protein, intestinal (FABP2) P12104 Melusin (ITGB1BP2) Q9UKP3 Fibroblast growth factor 21 (FGF-21) Q9NSA1 Natriuretic peptides B (BNP) P16860 Fibroblast growth factor 23 (FGF-23) Q9GZV9 NF-kappa-B essential modulator (NEMO) Q9Y6K9 Follistatin (FS) P19883 Osteoclast-associated immunoglobulin-like receptor (hoscar) Q8IYS5 Galectin-9 (Gal-9) O00182 Pappalysin-1 (PAPPA) Q13219 Gastric intrinsic factor (GIF) P27352 Pentraxin-related protein PTX3 (PTX3) P26022 Gastrotropin (GT) P51161 Placenta growth factor (PlGF) P49763 Growth hormone (GH) P01241 Platelet-derived growth factor subunit B (PDGF subunit B) P01127 Table continues on reverse
4 Proseek Multiplex CVD I I Poly [ADP-ribose] polymerase 1 (PARP-1) P09874 SLAM family member 7 (SLAMF7) Q9NQ25 Polymeric immunoglobulin receptor (PIgR) P01833 Sortilin (SORT1) Q99523 Programmed cell death 1 ligand 2 (PD-L2) Q9BQ51 Spondin-2 (SPON2) Q9BUD6 Proheparin-binding EGF-like growth factor (HB- EGF) Q99075 Stem cell factor (SCF) P21583 Pro-interleukin-16 (IL16) Q14005 Superoxide dismutase [Mn], mitochondrial (SOD2) P04179 Prolargin (PRELP) P51888 Kidney injury molecule 1 (KIM-1) Q96D42 Prostasin (PRSS8) Q16651 T-cell surface glycoprotein CD4 (CD4) P01730 Protein AMBP (AMBP) P02760 Thrombomodulin TM P07204 Proteinase-activated receptor 1 (PAR-1) P25116 Thrombopoietin (THPO) P40225 Protein-glutamine gamma-glutamyltransferase 2 (TGM2) P21980 Thrombospondin-2 (THBS2) P35442 Proto-oncogene tyrosine-protein kinase Src (SRC) P12931 Tissue factor (TF) P13726 P-selectin glycoprotein ligand 1 (PSGL-1) Q14242 TNF-related apoptosis-inducing ligand receptor 2 (TRAIL-R2) O14763 Receptor for advanced glycosylation end products (RAGE) Q15109 Tumor necrosis factor receptor superfamily member 10A (TNFRSF10A) O00220 Renin (REN) P00797 Tumor necrosis factor receptor superfamily member 11A (TNFRSF11A) Serine protease 27 (PRSS27) Q9BQR3 Tumor necrosis factor receptor superfamily member 13B (TNFRSF13B) Q9Y6Q6 O14836 Serine/threonine-protein kinase 4 (STK4) Q13043 Tyrosine-protein kinase Mer (MERTK) Q12866 Serpin A12 (SERPINA12) Q8IW75 Vascular endothelial growth factor D (VEGF-D) O43915 SLAM family member 5 (CD84) Q9UIB8 V-set and immunoglobulin domain-containing protein 2 (VSIG2) Q96IQ7 CVD Metabolism CVD Exploratory CVD CVD/ Inflammation Inflammatory and immune system Figure 1. Proseek Multiplex CVD II 96x96 protein biomarker categories. This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB. 1024, v. 1.1, Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden
5 Proseek Multiplex CVD I I I Aminopeptidase N (AP-N) P15144 Growth/differentiation factor 15 (GDF-15) Q99988 Azurocidin (AZU1 P20160 Insulin-like growth factor-binding protein 1 (IGFBP-1) P08833 Bleomycin hydrolase (BLM hydrolase) Q13867 Insulin-like growth factor-binding protein 2 (IGFBP-2) P18065 Cadherin-5 (CDH5) P33151 Insulin-like growth factor-binding protein 7 (IGFBP-7) Q16270 Carboxypeptidase A1 (CPA1) P15085 Integrin beta-2 (ITGB2) P05107 Carboxypeptidase B (CPB1) P15086 Intercellular adhesion molecule 2 (ICAM-2) P13598 Caspase-3 (CASP-3) P42574 Interleukin-1 receptor type 1 (IL-1RT1) P14778 Cathepsin D (CTSD) P07339 Interleukin-1 receptor type 2 (IL-1RT2) P27930 Cathepsin Z (CTSZ) Q9UBR2 Interleukin-2 receptor subunit alpha (IL2-RA) P01589 C-C motif chemokine 15 (CCL15) Q16663 Interleukin-6 receptor subunit alpha (IL2-RA) P08887 C-C motif chemokine 16 (CCL16) O15467 Interleukin-17 receptor A (IL-17RA) Q96F46 C-C motif chemikine 22 (CCL22) O00626 Interleukin-18-binding protein (IL-18BP) O95998 C-C motif chemokine 24 (CCL24) O00175 Junctional adhesion molecule A (JAM-A) Q9Y624 CD166 antigen (ALCAM) Q13740 Kallikrein-6 (KLK6) Q92876 Chitinase-3-like protein 1 (CHI3L1) P36222 Low-density lipoprotein receptor (LDL receptor) P01130 Chitotriosidase-1 (CHIT1) Q13231 Lymphotoxin-beta receptor (LTBR) P36941 Collagen alpha-1(i) chain (COL1A1) P02452 Matrix extracellular phosphoglycoprotein (MEPE) Q9NQ76 Complement component C1q receptor (CD93) Q9NPY3 Matrix metalloproteinase-2 (MMP-2) P08253 Contactin-1 (CNTN1) Q12860 Matrix metalloproteinase-3 (MMP-3) P08254 C-X-C motif chemokine 16 (CXCL16) Q9H2A7 Matrix metalloproteinase-9 (MMP-9) P14780 Cystatin-B (CSTB) P04080 Metalloproteinase inhibitor 4 (TIMP4) Q99727 Elafin (PI3) P19957 Monocyte chemotactic protein 1 (MCP-1) P13500 Ephrin type-b receptor 4 (EPHB4) P54760 Myeloblastin (PRTN3) P24158 Epidermal growth factor receptor (EGFR) P00533 Myeloperoxidase (MPO) P05164 Epithelial cell adhesion molecule (Ep-CAM) P16422 Myoglobin (MB) P02144 E-selectin (SELE) P16581 Neurogenic locus notch homolog protein 3 (Notch 3) Q9UM47 Fatty acid-binding protein, adipocyte (FABP4) P15090 N-terminal prohormone brain natriuretic peptide (NT-pro BNP) NA Galectin-3 (Gal-3) P17931 Osteopontin (OPN) P10451 Galectin-4 (Gal-4) P56470 Osteoprotegerin (OPG) O00300 Granulins (GRN) P28799 Paraoxonase (PON3) Q15166 Table continues on reverse
6 Proseek Multiplex CVD I I I Peptidoglycan recognition protein 1 (PGLYRP1) O75594 Tissue factor pathway inhibitor (TFPI) P10646 Perlecan (PLC) P98160 Tissue-type plasminogen activator (t-pa) P00750 Plasminogen activator inhibitor 1 (PAI) P05121 Transferrin receptor protein 1 (TR) P02786 Platelet endothelial cell adhesion molecule (PECAM-1) Platelet-derived growth factor subunit A (PDGF subunit A) P16284 Trefoil factor 3 (TFF3) Q07654 P04085 Trem-like transcript 2 protein (TLT-2) Q5T2D2 Proprotein convertase subtilisin/kexin type 9 (PCSK9) Q8NBP7 Tumor necrosis factor ligand superfamily member 13B (TNFSF13B) Q9Y275 Protein delta homolog 1 (DLK-1) P80370 Tumor necrosis factor receptor 1 (TNF-R1) P19438 P-selectin (SELP) P16109 Tumor necrosis factor receptor 2 (TNF-R2) P20333 Pulmonary surfactant-associated protein D (PSP-D) P35247 Tumor necrosis factor receptor superfamily member 6 (FAS) Resistin (RETN) Q9HD89 Tumor necrosis factor receptor superfamily member 10C (TNFRSF10C) P25445 O14798 Retinoic acid receptor responder protein 2 (RARRES2) Q99969 Tumor necrosis factor receptor superfamily member 14 (TNFRSF14) Q92956 Scavenger receptor cysteine-rich type 1 protein M130 (CD163) Q86VB7 Tyrosine-protein kinase receptor UFO (AXL) P30530 Secretoglobin family 3A member 2 (SCGB3A2) Q96PL1 Tyrosine-protein phosphatase non-receptor type substrate 1 (SHPS-1) Spondin-1 (SPON1) Q9HCB6 Urokinase plasminogen activator surface receptor (U-PAR) P78324 Q03405 ST2 protein (ST2) Q01638 Urokinase-type plasminogen activator (upa) P00749 Tartrate-resistant acid phosphatase type 5 (TR-AP) P13686 von Willebrand factor (vwf) P04275 CVD Exploratory CVD CVD Metabolism CVD/ Inflammation Inflammatory and immune system Figure 1. Proseek Multiplex CVD III 96x96 protein biomarker categories. This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB. 1023,, v. 1.1, Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden
7 Proseek Multiplex Neurology I ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1 (CD38) Alpha-2-macroglobulin receptor-associated protein (Alpha-2-MRAP) P28907 Epithelial discoidin domain-containing receptor 1 (DDR1) Q08345 P30533 Ezrin (EZR) P15311 BDNF/NT-3 growth factors receptor (NTRK2) Q16620 Fc receptor-like protein 2 (FcRL2) Q96LA5 Beta-nerve growth factor (Beta-NGF) P01138 Galectin-8 (gal-8) O00214 Bone morphogenetic protein 4 (BMP-4) P12644 GDNF family receptor alpha-1 (GFR-alpha-1) P56159 Brain-derived neurotrophic factor (BDNF) P23560 GDNF family receptor alpha-3 (GDNFR-alpha-3) O60609 Brevican core protein (BCAN) Q96GW7 Glial cell line-derived neurotrophic factor (GDNF) P39905 Brorin (VWC2) Q2TAL6 Glypican-5 (GCP5) P78333 Cadherin-3 (CDH3) P22223 Granulocyte Colony-Stimulating Factor (G-CSF) P09919 Cadherin-6 (CDH6) P55285 Granulocyte-macrophage colony-stimulating factor receptor subunit alpha (GM-CSF-R-alpha) P15509 Carboxypeptidase A2 (CPA2) P48052 Granzyme A (GZMA) P12544 Carboxypeptidase M (CPM) P14384 Growth/differentiation factor 8 (GDF-8) O14793 Cathepsin S (CTSS) P25774 Hydroxyacylglutathione hydrolase, mitochondrial (HAGH) Q16775 Cell adhesion molecule 3 (CADM3) Q8N126 Interleukin-12 subunit beta, Interleukin-12 subunit alpha (IL-12B, IL-12A) P29460, P29459 Cell surface glycoprotein CD200 receptor 1 (CD200R1) Q8TD46 Interleukin-5 receptor subunit alpha (IL-5R-alpha) Q01344 CMRF35-like molecule 1 (CLM-1) Q8TDQ1 Junctional adhesion molecule B (JAM-B) P57087 CMRF35-like molecule 6 (CLM-6) Q08708 Kynureninase (KYNU) Q16719 Contactin-5 (CNTN5) O94779 Latexin (LXN) Q9BS40 C-type lectin domain family 1 member B (CLEC1B) Q9P126 Layilin (LAYN) Q6UX15 C-type lectin domain family 10 member A (CLEC10A) Q8IUN9 Leucine-rich repeat transmembrane protein FLRT2 (FLRT2) Cytotoxic and regulatory T-cell molecule (CRTAM) O95727 Leukocyte-associated immunoglobulin-like receptor 2 (LAIR-2) O43155 Q6ISS4 Dickkopf-related protein 4 (Dkk-4) Q9UBT3 Linker for activation of T-cells family member 1 (LAT) O43561 Dipeptidyl peptidase 1 (CTSC) P53634 Lysosome membrane protein 2 (SCARB2) Q14108 Disintegrin and metalloproteinase domain-containing protein 22 (ADAM 22) Q9P0K1 Macrophage scavenger receptor types I and II (MSR1) P21757 Disintegrin and metalloproteinase domain-containing protein 23 (ADAM 23) O75077 MAM domain-containing glycosylphosphatidylinositol anchor protein 1 (MDGA1) Q8NFP4 Draxin (DRAXIN) Q8NBI3 Matrilin-3 (MATN3) O15232 Ephrin type-b receptor 6 (EPHB6) O15197 Mesencephalic astrocyte-derived neurotrophic factor (MANF) P55145 Ephrin-A4 (EFNA4) P52798 N-acylethanolamine-hydrolyzing acid amidase (NAAA) Q02083 Table continues on reverse
8 Proseek Multiplex Neurology I Neprilysin (NEP) P08473 Roundabout homolog 2 (ROBO2) Q9HCK4 Netrin receptor UNC5C (UNC5C) O95185 R-spondin-1 (RSPO1) Q2MKA7 Neuroblastoma suppressor of tumorigenicity 1 (NBL1) P41271 Scavenger receptor class A member 5 (SCARA5) Q6ZMJ2 Neurocan core protein (NCAN) O14594 Scavenger receptor class F member 2 (SCARF2) Q96GP6 Neuronal cell adhesion molecule (Nr-CAM) Q92823 Secreted frizzled-related protein 3 (sfrp-3) Q92765 Neuropilin-2 (NRP2) O60462 Serine/threonine-protein kinase receptor R3 (SKR3) P37023 Neutral ceramidase (N-Cdase) Q9NR71 Sialic acid-binding Ig-like lectin 9 (Siglec-9) Q9Y336 Nicotinamide/nicotinic acid mononucleotide adenylyltransferase 1 (NMNAT1) Q9HAN9 Sialoadhesin (SIGLEC1) Q9BZZ2 NKG2D ligand 2 (N2DL-2) Q9BZM5 SPARC-related modular calcium-binding protein 2 (SMOC2) Q9H3U7 NT-3 growth factor receptor (NTRK3) Q16288 Sphingomyelin phosphodiesterase (SMPD1) P17405 OX-2 membrane glycoprotein (CD200) P41217 Tenascin-R (TN-R) Q92752 Platelet-derived growth factor receptor alpha (PDGF-Ralpha) P16234 Testican-1 (SPOCK1) Q08629 Plexin-B1 (PLXNB1) O43157 Thy-1 membrane glycoprotein (THY 1) P04216 Plexin-B3 (PLXNB3) Q9ULL4 Transmembrane protease serine 5 (TMPRSS5) Q9H3S3 Poliovirus receptor (PVR) P15151 Tumor necrosis factor receptor superfamily member 12A (TNFRSF12A) Protogenin (PRTG) Q2VWP7 Tumor necrosis factor receptor superfamily member 21 (TNFRSF21) Repulsive guidance molecule A (RGMA) Q96B86 Tumor necrosis factor receptor superfamily member 27 (EDA2R) RGM domain family member B (RGMB) Q6NW40 WAP, Kazal, immunoglobulin, Kunitz and NTR domaincontaining protein 1 (WFIKKN1) Q9NP84 O75509 Q9HAV5 Q96NZ8 Synaptic function Axon guidance Neurology: miscellaneous Exploratory: cellular regulation Exploratory: immunology, development & metabolism Neural development: miscellaneous Neurological disease associated Figure 1. Proseek Multiplex Neurology I 96x96 protein biomarker categories. This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB. 1035, v.1.1, Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden
9 Proseek Multiplex Oncology I I '-nucleotidase (5'-NT) P21589 Galectin-1 (Gal-1) P09382 A disintegrin and metalloproteinase with thrombospondin motifs 15 (ADAM-TS 15) Q8TE58 Glypican-1 (GPC1) P35052 Alpha-taxilin (TXLNA) P40222 Granzyme B (GZMB) P10144 Amphiregulin (AR) P15514 Granzyme H (GZMH) P20718 Annexin A1 (ANXA1) P04083 Hepatocyte growth factor (HGF) P14210 Carbonic anhydrase 9 (CA9) Q16790 ICOS ligand (ICOSLG) O75144 Carboxypeptidase E (CPE) P16870 Insulin-like growth factor 1 receptor (IGF1R) P08069 Carcinoembryonic antigen-related cell adhesion molecule 1 (CEACAM1) Carcinoembryonic antigen-related cell adhesion molecule 5 (CEACAM5) P13688 Integrin alpha-v (ITGAV) P06756 P06731 Integrin beta-5 (ITGB5) P18084 Cathepsin L2 (CTSV) O60911 Interferon gamma receptor 1 (IFN-gamma-R1) P15260 CD27 antigen (CD27) P26842 Interleukin-6 (IL-6) P05231 CD48 antigen (CD48) P09326 Kallikrein-8 (hk8) O60259 CD70 antigen (CD70) P32970 Kallikrein-11 (hk11) Q9UBX7 CD160 antigen (CD160) O95971 Kallikrein-13 (KLK13) Q9UKR3 Cornulin (CRNN) Q9UBG3 Kallikrein-14 (hk14) Q9P0G3 C-type lectin domain family 4 member K (CD207) Q9UJ71 Ly6/PLAUR domain-containing protein 3 (LYPD3) O95274 C-X-C motif chemokine 13 (CXCL13) O43927 Melanoma-derived growth regulatory protein (MIA) Q16674 Cyclin-dependent kinase inhibitor 1 (DKN1A) P38936 Mesothelin (MSLN) Q13421 Delta-like protein 1 (DLL1) O00548 Methionine aminopeptidase 2 (MetAP 2) P50579 Disintegrin and metalloproteinase domaincontaining protein 8 (ADAM 8) P78325 MHC class I polypeptide-related sequence A/B (MIC-A/B) Q29983, Q29980 Endothelial cell-specific molecule 1 (ESM-1) Q9NQ30 Midkine (MK) P21741 Ephrin type-a receptor 2 (EPHA2) P29317 Mothers against decapentaplegic homolog 5 (MAD homolog 5) Q99717 FAS-associated death domain protein (FADD) Q13158 Mucin-16 (MUC-16) Q8WXI7 Fc receptor-like B (FCRLB) Q6BAA4 Nectin-4 (PVRL4) Q96NY8 Fibroblast growth factor-binding protein 1 (FGF- BP1) Q14512 Pancreatic prohormone (PPY) P01298 Folate receptor alpha (FR-alpha) P15328 Podocalyxin (PODXL) O00592 Folate receptor gamma (FR-gamma) P41439 Pro-epidermal growth factor (EGF) P01133 Furin (FURIN) P09958 Protein CYR61 (CYR61) O00622 Table continues on reverse
10 Proseek Multiplex Oncology I I Protein S100-A11 (S100A11) P31949 Transforming growth factor alpha (TGF-alpha) P01135 Protein S100-A4 (S100A4) P26447 Transmembrane glycoprotein NMB (GPNMB) Q14956 Proto-oncogene tyrosine-protein kinase receptor Ret (RET) P07949 Tumor necrosis factor ligand superfamily member 6 (FASLG) P48023 Receptor tyrosine-protein kinase erbb-2 (ERBB2) P04626 Tumor necrosis factor ligand superfamily member 13 (TNFSF13) Receptor tyrosine-protein kinase erbb-3 (ERBB3) P21860 Tumor necrosis factor receptor superfamily member 4 (TNFRSF4) Receptor tyrosine-protein kinase erbb-4 (ERBB4) Q15303 Tumor necrosis factor receptor superfamily member 6B (TNFRSF6B) R-spondin-3 (RSPO3) Q9BXY4 Tumor necrosis factor receptor superfamily member 19 (TNFRSF19) O75888 P43489 O95407 Q9NS68 Secretory carrier-associated membrane protein 3 (SCAMP3) O14828 Tyrosine-protein kinase ABL1 (ABL1) P00519 Seizure 6-like protein (SEZ6L) Q9BYH1 Tyrosine-protein kinase Lyn (LYN) P07948 SPARC (SPARC) P09486 WAP four-disulfide core domain protein 2 (WFDC2) Q14508 Stem cell factor (SCF) P21583 Vascular endothelial growth factor A (VEGF-A) P15692 Syndecan-1 (SYND1) P18827 Vascular endothelial growth factor receptor 2 (VEGFR-2) T-cell leukemia / lymphoma protein 1A (TCL1A) P56279 Vascular endothelial growth factor receptor 3 (VEGFR-3) P35968 P35916 TGF-beta receptor type-2 (TGFR-2) P37173 VEGF-co regulated chemokine 1 (CXL17) Q6UXB2 Tissue factor pathway inhibitor 2 (TFPI-2) P48307 Vimentin (VIM) P08670 T-lymphocyte surface antigen Ly-9 (LY9) Q9HBG7 Wnt inhibitory factor 1 (WIF-1) Q9Y5W5 TNF-related apoptosis-inducing ligand (TRAIL) P50591 WNT1-inducible-signaling pathway protein 1 (WISP-1) O95388 Toll-like receptor 3 (TLR3) O43895 Xaa-Pro aminopeptidase 2 (XPNPEP2) O43895 Invasion and metastasis Tumor-specific marker Angiogenesis Apoptosis Immune response Cell differentiation & adhesion Exploratory Cell proliferation Figure 1. Proseek Multiplex Oncology II 96x96 protein biomarker categories. This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB. 1032, v. 1.1, Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden
11 Proseek Multiplex Immuno-Onc I Adenosine deaminase (ADA) P00813 C-X-C motif chemokine 13 (CXCL13) O43927 Adhesion G-protein coupled receptor G1 (ADGRG1) Q9Y653 Cytotoxic and regulatory T-cell molecule (CRTAM) O95727 Angiopoietin-1 (ANG-1) Q15389 Decorin (DCN) P07585 Angiopoietin-1 receptor (TIE2) Q02763 Fas antigen ligand (FasL) P48023 Angiopoietin-2 (ANG-2) O15123 Fibroblast growth factor 2 (FGF-2) P09038 Arginase-1 (ARG-1) P05089 Fractalkine (CX3CL1) P78423 Carbonic anhydrase 9 (CA9) Q16790 Galectin-1 (Gal-1) P09382 Caspase-8 (CASP-8) Q14790 Galectin-9 (Gal-9) O00182 C-C motif chemokine 2 (CCL2) P13500 Granzyme A (GZMA) P12544 C-C motif chemokine 3 (CCL3 ) P10147 Granzyme B (GZMB) P10144 C-C motif chemokine 4 (CCL4 ) P13236 Granzyme H (GZMH) P20718 C-C motif chemokine 7 (CCL7 ) P80098 Heme oxygenase 1 (HO-1) P09601 C-C motif chemokine 8 (CCL8 ) P80075 Hepatocyte growth factor (HGF) P14210 C-C motif chemokine 13 (CCL13 ) Q99616 ICOS ligand (ICOSLG) O75144 C-C motif chemokine 17 (CCL17) Q92583 Interferon beta (IFN-beta) P01574 C-C motif chemokine 19 (CCL19 ) Q99731 Interferon gamma (IFN-gamma) P01579 C-C motif chemokine 20 (CCL20 ) P78556 Interleukin-1 alpha (IL-1 alpha) P01583 C-C motif chemokine 23 (CCL23 ) P55773 Interleukin-2 (IL-2) P60568 CD27 antigen (CD27) P26842 Interleukin-4 (IL-4) P05112 CD40 ligand (CD40-L) P29965 Interleukin-5 (IL-5) P05113 CD40L receptor (CD40) P25942 Interleukin-6 (IL-6) P05231 CD70 antigen (CD70) P32970 Interleukin-7 (IL-7) P13232 CD83 antigen (CD83) Q01151 Interleukin-8 (IL-8) P10145 C-X-C motif chemokine 1 (CXCL1) P09341 Interleukin-10 (IL-10) P22301 C-X-C motif chemokine 5 (CXCL5) P42830 Interleukin-12 (IL-12) P29459 P29460 C-X-C motif chemokine 9 (CXCL9) Q07325 Interleukin-12 receptor subunit beta-1 (IL12RB1) P42701 C-X-C motif chemokine 10 (CXCL10) P02778 Interleukin-13 (IL-13) P35225 C-X-C motif chemokine 11 (CXCL11) O14625 Interleukin-18 (IL-18) Q14116 Table continues on reverse
12 Proseek Multiplex Immuno-Onc I Interleukin-21 (IL-21) Q9HBE4 Programmed cell death 1 ligand 2 (PD-L2) Q9BQ51 Interleukin-33 (IL-33) O95760 Programmed cell death protein 1 (PDCD1) Q15116 Interleukin-35 (IL-35) Q14213 Stromal cell-derived factor 1 (SDF-1) P48061 Latency-associated peptide transforming growth factor beta-1 (LAP TGF-beta-1) Lysosome-associated membrane glycoprotein 3 (LAMP-3) P01137 T-cell surface glycoprotein CD4 (CD4) P01730 Q9UQV4 T-cell surface glycoprotein CD5 (CD5) P06127 Macrophage colony-stimulating factor 1 (CSF-1) P09603 T-cell surface glycoprotein CD8 alpha chain (CD8A) P01732 Macrophage metalloelastase (MME) P39900 T-cell-specific surface glycoprotein CD28 (CD28) P10747 Matrix metalloproteinase-7 (MMP7) P09237 TNF-related apoptosis-inducing ligand (TRAIL) P50591 MHC class I polypeptide-related sequence A/B (MIC- A/B) Q29983, Q29980 Tumor necrosis factor (TNF) P01375 Natural cytotoxicity triggering receptor (NCR1) O76036 Tumor necrosis factor ligand superfamily member 12 (TWEAK) Natural killer cell receptor 2B4 (CD244) Q9BZW8 Tumor necrosis factor ligand superfamily member 14 (TNFSF14) Natural killer cells antigen CD94 (KLRD1) Q13241 Tumor necrosis factor receptor superfamily member 4 (TNFRSF4) Nitric oxide synthase, endothelial (NOS3) P29474 Tumor necrosis factor receptor superfamily member 9 (TNFRSF9) Placenta growth factor (PlGF) P49763 Tumor necrosis factor receptor superfamily member 12A (TNFRSF12A) O43508 O43557 P43489 Q07011 Q9NP84 Platelet-derived growth factor subunit B (PDGF subunit B) P01127 Tumor necrosis factor receptor superfamily member 21 (TNFRSF21) O75509 Pleiotrophin (PTN) P21246 Vascular endothelial growth factor A (VEGF-A) P15692 Pro-epidermal growth factor (EGF) P01133 Vascular endothelial growth factor C (VEGF-C) P49767 Programmed cell death 1 ligand 1 (PD-L1) Q9NZQ7 Vascular endothelial growth factor receptor 2 (VEGFR-2) P35968 Figure 1. Number of protein biomarkers in each immuno-oncology related category. Note that biomarkers can fall into multiple categories. This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB v Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden info@olink.com
13 Proseek Multiplex Metabolism Adenosylhomocysteinase (AHCY) P23526 Fc receptor-like protein 1 (FCRL1) Q96LA6 Adhesion G protein-coupled receptor E2 (ADGRE2) Q9UHX3 Fructose-1,6-bisphosphatase 1 (FBP1) P09467 Adhesion G-protein coupled receptor G2 (ADGRG2) Q8IZP9 Galanin peptides (GAL) P22466 Amyloid-like protein 1 (APLP1) P51693 Gamma-enolase (ENO2) P09104 Angiopoietin-2 (ANGPT2) O15123 Glutaredoxin-1 (GLRX) P35754 Angiopoietin-related protein 1 (ANGPTL1) O95841 GRB2-related adapter protein 2 (GRAP2) O75791 Angiopoietin-related protein 7 (ANGPTL7) O43827 Hepatoma-derived growth factor (HDGF) P51858 Annexin A4 (ANXA4) P09525 Inactive tyrosine-protein kinase transmembrane receptor ROR1 (ROR1) Q01973 Annexin A11 (ANXA11) P50995 Insulin-like growth factor-binding protein-like 1 (IGFBPL1) Q8WX77 Appetite-regulating hormone (GHRL) Q9UBU3 Integrin beta-7 (ITGB7) P26010 Arginase-1 (ARG1) P05089 Kallikrein-10 (KLK10) O43240 Aromatic-L-amino-acid decarboxylase (DDC) P20711 Kynurenine--oxoglutarate transaminase 1 (KYAT1) Q16773 B-cell antigen receptor complex-associated protein beta chain (CD79B) P40259 Large proline-rich protein BAG6 (BAG6) P46379 Cadherin-2 (CDH2) P19022 Leucine-rich repeats and immunoglobulin-like domains protein 1 (LRIG1) Q96JA1 Cadherin-related family member 5 (CDHR5) Q9HBB8 Leukocyte immunoglobulin-like receptor subfamily A member 5 (LILRA5) A6NI73 Calsyntenin-2 (CLSTN2) Q9H4D0 Low-density lipoprotein receptor-related protein 11 (LRP11) Q86VZ4 Carbonic anhydrase 13 (CA13) Q8N1Q1 Lysophosphatidic acid phosphatase type 6 (ACP6) Q9NPH0 Catechol O-methyltransferase (COMT) P21964 Meprin A subunit beta (MEP1B) Q16820 Cathepsin O (CTSO) P43234 Meteorin-like protein (METRNL) Q641Q3 CD2-associated protein (CD2AP) Q9Y5K6 Multiple coagulation factor deficiency protein 2 (MCFD2) Q8NI22 Chordin-like protein 2 (CHRDL2) Q6WN34 NAD kinase (NADK) O95544 Clusterin-like protein 1 (CLUL1) Q15846 Nectin-2 (NECTIN2) Q92692 Coiled-coil domain-containing protein 80 (CCDC80) Q76M96 Neural proliferation differentiation and control protein 1 (NPDC1) Q9NQX5 Crk-like protein (CRKL) P46109 Neuronal pentraxin receptor (NPTXR) O95502 C-type lectin domain family 5 member A (CLEC5A) Q9NY25 Nodal modulator 1 (NOMO1) Q15155 CXADR-like membrane protein (CLMP) Q9H6B4 N-terminal prohormone brain natriuretic peptide (NT-proBNP) NA Diablo homolog, mitochondrial (DIABLO) Q9NR28 Paired immunoglobulin-like type 2 receptor beta (PILRB) Q9UKJ0 Dihydropteridine reductase (QDPR) P09417 Peptidyl-prolyl cis-trans isomerase FKBP4 (FKBP4) Q02790 Dipeptidyl peptidase 2 (DPP7) Q9UHL4 Phosphoprotein associated with glycosphingolipid-enriched microdomains 1 (PAG1) Q9NWQ8 Disabled homolog 2 (DAB2) P98082 Pro-cathepsin H (CTSH) P09668 DNA-(apurinic or apyrimidinic site) lyase (APEX1) P27695 Protein FAM3C (FAM3C) Q92520 Ectonucleoside triphosphate diphosphohydrolase 5 (ENTPD5) O75356 Protein phosphatase inhibitor 2 (PPP1R2) P41236 Ectonucleotide pyrophosphatase/phosphodiesterase family member 7 (ENPP7) Q6UWV6 Protein S100-P (S100P) P25815 Eosinophil cationic protein (RNASE3) P12724 Regenerating islet-derived protein 4 (REG4) Q9BYZ8 Table continues on reverse
14 Reticulon-4 receptor (RTN4R) Q9BZR6 Synaptosomal-associated protein 23 (SNAP23) O00161 Retinal dehydrogenase 1 (ALDH1A1) P00352 Syndecan-4 (SDC4) P31431 Ribosyldihydronicotinamide dehydrogenase [quinone] (NQO2) P16083 T-cell surface glycoprotein CD1c (CD1C) P29017 Scavenger receptor cysteine-rich domain-containing group B protein (SSC4D) Q8WTU2 Thimet oligopeptidase (THOP1) P52888 Sclerostin (SOST) Q9BQB4 Thioredoxin domain-containing protein 5 (TXNDC5) Q8NBS9 Semaphorin-3F (SEMA3F) Q13275 Thymidine phosphorylase (TYMP) P19971 Serpin B6 (SERPINB6) P35237 Thyrotropin subunit beta (TSHB) P01222 Serpin B8 (SERPINB8) P50452 Trefoil factor 2 (TFF2) Q03403 Sialic acid-binding Ig-like lectin 7 (SIGLEC7) Q9Y286 Tubulointerstitial nephritis antigen-like (TINAGL1) Q9GZM7 Sialomucin core protein 24 (CD164) Q04900 Tyrosine-protein kinase receptor TYRO3 (TYRO3) Q06418 Soluble calcium-activated nucleotidase 1 (CANT1) Q8WVQ1 Ubiquitin carboxyl-terminal hydrolase 8 (USP8) P40818 Sulfatase-modifying factor 2 (SUMF2) Q8NBJ7 Versican core protein (VCAN) P13611 Biological Process Disease Area Response to stress Response to hypoxia Response to drug Renal system development Regulation of phosphorylation Other GO terms Inflammatory response Hormone secretion Cellular metabolic process Cell surface receptor signaling pathway Cell cycle Cell adhesion Apoptotic process Number of proteins Neurological, 43 Metabolic, 18 Inflammatory, 8 Pulmonary, 15 Other diseases, 61 Skeletal, 12 Infectious, 15 Cancer, 74 Cardiovascular, 28 Digestive, 12 Hemic and Lymphatic, 10 Tissue Expression Protein Class Widely expressed Urinary bladder Tonsil Thyroid gland Stomach Spleen Smooth muscle Small intestine Rectum Prostate Placenta Ovary Lymph node Liver Kidney Heart muscle Gallbladder Fallopian tube Esophagus Endometrium Duodenum Colon Cerebral cortex Bone marrow Appendix Adrenal gland Adipose tissue Number of proteins Transporters, 2 Secreted proteins, 39 Other protein classes, 40 Plasma proteins, 43 Mitochondrial proteins, 1 CD markers, 9 Membrane proteins, 29 Enzymes, 29 G-protein coupled receptors, 2 Intracellular proteins, 62 Classification of biomarker proteins included in the panel based on Biological Process, Disease Area, Tissue Expression and Protein Class. Note that proteins may belong to multiple classes in some cases. For more details visit This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB v Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden info@olink.com
15 Proseek Multiplex Immune Response Allergin-1 (MILR1) Q7Z6M3 Histamine N-methyltransferase (HNMT) P50135 Amphiregulin (AR) (AREG) P15514 Importin subunit alpha-5 (KPNA1) P52294 Aryl hydrocarbon receptor nuclear translocator (ARNT) P27540 Inactive dipeptidyl peptidase 10 (DPP10) Q8N608 Baculoviral IAP repeat-containing protein 2 (BIRC2) Q13490 Integral membrane protein 2A (ITM2A) O43736 Beta-galactosidase (GLB1) P16278 Integrin alpha-6 (ITGA6) P23229 Butyrophilin subfamily 3 member A2 (BTN3A2) P78410 Integrin alpha-11 (ITGA11) Q9UKX5 CD83 antigen (CD83) Q01151 Integrin beta-6 (ITGB6) P18564 Contactin-associated protein-like 2 (CNTNAP2) Q9UHC6 Interferon lambda receptor 1 (IFNLR1) Q8IU57 Corneodesmosin (CDSN) Q15517 Interferon regulatory factor 9 (IRF9) Q00978 Corticosteroid 11-beta-dehydrogenase isozyme 1 (HSD11B1) P28845 Interleukin-1 receptor-associated kinase 1 (IRAK1) P51617 Coxsackievirus and adenovirus receptor (CXADR) P78310 Interleukin-1 receptor-associated kinase 4 (IRAK4) Q9NWZ3 C-type lectin domain family 4 member A (CLEC4A) Q9UMR7 Interleukin-5 (IL5) P05113 C-type lectin domain family 4 member C (CLEC4C) Q8WTT0 Interleukin-6 (IL6) P05231 C-type lectin domain family 4 member D (CLEC4D) Q8WXI8 Interleukin-10 (IL10) P22301 C-type lectin domain family 4 member G (CLEC4G) Q6UXB4 Interleukin-12 receptor subunit beta-1 (IL12RB1) P42701 C-type lectin domain family 6 member A (CLEC6A) Q6EIG7 Islet cell autoantigen 1 (ICA1) Q05084 C-type lectin domain family 7 member A (CLEC7A) Q9BXN2 Keratin, type I cytoskeletal 19 (KRT19) P08727 Cytoskeleton-associated protein 4 (CKAP4) Q07065 Leukocyte immunoglobulin-like receptor subfamily B member 4 (LILRB4) Q8NHJ6 Diacylglycerol kinase zeta (DGKZ) Q13574 Lymphocyte activation gene 3 protein (LAG3) P18627 Discoidin, CUB and LCCL domain-containing protein 2 (DCBLD2) Q96PD2 Lymphocyte antigen 75 (LY75) O60449 DNA fragmentation factor subunit alpha (DFFA) O00273 Lysosome-associated membrane glycoprotein 3 (LAMP3) Q9UQV4 Dual adapter for phosphotyrosine and 3-phosphotyrosine and 3-phosphoinositide (DAPP1) Q9UN19 Mannan-binding lectin serine protease 1 (MASP1) P48740 Dynactin subunit 1 (DCTN1) Q14203 Merlin (NF2) P35240 E3 ubiquitin-protein ligase TRIM21 (TRIM21) P19474 Methylated-DNA--protein-cysteine methyltransferase (MGMT) P16455 Egl nine homolog 1 (EGLN1) Q9GZT9 Natural cytotoxicity triggering receptor 1 (NCR1) O76036 Eotaxin (CCL11) P51671 Natural killer cells antigen CD94 (KLRD1) Q13241 Eukaryotic translation initiation factor 4 gamma 1 (EIF4G1) Q04637 Neurabin-2 (PPP1R9B) Q96SB3 Eukaryotic translation initiation factor 5A-1 (EIF5A) P63241 Neurotrophin-4 (NTF4) P34130 Fc receptor-like protein 3 (FCRL3) Q96P31 Nuclear factor of activated T-cells, cytoplasmic 3 (NFATC3) Q12968 Fc receptor-like protein 6 (FCRL6) Q6DN72 Parathyroid hormone/parathyroid hormone-related peptide receptor (PTH1R) Q03431 Fibroblast growth factor 2 (FGF2) P09038 PC4 and SFRS1-interacting protein (PSIP1) O75475 FXYD domain-containing ion transport regulator 5 (FXYD5) Q96DB9 Peroxiredoxin-1 (PRDX1) Q06830 Hematopoietic lineage cell-specific protein (HCLS1) P14317 Peroxiredoxin-5, mitochondrial (PRDX5) P30044 Table continues on reverse
16 Phosphoinositide 3-kinase adapter protein 1 (PIK3AP1) Q6ZUJ8 Stanniocalcin-1 (STC1) P52823 Plexin-A4 (PLXNA4) Q9HCM2 Stromal cell-derived factor 1 (CXCL12) P48061 Polypeptide N-acetylgalactosaminyltransferase 3 (GALNT3) Q14435 T-cell-specific surface glycoprotein CD28 (CD28) P10747 Probable ATP-dependent RNA helicase DDX58 (DDX58) O95786 Thioredoxin-dependent peroxide reductase, mitochondrial (PRDX3) P30048 Protein FAM3B (FAM3B) P58499 TNF receptor-associated factor 2 (TRAF2) Q12933 Protein HEXIM1 (HEXIM1) O94992 TRAF family member-associated NF-kappa-B activator (TANK) Q92844 Protein kinase C theta type (PRKCQ) Q04759 Transcription factor AP-1 (JUN) P05412 Protein sprouty homolog 2 (SPRY2) O43597 Transcription regulator protein BACH1 (BACH1) O14867 Protein-arginine deiminase type-2 (PADI2) Q9Y2J8 Triggering receptor expressed on myeloid cells 1 (TREM1) Q9NP99 SH2 domain-containing protein 1A (SH2D1A) O60880 Tripartite motif-containing protein 5 (TRIM5) Q9C035 SH2B adapter protein 3 (SH2B3) Q9UQQ2 Tryptase alpha/beta-1 (TPSAB1) Q15661 Signaling threshold-regulating transmembrane adapter 1 (SIT1) Q9Y3P8 Tumor necrosis factor receptor superfamily member EDAR (EDAR) Q9UNE0 SRSF protein kinase 2 (SRPK2) P78362 Zinc finger and BTB domain-containing protein 16 (ZBTB16) Q05516 Biological Process Disease Area T cell proliferation Response to hypoxia Regulation of gene expression Regulation of cell proliferation Other go terms Mast cell activation Lymphocyte activation Intracellular signal transduction Inflammatory response Immune response Defense response to virus Cytokine-mediated signaling pathway Cell differentiation Cell adhesion Apoptotic process Adaptive immune response Pulmonary, 32 Other diseases, 67 Neurological, 51 Metabolic, 17 Skeletal, 28 Inflammatory, 37 Cancer, 67 Cardiovascular, 31 Cutaneous, 29 Digestive, 13 Infectious, Number of proteins Tissue Expression Protein Class Widely expressed Tonsil Testis Spleen Smooth muscle Small intestine Skin Skeletal muscle Placenta Lymph node Lung Liver Kidney Heart muscle Endometrium Duodenum Cerebral cortex Bone marrow Appendix Adrenal gland Adipose tissue Number of proteins Secreted proteins, 21 Plasma proteins, 30 Other protein classes, 61 Transcription factors, 6 Transporters, 2 Mitochondrial proteins, 3 CD markers, 13 Membrane proteins, 40 Cytoskeleton related proteins, 2 Enzymes, 19 G-protein coupled receptors, 1 Intracellular proteins, 67 Classification of biomarker proteins included in the panel based on Biological Process, Disease Area, Tissue Expression and Protein Class. Note that proteins may belong to multiple classes in some cases. For more details visit This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB v Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden info@olink.com
17 Proseek Multiplex Organ Damage 5'-AMP-activated protein kinase subunit beta-1 (PRKAB1) Q9Y478 Inactive tyrosine-protein kinase 7 (PTK7) Q13308 Adhesion G-protein coupled receptor G1 (ADGRG1) Q9Y653 Integrin beta-1-binding protein 1 (ITGB1BP1) O14713 Aldehyde dehydrogenase, dimeric NADP-preferring (ALDH3A1) P30838 Interferon-inducible double-stranded RNA-dependent protein kinase activator A (PRKRA) O75569 Anterior gradient protein 2 homolog (AGR2) O95994 Kidney Injury Molecule (KIM1) Q96D42 Apoptosis-inducing factor 1, mitochondrial (AIFM1) O95831 Leukotriene A-4 hydrolase (LTA4H) P09960 B-cell scaffold protein with ankyrin repeats (BANK1) Q8NDB2 Linker for activation of T-cells family member 2 (LAT2) Q9GZY6 BH3-interacting domain death agonist (BID) P55957 Lutropin subunit beta (LHB) P01229 BMP and activin membrane-bound inhibitor homolog (BAMBI) Q13145 Macrophage erythroblast attacher (MAEA) Q7L5Y9 Calcitonin (CALCA) P01258 Macrophage-capping protein (CAPG) P40121 Calreticulin (CALR) P27797 Melanoma-associated antigen D1 (MAGED1) Q9Y5V3 Carbonic anhydrase 12 (CA12) O43570 Methionine aminopeptidase 1 (METAP1) P53582 Carbonic anhydrase 14 (CA14) Q9ULX7 Mevalonate kinase (MVK) Q03426 Casein kinase I isoform delta (CSNK1D) P48730 Mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5) Q9Y4K4 Claspin (CLSPN) Q9HAW4 Mothers against decapentaplegic homolog 1 (SMAD1) Q15797 CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 1 (ST3GAL1) Q11201 NAD-dependent protein deacylase sirtuin-5, mitochondrial (SIRT5) Q9NXA8 Cocaine esterase (CES2) O00748 NEDD8 ultimate buster 1 (NUB1) Q9Y5A7 Contactin-2 (CNTN2) Q02246 Neutrophil cytosol factor 2 (NCF2) P19878 Corticoliberin (CRH) P06850 Nibrin (NBN) O60934 C-type lectin domain family 1 member A (CLEC1A) Q8NC01 Nitric oxide synthase, endothelial (NOS3) P29474 C-type natriuretic peptide (NPPC) P23582 Nucleobindin-2 (NUCB2) P80303 Desmoglein-4 (DSG4) Q86SJ6 Parvalbumin alpha (PVALB) P20472 Dipeptidyl aminopeptidase-like protein 6 (DPP6) P42658 Paxillin (PXN) P49023 DNA topoisomerase 2-beta (TOP2B) Q02880 Peptidyl-prolyl cis-trans isomerase FKBP1B (FKBP1B) P68106 Ectonucleoside triphosphate diphosphohydrolase 2 (ENTPD2) Q9Y5L3 Perilipin-1 (PLIN1) O60240 Ectonucleoside triphosphate diphosphohydrolase 6 (ENTPD6) O75354 Phosphatidylinositol 3,4,5-trisphosphate 5-phosphatase 2 (INPPL1) O15357 EGF-like repeat and discoidin I-like domain-containing protein 3 (EDIL3) O43854 Placenta growth factor (PGF) P49763 Enteropeptidase (TMPRSS15) P98073 Platelet-derived growth factor C (PDGFC) Q9NRA1 Epidermal growth factor-like protein 7 (EGFL7) Q9UHF1 Pleiotrophin (PTN) P21246 Erbin (ERBIN) Q96RT1 Plexin domain-containing protein 1 (PLXDC1) Q8IUK5 Erythropoietin (EPO) P01588 Polypeptide N-acetylgalactosaminyltransferase 10 (GALNT10) Q86SR1 Fatty acid-binding protein 9 (FABP9) Q0Z7S8 Probetacellulin (BTC) P35070 Forkhead box protein O1 (FOXO1) Q12778 Programmed cell death protein 1 (PDCD1) Q15116 Fructose-2,6-bisphosphatase TIGAR (TIGAR) Q9NQ88 Prolow-density lipoprotein receptor-related protein 1 (LRP1) Q07954 Hematopoietic prostaglandin D synthase (HPGDS) O60760 Proteasome subunit alpha type-1 (PSMA1) P25786 Table continues on reverse
18 Protein amnionless (AMN) Q9BXJ7 Ribonucleoside-diphosphate reductase subunit M2 B (RRM2B) Q7LG56 Protein enabled homolog (ENAH) Q8N8S7 Serpin A9 (SERPINA9) Q86WD7 Protein fosb (FOSB) P53539 Serum paraoxonase/arylesterase 2 (PON2) Q15165 Protein max (MAX) P61244 Syntaxin-8 (STX8) Q9UNK0 Protein phosphatase 1B (PPM1B) O75688 Syntaxin-binding protein 3 (STXBP3) O00186 [Pyruvate dehydrogenase [acetyl-transferring]]-phosphatase 1, mitochondrial (PDP1) Q9P0J1 Troponin I, cardiac muscle (TNNI3) P19429 Ras association domain-containing protein 2 (RASSF2) P50749 Tyrosine-protein kinase Fes/Fps (FES) P07332 Ras GTPase-activating protein 1 (RASA1) P20936 Tyrosine-protein kinase Fgr (FGR) P09769 Receptor-type tyrosine-protein phosphatase eta (PTPRJ) Q12913 Tyrosine-protein kinase Yes (YES1) P07947 Renin receptor (ATP6AP2) O75787 Vascular endothelial growth factor C (VEGFC) P49767 REST corepressor 1 (RCOR1) Q9UKL0 Vasohibin-1 (VASH1) Q7L8A9 Retinoic acid receptor responder protein 1 (RARRES1) P49788 Wiskott-Aldrich syndrome protein (WAS) P42768 Biological Process Disease Area Response to stress Response to peptide hormone Response to drug Reproduction Renal system development Regulation of cell proliferation Peptide metabolic process Other GO terms Neurogenesis Metal ion transport Growth Fatty acid metabolic process Erythrocyte maturation Epithelial cell differentiation DNA repair Cytokine secretion Chemical homeostasis Cell death Cell cycle Blood vessel morphogenesis Apoptotic process Hemic and Lymphatic, 9 Metabolic, 34 Pulmonary, 10 Other diseases, 48 Inflammatory, 11 Infectious, 16 Renal, 25 Hepatic, 9 Cancer, 65 Cutaneous, 12 Cardiovascular, 41 Digestive, 10 Neurological, Number of proteins Tissue Expression Widely expressed Tonsil Thyroid gland Stomach Spleen Small intestine Skeletal muscle Rectum Prostate Placenta Pancreas Ovary Not reported Lymph node Liver Kidney Heart muscle Esophagus Endometrium Duodenum Colon Cerebral cortex Appendix Adipose tissue Number of proteins Secreted proteins, 27 Plasma proteins, 23 Other protein classes, 74 Transcription factors, 5 Protein Class Transporters, 4 Mitochondrial proteins, 3 CD markers, 3 Membrane proteins, 22 Cytoskeleton related proteins, 8 Enzymes, 29 G-protein coupled receptors, 1 Intracellular proteins, 66 Classification of biomarker proteins included in the panel based on Biological Process, Disease Area, Tissue Expression and Protein Class. Note that proteins may belong to multiple classes in some cases. For more details visit This product is sold under license from PHRI Properties, Inc. and may be used under the PHRI Properties patent rights outside the field of human in vitro diagnostics. Proseek is a trademark of Olink AB. All third party trademarks are the property of their respective owners. Copyright 2016 Olink Proteomics AB v Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden info@olink.com
Supplemental Material
Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin
More informationDATA PACKAGE. Multiplex CVD I 96 96
DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit
More informationVALIDATION DATA. Multiplex CVD II 96 96
VALIDATION DATA Multiplex CVD II 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Quality Controls 3 1.3 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical
More informationData Package. Multiplex Oncology I 96 96
Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection
More informationExtend and pre-amplify 92 unique DNA reporter sequences by proximity extension.
VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationCytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
More informationTNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationSUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
More informationThe Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
More informationELISA kits for Cancer
ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationFirePlex Multiplex Immunoassay product list
FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes
More informationSUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationProtein Uniprot ID Panel(s)
Protein Uniprot ID Panel(s) [Pyruvate dehydrogenase [acetyl-transferring]]-phosphatase 1, mitochondrial (PDP1) Q9P0J1 OD 2,4-dienoyl-CoA reductase, mitochondrial (DECR1) Q16698 CVD II 26S proteasome non-atpase
More informationDilution Factor Serum Plasma Urine CSF (Other)
R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations
More informationAVAILABLE BIOMARKER ASSAYS
AAILABLE BIOMARKER ASSAYS alidation Alpha-2-microglobulin ELISA Anti-CD71/anti-platelet/propidium iodide Anti-KLH IgG ELISA,, Dog, Minipig, Apoptotic, necrotic and dead cells (bone marrow) B (activated
More informationEffects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )
1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo
More informationSupplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationulcer healing role 118 Bicarbonate, prostaglandins in duodenal cytoprotection 235, 236
Subject Index Actin cellular forms 48, 49 epidermal growth factor, cytoskeletal change induction in mucosal repair 22, 23 wound repair 64, 65 polyamine effects on cytoskeleton 49 51 S-Adenosylmethionine
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationGenetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
More informationSupplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationSubject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More information* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationAdditional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationCell signaling. How do cells receive and respond to signals from their surroundings?
Cell signaling How do cells receive and respond to signals from their surroundings? Prokaryotes and unicellular eukaryotes are largely independent and autonomous. In multicellular organisms there is a
More informationACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationCO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
More informationMechanisms of Gene Regulation and Signal! Transduction in Hypoxia!
Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Lorenz Poellinger! Dept. of Cell and Molecular Biology! Karolinska Institutet, Stockholm, Sweden! Normoxia - O 2 availability is in balance
More informationAssessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018
Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect
More informationTable 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
More informationSupplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p
More informationACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY
ACTIVATION OF T LYMPHOCYTES AND CELL MEDIATED IMMUNITY The recognition of specific antigen by naïve T cell induces its own activation and effector phases. T helper cells recognize peptide antigens through
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationT cell and Cell-mediated immunity
T cell and Cell-mediated immunity ( 第十章 第十二章第十二章 ) Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, School of Medicine Medical Research Building B815-819
More informationChapter 20. Cell - Cell Signaling: Hormones and Receptors. Three general types of extracellular signaling. endocrine signaling. paracrine signaling
Chapter 20 Cell - Cell Signaling: Hormones and Receptors Three general types of extracellular signaling endocrine signaling paracrine signaling autocrine signaling Endocrine Signaling - signaling molecules
More informationTissue repair. (3&4 of 4)
Tissue repair (3&4 of 4) What will we discuss today: Regeneration in tissue repair Scar formation Cutaneous wound healing Pathologic aspects of repair Regeneration in tissue repair Labile tissues rapid
More informationSOMAmer Reagents Generated to Human Proteins
The exact content of any pre-specified menu offered by SomaLogic may be altered on an ongoing basis, including the addition of SOMAmer reagents as they are created, and the removal of others if deemed
More informationPrepared by Cyrus H. Nozad, MD, University of Tennessee and John Seyerle, MD, Ohio State University
Allergy and Immunology Review Corner: Chapter 21 of Middleton s Allergy Principles and Practice, Seventh Edition, edited by N. Franklin Adkinson, et al. Chapter 21: Antigen-Presenting Dendritic Cells (Pages
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationsilent epidemic,. (WHO),
Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining
More informationSupplementary Online Content
Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064
More informationSOMAmer Reagents Generated to Human Proteins
The exact content of any pre specified menu offered by SomaLogic may be altered on an ongoing basis, including the addition of SOMAmer reagents as they are created, and the removal of others if deemed
More informationCell Signaling (part 1)
15 Cell Signaling (part 1) Introduction Bacteria and unicellular eukaryotes respond to environmental signals and to signaling molecules secreted by other cells for mating and other communication. In multicellular
More informationG-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
More informationChapter 15: Signal transduction
Chapter 15: Signal transduction Know the terminology: Enzyme-linked receptor, G-protein linked receptor, nuclear hormone receptor, G-protein, adaptor protein, scaffolding protein, SH2 domain, MAPK, Ras,
More informationCell Cell Communication
IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate
More informationGrowth Factors. BIT 230 Walsh Chapter 7
Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of
More informationCD Marker Antibodies. atlasantibodies.com
CD Marker Antibodies atlasantibodies.com CD Marker Antibodies Product Name Product Number Validated Applications Anti-ACE HPA029298 IHC,WB Anti-ACKR1 HPA016421 IHC Anti-ACKR1 HPA017672 IHC Anti-ADAM17
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationEffects of Second Messengers
Effects of Second Messengers Inositol trisphosphate Diacylglycerol Opens Calcium Channels Binding to IP 3 -gated Channel Cooperative binding Activates Protein Kinase C is required Phosphorylation of many
More informationT cell and Cell-mediated immunity
T cell and Cell-mediated immunity Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, it School of Medicine i Medical Research Building B815-819 Email: Lu.Linrong@gmail.com
More informationMedical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University
Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve
More informationInnate Immunity. Chapter 3. Connection Between Innate and Adaptive Immunity. Know Differences and Provide Examples. Antimicrobial peptide psoriasin
Chapter Know Differences and Provide Examples Innate Immunity kin and Epithelial Barriers Antimicrobial peptide psoriasin -Activity against Gram (-) E. coli Connection Between Innate and Adaptive Immunity
More informationThe recruitment of leukocytes and plasma proteins from the blood to sites of infection and tissue injury is called inflammation
The migration of a particular type of leukocyte into a restricted type of tissue, or a tissue with an ongoing infection or injury, is often called leukocyte homing, and the general process of leukocyte
More informationKEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
More informationT cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
More information1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
More informationTHE HALLMARKS OF CANCER
THE HALLMARKS OF CANCER ONCOGENES - Most of the oncogenes were first identified in retroviruses: EGFR (ErbB), Src, Ras, Myc, PI3K and others (slightly more than 30) - Mutated cellular genes incorporated
More informationVIII Curso Internacional del PIRRECV. Some molecular mechanisms of cancer
VIII Curso Internacional del PIRRECV Some molecular mechanisms of cancer Laboratorio de Comunicaciones Celulares, Centro FONDAP Estudios Moleculares de la Celula (CEMC), ICBM, Facultad de Medicina, Universidad
More informationREACTOME: Nonsense Mediated Decay (NMD) REACTOME:72764 Eukaryotic Translation Termination. REACTOME:72737 Cap dependent Translation Initiation
A REACTOME:975957 Nonsense Mediated Decay (NMD) enhanced by the Exon Junction Complex (EJC) REACTOME:975956 Nonsense Mediated Decay (NMD) independent of the Exon Junction Complex (EJC) REACTOME:927802
More informationSwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4
P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor
More informationSupplementary Table S1: Gene expression targets
Supplementary Table S1: Gene expression targets Probe ID Gene ID Gene Descriptions Cell type Antigen-dependent activation MmugDNA.32422.1.S1_at CD180 CD180 molecule B 1 MmugDNA.18254.1.S1_at CD19 CD19
More informationEffects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies
Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Abstract Background: Cardiovascular diseases account for the largest fraction of smoking-induced
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationTime course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationThe Tissue Engineer s Toolkit
The Tissue Engineer s Toolkit Stimuli Detection and Response Ken Webb, Ph. D. Assistant Professor Dept. of Bioengineering Clemson University Environmental Stimulus-Cellular Response Environmental Stimuli
More informationSupplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases
Supplementary Tables: Supplementary Table 1: List of the 242 hypoxia/reoxygenation marker genes collected from literature and databases Supplementary Table 2: Contingency tables used in the fisher exact
More informationCytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
More informationIMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS
LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the
More information1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
More informationChapter 9. Cellular Signaling
Chapter 9 Cellular Signaling Cellular Messaging Page 215 Cells can signal to each other and interpret the signals they receive from other cells and the environment Signals are most often chemicals The
More informationVets 111/Biov 111 Cell Signalling-2. Secondary messengers the cyclic AMP intracellular signalling system
Vets 111/Biov 111 Cell Signalling-2 Secondary messengers the cyclic AMP intracellular signalling system The classical secondary messenger model of intracellular signalling A cell surface receptor binds
More informationReceptors Functions and Signal Transduction L1- L2
Receptors Functions and Signal Transduction L1- L2 Faisal I. Mohammed, MD, PhD University of Jordan 1 Introduction to Physiology (0501110) Summer 2012 Subject Lecture No. Lecturer Pages in the 11 th edition.
More informationCytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones
Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological
More informationSupplementary Files. Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis
Supplementary Files Novel blood-based microrna biomarker panel for early diagnosis of chronic pancreatitis Lei Xin 1 *, M.D., Jun Gao 1 *, Ph.D., Dan Wang 1 *, M.D., Jin-Huan Lin 1, M.D., Zhuan Liao 1,
More informationBIOL 2458 A&P II CHAPTER 18 SI Both the system and the endocrine system affect all body cells.
BIOL 2458 A&P II CHAPTER 18 SI 1 1. Both the system and the endocrine system affect all body cells. 2. Affect on target cells by the system is slow. Affect on target cells by the system is fast. INTERCELLULAR
More informationAdaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,
Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development
More informationEnzyme-coupled Receptors. Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors
Enzyme-coupled Receptors Cell-surface receptors 1. Ion-channel-coupled receptors 2. G-protein-coupled receptors 3. Enzyme-coupled receptors Cell-surface receptors allow a flow of ions across the plasma
More informationImmunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
More informationPutting it Together. Stephen Canfield Secondary Lymphoid System. Tonsil Anterior Cervical LN s
Putting it Together Stephen Canfield smc12@columbia.edu Secondary Lymphoid System Tonsil Anterior Cervical LN s Axillary LN s Mediastinal/Retroperitoneal LN s Thoracic Duct Appendix Spleen Inguinal LN
More informationCholera host response gene networks: preliminary studies
www.bioinformation.net Volume 13(10) Hypothesis Cholera host response gene networks: preliminary studies Paul Shapshak 1 *, Charurut Somboonwit 1, 2, Shu Cao 1, John T. Sinnott 1, 2 1Division of Infectious
More information7/6/2009. The study of the immune system and of diseases that occur as a result of inappropriate or inadequate actions of the immune system.
Diseases of Immunity 2009 CL Davis General Pathology Paul W. Snyder, DVM, PhD Purdue University Acknowledgements Pathologic Basis of Veterinary Disease, 4 th Ed Veterinary Immunology, An Introduction 8
More informationINTERACTION DRUG BODY
INTERACTION DRUG BODY What the drug does to the body What the body does to the drug Receptors - intracellular receptors - membrane receptors - Channel receptors - G protein-coupled receptors - Tyrosine-kinase
More informationChapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues
Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages
More informationOverview of the immune system
Overview of the immune system Immune system Innate (nonspecific) 1 st line of defense Adaptive (specific) 2 nd line of defense Cellular components Humoral components Cellular components Humoral components
More information