Supplemental Material
|
|
|
- Dana Townsend
- 5 years ago
- Views:
Transcription
1 Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin Myte, Bethany Van Guelpen Table of Contents: Page Figure S (MetS and its components per individual over time) Figure S (Levels of MetS associated proteins (log) per individual over time) Figure S (Direction of protein-mets associations) 4 Figure S4 (Protein-protein associations of MetS associated proteins) Table S (Proteins included in Proseek Multiplex immunoassay panels) -
2 MetS, ICC:.4 BMI, ICC:.8 Triglycerides, ICC:. 4 Sex mid BP, ICC:.44 Blood glucose, ICC: Total cholsterol, ICC:. Men Women Change decrease increase 7 8 Age Figure S. Metabolic syndrome (MetS) and its components in the study participants over time. ICC: Intraclass correlation coefficient, i.e., proportion of total variance due to variation between individuals.
3 4.... FURIN HGF TNFSF4 FGF ERBB IL TNFSF OPG FGF BP ESM SEZL SCF Sampling time point Sex Men Women MetS Figure S. Direction of protein-metabolic syndrome (MetS) associations. Protein levels (log) plotted against MetS score, and regression lines with error bounds plotted without random intercepts for simplicity. The proteins are sorted according to size and direction of regression coefficient.
4 SEZL, ICC:.7 TNFSF, ICC:. FGF BP, ICC:. OPG, ICC:.8 ESM, ICC:.8 FURIN, ICC:.4 ERBB, ICC:. HGF, ICC:.4 Protein levels (log) Sampling time point Sex Men Women SCF, ICC:. FGF, ICC:.47 IL, ICC:.4 TNFSF4, ICC:. Participants Figure S. Levels of metabolic syndrome (MetS) associated proteins (log) per participant by sampling time point. The proteins are sorted according to ICC (ICC: Intra-class correlation coefficient, i.e., proportion of total variance due to variation between individuals.) 4
5 SCF SCF OPG ERBB SEZL ESM FGF BP.. HGF TNFSF4 FURIN IL FGF..... TNFSF OPG ERBB SEZL ESM FGF BP HGF TNFSF FURIN IL FGF TNFSF Figure S4. Partial correlations between metabolic syndrome (MetS) -associated proteins. Partial correlations were calculated by estimating Spearman s correlations on the standardized residuals from protein mixed models adjusting for age, sex, MetS, physical activity, smoking and education level. The black squares represent the two major clusters from a hierarchical cluster analysis on the correlations (using Euclidean distance with average linkage).
6 Table S. Proteins included in Proseek Multiplex immunoassay panels Protein UniProt No Immunoassay panel Comment Hepatocyte growth factor (HGF) P Both Interleukin- (IL-) P Both Stem cell factor (SCF) P8 Both Excluded from one panel TNF-related apoptosis-inducing ligand (TRAIL) P Both Excluded from one panel Transforming growth factor alpha (TGF-alpha) P Both Vascular endothelial growth factor A (VEGF-A) P Both Adenosine Deaminase (ADA) P8 Inflammation Artemin (ARTN) QT4W7 Inflammation Excluded (>% missing) Axin- (AXIN) O Inflammation Beta-nerve growth factor (Beta-NGF) P8 P8 Inflammation Brain-derived neurotrophic factor (BDNF) P Inflammation Caspase 8 (CASP-8 ) Q47 Inflammation C-C motif chemokine (CCL) Q7 Inflammation C-C motif chemokine (CCL) P78 Inflammation C-C motif chemokine (CCL) P77 Inflammation C-C motif chemokine (CCL) O444 Inflammation C-C motif chemokine 8 (CCL8) QNRJ Inflammation C-C motif chemokine 4 (CCL4 ) P Inflammation CDL receptor (CD) P4 Inflammation CUB domain-containing protein (CDCP) QHV8 Inflammation C-X-C motif chemokine (CXCL) P4 Inflammation C-X-C motif chemokine (CXCL) P778 Inflammation C-X-C motif chemokine (CXCL) O4 Inflammation C-X-C motif chemokine (CXCL) P48 Inflammation C-X-C motif chemokine (CXCL) P8 Inflammation C-X-C motif chemokine (CXCL ) Q7 Inflammation Cystatin D (CST) P8 Inflammation Delta and Notch-like epidermal growth factor-related recep (DNER) Q8NFT8 Inflammation Eotaxin- (CCL) P7 Inflammation Eukaryotic translation initiation factor 4E-binding protein (4E-BP) Q4 Inflammation Fibroblast growth factor (FGF-) O7 Inflammation Fibroblast growth factor (FGF-) QNSA Inflammation Fibroblast growth factor (FGF-) QGZV Inflammation Fibroblast growth factor (FGF-) Q8NF Inflammation Fms-related tyrosine kinase ligand (FltL) P477 Inflammation Fractalkine (CXCL ) P784 Inflammation Glial cell line-derived neurotrophic factor (hgdnf) P Inflammation Table continues on next page
7 Table S. Cont. Protein UniProt No Immunoassay panel Comment Interferon gamma (IFN-gamma) P7 Inflammation Interleukin- alpha (IL- alpha) P8 Inflammation Excluded (>% missing) Interleukin- (IL-) P Inflammation Interleukin- receptor subunit alpha (IL-RA) Q Inflammation Excluded (>% missing) Interleukin- receptor subunit beta (IL-RB) Q84 Inflammation Interleukin- subunit beta (IL-B) P4 Inflammation Interleukin- (IL-) P Inflammation Excluded (>% missing) Interleukin- receptor subunit alpha (IL-RA) Q Inflammation Interleukin-7A (IL-7A) Q Inflammation Interleukin-7C (IL-7C) QPM4 Inflammation Interleukin-8 (IL-8) Q4 Inflammation Interleukin-8 receptor (IL-8R) Q478 Inflammation Interleukin- (IL-) P8 Inflammation Excluded (>% missing) Interleukin- receptor subunit beta (IL-RB) P4784 Inflammation Excluded (>% missing) Interleukin- (IL-) QNYY Inflammation Excluded (>% missing) Interleukin- receptor subunit alpha (IL-RA) QUHF4 Inflammation Excluded (>% missing) Interleukin- receptor subunit alpha- (IL- RA) Q8NP7 Inflammation Excluded (>% missing) Interleukin-4 (IL-4) Q7 Inflammation Excluded (>% missing) Interleukin- (IL-) O7 Inflammation Excluded (>% missing) Interleukin-4 (IL-4) P Inflammation Excluded (>% missing) Interleukin- (IL-) P Inflammation Excluded (>% missing) Interleukin-7 (IL-7) P Inflammation Interleukin-8 (IL-8) P4 Inflammation Latency-associated peptide transforming growth factor beta (LAP TGFbeta-) P7 Inflammation Leukemia inhibitory factor (LIF) P8 Inflammation Excluded (>% missing) Leukemia inhibitory factor receptor (LIF-R) P47 Inflammation Macrophage colony-stimulating factor (CSF-) P Inflammation Macrophage inflammatory protein -alpha (MIP- alpha ) P47 Inflammation Excluded (>% missing) Matrix metalloproteinase- (MMP-) P Inflammation Matrix metalloproteinase- (MMP-) P8 Inflammation Monocyte chemotactic protein (MCP-) P Inflammation Monocyte chemotactic protein (MCP-) P87 Inflammation Monocyte chemotactic protein (MCP-) P88 Inflammation Monocyte chemotactic protein 4 (MCP-4) Q Inflammation Natural killer cell receptor B4 (CD44) QBZW8 Inflammation Neurotrophin- (NT-) P78 Inflammation Neurturin (NRTN) Q748 Inflammation Excluded (>% missing) Table continues on next page 7
8 Table S. Cont. Protein UniProt No Immunoassay panel Comment Oncostatin-M (OSM) P7 Inflammation Osteoprotegerin (OPG) O Inflammation Programmed cell death ligand (PD-L) QNZQ7 Inflammation Protein S-A (EN-RAGE ) P8 Inflammation Signaling lymphocytic activation molecule (SLAMF) Q Inflammation SIR-like protein (SIRT) Q8IXJ Inflammation STAM-binding protein (STAMPB) O Inflammation Sulfotransferase A (STA) P Inflammation T cell surface glycoprotein CD isoform (CD) Q8WWJ7 Inflammation T-cell surface glycoprotein CD (CD) P7 Inflammation Thymic stromal lymphopoietin (TSLP) QD Inflammation Excluded (>% missing) TNF-beta (TNFB) P74 Inflammation TNF-related activation-induced cytokine (TRANCE) O4788 Inflammation Tumor necrosis factor (Ligand) superfamily, member (TWEAK) Q4ACW Inflammation Tumor necrosis factor (TNF) P7 Inflammation Excluded (>% missing) Tumor necrosis factor ligand superfamily member 4 (TNFSF4) O47 Inflammation Tumor necrosis factor receptor superfamily member (TNFRSF) Q7 Inflammation Urokinase-type plasminogen activator (upa) P74 Inflammation '-nucleotidase ('-NT) P8 Oncology II A disintegrin and metalloproteinase with thrombospondin motifs (ADAM-TS ) Q8TE8 Oncology II A/B (MIC-A/B) Q8 Oncology II AlPha-taxilin (TXLNA) P Oncology II AmPhiregulin (AR) P4 Oncology II Annexin A (ANXA) P8 Oncology II Carbonic anhydrase (CA) Q7 Oncology II Carboxypeptidase E (CPE) P87 Oncology II Carcinoembryonic antigen-related celladhesion molecule (CEACAM) P88 Oncology II Carcinoembryonic antigen-related celladhesion molecule (CEACAM) P7 Oncology II Cathepsin L (CTSV) O Oncology II CD antigen (CD) O7 Oncology II CD7 antigen (CD7) P84 Oncology II CD48 antigen (CD48) P Oncology II CD7 antigen (CD7) P7 Oncology II Cornulin (CRNN) QUBG Oncology II C-type lectin domain family 4 member K(CD7) QUJ7 Oncology II C-X-C motif chemokine (CXCL) O47 Oncology II Cyclin-dependent kinase inhibitor (CDKNA) P8 Oncology II Excluded (>% missing) Table continues on next page 8
9 Table S. Cont. Protein UniProt No Immunoassay panel Comment Delta-like protein (DLL) O48 Oncology II Disintegrin and metalloproteinase domain-containing protein (ADAM8) P78 Oncology II Endothelial cell-specific molecule (ESM-) QNQ Oncology II EPhrin type-a receptor (EPH) P7 Oncology II FAS-associated death domain protein (FADD) Q8 Oncology II Fc receptor-like B (FCRLB) QBAA4 Oncology II Fibroblast growth factor-binding Protein (FGF-BP) Q4 Oncology II Folate receptor alpha (FR-alpha) P8 Oncology II Folate receptor gamma (FR-gamma) P44 Oncology II Furin (FURIN) P8 Oncology II Galectin- (Gal-) P8 Oncology II Glypican- (GPC) P Oncology II Granzyme B (GZMB) P44 Oncology II Granzyme H (GZMH) P78 Oncology II ICOS ligand (ICOSLG) O744 Oncology II Insulin-like growth factor receptor (IGFR) P8 Oncology II Excluded (>% missing) Integrin alpha-v (ITGAV) P7 Oncology II Integrin beta- (ITGB) P884 Oncology II Interferon gamma receptor (IFN-gamma-R) P Oncology II Kallikrein- (hk) QUBX7 Oncology II Kallikrein- (KLK) QUKR Oncology II Kallikrein-4 (hk4) QPG Oncology II Kallikrein-8 (hk8) O Oncology II Ly/PLAUR domain-containing Protein (LYPD) O74 Oncology II Melanoma-derived growth regulatory Protein (MIA) Q74 Oncology II Mesothelin (MSLN) Q4 Oncology II Methionine aminopeptidase (MetAp) P7 Oncology II MHC class I Polypeptide-related se Quence Q8 Oncology II Excluded (>% missing) Midkine (Mk) P74 Oncology II Mothers against decapentaplegic homolog (MAD homolog ) Q77 Oncology II Mucin- (MUC-) Q8WXI7 Oncology II Nectin-4 (PVRL4) QNY8 Oncology II Pancreatic prohormone (PPY) P8 Oncology II Podocalyxin (PODXL) O Oncology II Pro-epidermal growth factor (EGF) P Oncology II Protein CYR (CYR) O Oncology II Protein S-A (SA) P4 Oncology II Table continues on next page
10 Table S. Cont. Protein UniProt No Immunoassay panel Comment Protein S-A4 (SA4) P447 Oncology II Proto-oncogene tyrosine-protein kinasereceptor Ret (RET) P74 Oncology II Receptor tyrosineprotein kinase erbb-(erbb) P4 Oncology II Receptor tyrosineprotein kinase erbb- (ERBB) P8 Oncology II Receptor tyrosineprotein kinase erbb-4 (ERBB4) Q Oncology II R-spondin- (RSPO) QBXY4 Oncology II Secretory carrier-associated membraneprotein (SCAMP) O488 Oncology II Seizure -like protein (SEZL) QBYH Oncology II SPARC (SPARC) P48 Oncology II Syndecan- (SYND) P887 Oncology II T-cell leukemia / lymphoma Protein A (TCLA) P7 Oncology II TGF-beta receptor type- (TGFR-) P77 Oncology II Tissue factor pathway inhibitor (TFP-) P487 Oncology II T-lymphocyte surface antigen Ly- (LY) QHBG7 Oncology II Toll-like receptor (TLR) O4 Oncology II Transmembrane glycoprotein NMB (GPNMB) Q4 Oncology II Tumor necrosis factor ligand superfamilymember (TNFSF) O7888 Oncology II Tumor necrosis factor ligand superfamilymember (FASLG) P48 Oncology II Tumor necrosis factor receptor superfamilymember (TNFRSF) QNS8 Oncology II Tumor necrosis factor receptor superfamilymember 4 (TNFRSF4) P448 Oncology II Tumor necrosis factor receptor superfamilymember B (TNFRSFB) O7 Oncology II Tyrosineprotein kinase ABL (ABL) P Oncology II Tyrosineprotein kinase Lyn (LYN) P748 Oncology II Vascular endothelial growth factor receptor (VEGFR-) P8 Oncology II Vascular endothelial growth factor receptor (VEGFR-) P Oncology II VEGF-co regulated chemokine (CXL7) QUXB Oncology II Vimentin (VIM) P87 Oncology II WAP four-disulfide core domain protein (WFDC) Q48 Oncology II Wnt inhibitory factor (WIF-) QYW Oncology II WNT-inducible-signaling pathway protein (WISP-) O88 Oncology II Xaa-pro aminopeptidase (XPNPEP) O48 Oncology II
Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension.
VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully
Data Package. Multiplex Oncology I 96 96
Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection
DATA PACKAGE. Multiplex CVD I 96 96
DATA PACKAGE Multiplex CVD I 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection limit
Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs
Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )
1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo
FirePlex Multiplex Immunoassay product list
FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes
TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57
Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive
Supplementary Online Content
Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT
ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes
Growth Factors. BIT 230 Walsh Chapter 7
Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of
ELISA kits for Cancer
ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones
Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological
The Role of Microenvironment in the Control of Tumor Angiogenesis
The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,
Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies
Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Abstract Background: Cardiovascular diseases account for the largest fraction of smoking-induced
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Supplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
Proseek Multiplex Inflammation I 96 96
Proseek Multiplex Inflammation I 96 96 Adenosine Deaminase (ADA) P00813 Fibroblast growth factor 5 (FGF-5) Q8NF90 Artemin (ARTN) Q5T4W7 Fms-related tyrosine kinase 3 ligand (Flt3L) P49771 Axin-1 (AXIN1)
Additional file 2 List of pathway from PID
Additional file 2 List of pathway from PID Pathway ID Pathway name # components # enriched GO terms a4b1_paxdep_pathway Paxillin-dependent events mediated by a4b1 20 179 a4b1_paxindep_pathway Paxillin-independent
Circulating Levels of Inflammatory Proteins and Survival in Patients with
Circulating Levels of Inflammatory Proteins and Survival in Patients with Gallbladder Cancer Zhiwei Liu 1 *, Troy J. Kemp 2, Yu-Tang Gao 3, Amanda Corbel 1, Emma E. McGee 1, Juan Carlos Roa 4,5, Bingsheng
basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman
D15001 C-60014 Angiopoietin 1 (HeLa cell-derived), (Ang-1), rhuman 20 µg 32,000 D15002 C-60016 Apolipoprotein A1, (APO-A1), rhuman 100 µg 32,000 D15003 C-60017 Apolipoprotein E2, (APO-E2), rhuman 500 µg
Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018
Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect
Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
ProcartaPlex multiplex immunoassays for the Luminex platform
ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer
Original Article Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Hongyan Huang, Yanbin Zhang, Sha Li, Jing Zhao, Xiaoli
Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.
Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2
Dilution Factor Serum Plasma Urine CSF (Other)
R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations
CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products.
CURRENT AND EMERGING CANCER DIAGNOSTIC TESTS Emerging Assays, and Companies Developing New Technologies and Products Table of Contents Major Current And Emerging Cancer Diagnostic Tests 1. Introduction
Immunology lecture: 14. Cytokines: Main source: Fibroblast, but actually it can be produced by other types of cells
Immunology lecture: 14 Cytokines: 1)Interferons"IFN" : 2 types Type 1 : IFN-Alpha : Main source: Macrophages IFN-Beta: Main source: Fibroblast, but actually it can be produced by other types of cells **There
Genetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration
Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,
T cell and Cell-mediated immunity
T cell and Cell-mediated immunity ( 第十章 第十二章第十二章 ) Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, School of Medicine Medical Research Building B815-819
T cell-mediated immunity
T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers
Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest
1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
Tumor Associated Macrophages as a Novel Target for Cancer Therapy
Tumor mass Tumor Associated Macrophage Tumor Associated Macrophages as a Novel Target for Cancer Therapy This booklet contains forward-looking statements that are based on Amgen s current expectations
Generation of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans
SUPPLEMENTARY DATA Expression of complement factors is induced in DBA/2 mice following administration of C. albicans water-soluble mannoprotein-beta-glucan complex (CAWS) Noriko Nagi-Miura 1,, Daisuke
Tyrosine kinases. Cell surface receptors ligand binding. Producer cell RNA. Target cell
Tyrosine kinases http://msbl.helsinki.fi/tkseminar roducer cell Signaling molecules Receptor binding Signal transduction Target cell Activation of Gene expression RNA Biological responses proliferation,
Supplementary Figure 1
Supplementary Figure 1 Full inter-omic cross-sectional correlation network Statistically-significant inter-omic cross-sectional Spearman correlations (p adj
Basis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro
1 Physicochemical Properties Can Be Key Determinants of Mesoporous Silica Nanoparticle Potency In Vitro Dalibor Breznan 1*, Dharani D. Das 1, Christine MacKinnon-Roy 1, Stéphane Bernatchez 2, Abdelhamid
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection.
Supplementary Table SI: Y strain T. cruzi infection results in the upregulation of 381 genes at the site of infection. Genes found to be significantly upregulated (FDR2) in Y strain
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26
Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory
Chapter 11 CYTOKINES
Chapter 11 CYTOKINES group of low molecular weight regulatory proteins secreted by leukocytes as well as a variety of other cells in the body (8~30kD) regulate the intensity and duration of the immune
AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.
AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:
Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,
Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development
Tumor Microenvironment and Immune Suppression
Tumor Microenvironment and Immune Suppression Hassane M. Zarour,, MD Department of Medicine, Division of Hematology-Oncology, University of Pittsburgh Cancer Institute Hallmarks of Cancer: The Next Generation
Cytokine Profiling in Human Colostrum and Milk by Protein Array
Papers in Press. Published March 15, 2007 as doi:10.1373/clinchem.2006.077107 The latest version is at http://www.clinchem.org/cgi/doi/10.1373/clinchem.2006.077107 Clinical Chemistry 53:5 000 000 (2007)
C M. Chimerigen Laboratories C M. Biologically Active BULK Proteins. Butyrophilin-like 2 [BTNL2] mil-35/fc An Inhibitory Cytokine.
![C M. Chimerigen Laboratories C M. Biologically Active BULK Proteins. Butyrophilin-like 2 [BTNL2] mil-35/fc An Inhibitory Cytokine.](/thumbs/95/123073381.jpg "C M. Chimerigen Laboratories C M. Biologically Active BULK Proteins. Butyrophilin-like 2 [BTNL2] mil-35/fc An Inhibitory Cytokine.")
www.adipogen.com 2014 fusion Proteins Laboratories The Experts for High Quality Fusion Proteins NEW NEW Butyrophilin-like 2 [BTNL2] Butyrophilin-like 2 (BTNL2) is a butyrophilin family member with homology
To compare the relative amount of of selected gene expression between sham and
Supplementary Materials and Methods Gene Expression Analysis To compare the relative amount of of selected gene expression between sham and mice given renal ischemia-reperfusion injury (IRI), ncounter
SUPPLEMENTARY FIG. S2. b-galactosidase staining of
SUPPLEMENTARY FIG. S1. b-galactosidase staining of senescent cells in 500 mg=dl glucose (10 magnification). SUPPLEMENTARY FIG. S3. Toluidine blue staining of chondrogenic-differentiated adipose-tissue-derived
VALIDATION DATA. Multiplex CVD II 96 96
VALIDATION DATA Multiplex CVD II 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Quality Controls 3 1.3 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical
Time course of immune response
Time course of immune response Route of entry Route of entry (cont.) Steps in infection Barriers to infection Mf receptors Facilitate engulfment Glucan, mannose Scavenger CD11b/CD18 Allows immediate response
Speciality and Research Controls
Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter
ProcartaPlex Multiplex Immunoassays
ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a
are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran
CXC chemokines CXCL1, CXCL9, CXCL10 and CXCL12 are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran Mojgan Noroozi Karimabad Molecular Medicine Research
B-cell. Astrocyte SCI SCI. T-cell
RF #2015 P-01 PI: Azizul Haque, PhD Grant Title: Targeting Enolase in Spinal Cord Injury 12-month Technical Progress Report Progress Report (First Six Months): Enolase is one of the most abundantly expressed
Cell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
T cell and Cell-mediated immunity
T cell and Cell-mediated immunity Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, it School of Medicine i Medical Research Building B815-819 Email: Lu.Linrong@gmail.com
T cells III: Cytotoxic T lymphocytes and natural killer cells
T cells III: Cytotoxic T lymphocytes and natural killer cells Margrit Wiesendanger Division of Rheumatology, CUMC September 17, 2008 Killer cells: CD8 + T cells (adaptive) vs. natural killer (innate) Shared
Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression
Cytokine Arrays Reveal Black Ops Tactics of Tumor-induced Immunosuppression Jarad J Wilson, Ph.D. Technical Support & Marketing Specialist Ruo-Pan Huang, MD, Ph.D. Founder and CEO What are Antibody Arrays?
Seeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas
Test Bank for Basic Immunology Functions and Disorders of the Immune System 4th Edition by Abbas Chapter 04: Antigen Recognition in the Adaptive Immune System Test Bank MULTIPLE CHOICE 1. Most T lymphocytes
Immunologic messenger molecules: Cytokines, interferons, and chemokines
Immunologic messenger molecules: Cytokines, interferons, and chemokines Scott P. Commins, MD, PhD, Larry Borish, MD, and John W. Steinke, PhD Charlottesville, Va Cytokines and chemokines are secreted proteins
CYTOKINES. Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010.
CYTOKINES Based on: Cellular and Molecular Immunology, 4 th ed.,abbas A.K., Lichtman A.H. and Pober J.S. Sounders company; Philadelphia, 2010. 1 What are cytokines? Glycoproteins (15 25 kda): Interleukins
Allergic rhinitis (Hay fever) Asthma Anaphylaxis Urticaria Atopic dermatitis
Hypersensitivity Disorders Hypersensitivity Disorders Immune Response IgE Disease Example Ragweed hay fever IgG Cytotoxic Immune complex T Cell Hemolytic anemia Serum sickness Poison ivy IgE-mediated Diseases
Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up. Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins
Regulating the Regulators for Cancer Immunotherapy: LAG-3 Finally Catches Up Drew Pardoll Sidney Kimmel Cancer Center Johns Hopkins The hostile immune microenvironment within a tumor Stat3 Stat3 NK Lytic
A. Incorrect! It s not correct. Synergism of cytokines refers to two or more cytokines acting together.
Immunology - Problem Drill 11: Cytokine and Cytokine Receptors Question No. 1 of 10 1. A single cytokine can act on several different cell types, which is known as. Question #1 (A) Synergism (B) Pleiotropism
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems
CO 2 tolerance of Atlantic salmon post-smolts in recirculating aquaculture systems Vasco Mota*, Tom Nilsen, Elizabeth Ytteborg, Grete Baeverfjord, Aleksei Krasnov, Jelena Kolarevic, Lars Ebbesson, Steven
Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation
Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis
Expression levels of b-pix mrna in ALS-MSCs and C-MSCs.
Supplementary Data SUPPLEMENTARY FIG. S1. The neurological functioning of ischemic rats depends on the origin of the transplanted MSCs. The scores of healthy rats in tests on forelimb placing, forelimb
Index. neurosurgery.theclinics.com. Note: Page numbers of article titles are in boldface type.
Index Note: Page numbers of article titles are in boldface type. A A Complimentary Trial of an Immunotherapy Vaccine Against Tumor-specific EGFRvIII (ACTIVATE), 90 91 Active immunotherapy, 5 8, 96. See
Lectins: selected topics 3/2/17
Lectins: selected topics 3/2/17 Selected topics Regulation of T-cell receptor signaling Thymic selection of self vs. non-self T-cells Essentials of Glycobiology Second Edition Signaling pathways associated
2. Cytokines and chemokines
2. Cytokines and chemokines Larry C. Borish, MD, and John W. Steinke, PhD Charlottesville, Va Cytokines and chemokines are redundant secreted proteins with growth, differentiation, and activation functions
Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer
Supplementary Information Synergy of radiotherapy and PD-1 blockade in Kras-mutant lung cancer Grit S. Herter-Sprie, Shohei Koyama, Houari Korideck, Josephine Hai, Jiehui Deng, Yvonne Y. Li, Kevin A. Buczkowski,
Immunology Research Related Cytokine Products
Immunology Research Related Cytokine Products Copyright 2017 by PeproTech, Inc. PeproTech, Inc. 5 Crescent Avenue Rocky Hill, NJ 08553-0275 Tel: (800) 436-9910 (609) 497-0253 Fax: (609) 497-0321 email:
DNA vaccine, peripheral T-cell tolerance modulation 185
Subject Index Airway hyperresponsiveness (AHR) animal models 41 43 asthma inhibition 45 overview 41 mast cell modulation of T-cells 62 64 respiratory tolerance 40, 41 Tregs inhibition role 44 respiratory
5% of patients with genetic immunodeficiency develop a cancer during their lifetime (200x)
Immune surveillance 5% of patients with genetic immunodeficiency develop a cancer during their lifetime (200x) Transplanted patients following an immunosuppressor therapy are 80 times more likely to develop
Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of
1 Supplementary material for: 2 3 4 5 6 Late regulation of immune genes and micrornas in circulating leukocytes in a pig model of influenza A (H1N2) infection Louise Brogaard, Peter M. H. Heegaard, Lars
Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell?
Abbas Chapter 2: Sarah Spriet February 8, 2015 Question 1. Kupffer cells, microglial cells and osteoclasts are all examples of what type of immune system cell? a. Dendritic cells b. Macrophages c. Monocytes
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
Supporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
The T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
Nori Rabbit IL-2 ELISA Kit DataSheet
Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the
MOLECULAR IMMUNOLOGY Manipulation of immune response Autoimmune diseases & the pathogenic mechanism
MOLECULAR IMMUNOLOGY Manipulation of immune response Autoimmune diseases & the pathogenic mechanism SCHMAIEL SHIRDEL CONTENT 2 Introduction Autoimmune diseases Classification Involved components Autoimmune
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
Darwinian selection and Newtonian physics wrapped up in systems biology
Darwinian selection and Newtonian physics wrapped up in systems biology Concept published in 1957* by Macfarland Burnet (1960 Nobel Laureate for the theory of induced immune tolerance, leading to solid
remember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with
بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition
T cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
Innate Immunity II. Integration. Lindsay Nicholson Advanced Immunology L2
Innate Immunity II Integration Lindsay Nicholson Advanced Immunology L2 l.nicholson@bristol.ac.uk Lecture 1 Defining Innate Immunity Recognition and effector mechanisms (I) Lecture 2 Recognition and effector
The Hallmarks of Cancer
The Hallmarks of Cancer This illustration encompasses the six hallmark capabilities originally proposed in our 2000 perspective. The past decade has witnessed remarkable progress toward understanding the