DATA PACKAGE. Multiplex CVD I 96 96

Size: px
Start display at page:

Download "DATA PACKAGE. Multiplex CVD I 96 96"

Transcription

1 DATA PACKAGE Multiplex CVD I 96 96

2 Table of contents 1. INTRODUCTION Technology Data analysis 3 2. PERFORMANCE CHARACTERISTICS Sample types Analytical Measurement 4 Detection limit 4 Measuring ranges 4 High dose hook effect Precision Repeatability Reproducibility 2.4 Analytical Specificity Endogenous interference 2.5 Scalability 3. REFERENCES 11 TECHNICAL SUPPORT For technical support, please contact us at support@olink.com or

3 1. Introduction Proseek Multiplex CVD I is a reagent kit measuring 92 cardiovascular disease related human protein biomarkers simultaneously in plasma samples. The analytical performance of the product has been carefully validated and the results are presented below. 1.1 TECHNOLOGY The Proseek reagents are based on PEA, a Proximity Extension Assay technology 1, where 92 oligonucleotide labeled antibody probe pairs are allowed to bind to their respective target present in the sample. A PCR reporter sequence is formed by a proximity dependent DNA polymerization event and is subsequently detected and quantified using real-time PCR. The assay is performed in a homogeneous 96-well format without any need for washing steps, see Figure DATA ANALYSIS Data analysis was performed by employing a preprocessing normalization procedure. For each data point, delta Cq (dcq) values were obtained by subtracting the value for the Extension control, thus normalizing each sample for technical variation within one run. Normalization between runs is then performed by subtraction of the Interplate Control (IPC) for each assay. In the final step of the preprocessing procedure the values are set relative to a fixed background level determined by Olink. The generated Normalized Protein Expression (NPX) unit is on a log2 scale where a larger number represents a higher protein level in the sample, typically with the background level at around zero, although it might differ between runs. Linearization of data is performed by the mathematical operation 2 ^NPX. Statistical analyses, e.g. coefficient of variation (CV) calculations were performed on linearized values. INCUBATION EXTENSION DETECTION Allow the 92 antibody probe pairs to bind to their respective proteins in your samples. Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. Quantify each biomarker s DNA reporter using high throughput real-time qpcr. Fig 1. Proseek Multiplex assay procedure employs three core steps: Incubation, Extension and Detection. High throughput real-time qpcr is performed by using the Fluidigm Biomark TM or Fluidigm Biomark TM HD systems. Proseek Multiplex CVD I Data Package 3

4 2. Performance characteristics 2.1 SAMPLE TYPES A) 1 GDF-15 The ability to use different sample types was evaluated with the Proseek Multiplex CVD I by collecting matched ethylenediaminetetraacetic acid (EDTA), acid citrate dextrose (ACD), and heparin plasma samples from 5 individuals. Table 1 shows signal to background values for each sample type and assay, as well as relative percentage differences compared to EDTA plasma. The results indicated that EDTA plasma is a suitable sample type for all assays. Variations observed between responses in heparin and citrate plasma, as compared to EDTA plasma, was generally small, and most of the assays will therefore function without limitation in these sample types. 2.2 ANALYTICAL MEASUREMENT DETECTION LIMIT Limit of detection (LOD) was defined as 3 standard deviations above background, and reported in pg/ ml for proteins out of 92, for which recombinant antigen was available, see Figure 2 and Table 1. B) NPX NPX LLOQ ULOQ LLOQ Concentration (pg/ml) Interleukin ULOQ LOD LOD LOD: 7.6 pg/ml LLOQ: 15.3 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 3.6 log LOD: 0. pg/ml LLOQ: 0. pg/ml ULOQ: 3 9 pg/ml Hook: 3 9 pg/ml Range: 4.5 log MEASURING RANGES The analytical measuring range was defined by the lower limit of quantification (LLOQ) and upper limit of quantification (ULOQ) and reported in pg/ml. Quantification limits of LLOQ and ULOQ were calculated with the following trueness and precision criteria; relative error 30% and CV 30%, of backcalculated values, respectively. Measuring ranges were reported in order of log. See Figure 2 and Table 1. Calibrator curves were determined for protein biomarkers simultaneously in multiplex format. Two protein biomarkers lacked recombinant antigens and two were non-purified preparations. Representative assays with their analytical data are exemplified in Figure 2 and the distribution of their corresponding measuring range per assay is shown in Figure 3. Separate calibrator curves established for each assay may be viewed at HIGH DOSE HOOK EFFECT A high dose hook effect is a state of antigen excess relative to the reagent antibodies resulting in falsely lower values. If undetected, a significantly lower value will be reported which can lead to misinterpretation of results. Therefore, the high dose hook effect was determined for each analyte, here reported in pg/ml, see Figure 2 and Table 1. C) D) NPX NPX LLOQ LLOQ Concentration (pg/ml) Interleukin 1 ULOQ Concentration (pg/ml) Osteoprotegerin ULOQ Concentration (pg/ml) LOD LOD LOD: 0.24 pg/ml LLOQ: 0.24 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 5.1 log LOD: 0.95 pg/ml LLOQ: 0.95 pg/ml ULOQ: pg/ml Hook: pg/ml Range: 4. log Fig 2. Calibrator curves from 4 representative assays and their corresponding analytical measurement data. 4 Proseek Multiplex CVD I Data Package

5 PAPPA CTSD mamp PRL HSP 27 MB NT-pro-BNP MMP-3 Gal-3 SPON1 FABP4 FS CHI3L1 AM IL-6RA SELE Gal-3 LEP CTSL-1 ESM-1 MPO TNF-R2 CSTB CXCL- FGF-23 ECP RETN EN-RAGE t-pa Dkk-1 PDGF Subunit B AGRP PECAM-1 PTX3 TIE2 SIRT2 ST2 IL-27 SRC ITGB1BP2 HGF VEGF-D MMP-7 CXCL-6 PSGL-1 FAS RAGE TRANCE CX3CL1 TRAIL-R2 GDF-15 REN IL- CXCL1 TM MMP- KLK6 TIM SCF LOX-1 hk11 CD40L MMP- MMP-1 TNF-R1 TRAIL CCL20 MCP-1 IL-1ra CASP- Beta-NGF TNFSF14 PIGF GH HB-EGF EGF CCL4 OPG IL-4 CD40 U-PAR CCL3 VEGF-A IL-1 CSF-1 TF IL- IL Concentration (pg/ml) Fig 3. Distribution of analytical measuring range, defined by the limits of quantification LLOQ-ULOQ, for out of 92 analytes. Proseek Multiplex CVD I Data Package 5

6 Table 1. Sample Types, Analytical Measurement; Limit of Detection, LOD, Lower Limit of Quantification, LLOQ, Upper Limit of Quantification, ULOQ, High Dose Effect, Hook, and Precision indicative of assay performance are shown for 92 analytes. Values below limit of detection were not reported (NR). Signal-to-background (2 ddcq ) Sample types Analytical measurement Precision Relative 2 ddcq to EDTA plasma Target UniProt No ACD EDTA Heparin ACD Heparin LOD LLOQ ULOQ Hook Range Intra-assay Inter-assay Inter-site Adrenomedullin P % 69% % 1% % Agouti-related protein O % 7% % % 17% Angiopoietin-1 receptor Q % 92% % % % Beta-nerve growth factor P % 1% % 25% 13% Caspase- Q % 1% % 21% 25% Cathepsin D P % % % % 14% Cathepsin L1 P % 0% % 14% % C-C motif chemokine 3 P % 79% % 1% 1% C-C motif chemokine 4 P % 5% % % % C-C motif chemokine 20 P % 72% % 9% 5% CD40 ligand P % 227% % % % Chitinase-3-like protein 1 P % 91% % 15% 11% C-X-C motife chemokine 1 P % 9% % 13% 1% C-X-C motif chemokine 6 P % 23% % % % C-X-C motif chemokine Q9H2A % 7% % 14% 14% Cystatin-B P % 74% % 13% % Dickkopf-related protein 1 O % 65% % 15% 14% Endothelial cell-specific molecule 1 Q9NQ % 57% % % 11% Eosinophil cationic protein P % 4% % 22% 24% Epidermal growth factor P % 0% % 9% 5% E-selectin P % 7% % 13% 13% Fatty acid-binding protein, adipocyte P % 2% % 14% % Fibroblast growth factor 23 Q9GZV % 5% % 21% 14% Follistatin P % 2% % 13% 14% Fractalkine P % 7% % 14% 22% Galanin peptides P % 5% % 17% 9% Galectin-3 P % 7% % % 13% Growth hormone P % 90% % 14% 15% Growth/differentiation factor 15 Q % 7% % 11% 14% Heat shock 27 kda protein P % 35% % 13% 13% Heparin-binding EGF-like growth factor Q % 4% % 14% 11% Hepatocyte growth factor P % 5% % % % Interleukin-1 receptor antagonist protein P % 0% % 14% % Interleukin-4 P051 NR NR NR NR NR % 11% 13% Interleukin-6 P % 9% % % 7% Interleukin-6 receptor subunit alpha P % 7% % 14% % Interleukin- P % 3% % % % Interleukin- Q % 0% % 11% % Interleukin-1 Q % 9% % % 14% Interleukin-27 QNEV9 Q14213 pg/ml 9 6 9% 67% % 19% 22% Kallikrein-6 Q % 2% % 22% 11% Kallikrein-11 Q9UBX % 97% % 19% 9% Lectin-like oxidized LDL receptor 1 P % 2% % % 9% Leptin P % 114% % % 21% Macrophage colony-stimulating factor 1 P % 96% % % 14% Matrix metalloproteinase-1 P % 64% % 31% 51% log 6 Proseek Multiplex CVD I Data Package

7 Signal-to-background (2 ddcq ) Sample types Analytical measurement Precision Relative 2 ddcq to EDTA plasma Target UniProt No ACD EDTA Heparin ACD Heparin LOD LLOQ ULOQ Hook Range Intra-assay Inter-assay Inter-site Matrix metalloproteinase-3 P % 76% % 20% % Matrix metalloproteinase-7 P % 414% % % 15% Matrix metalloproteinase- P % 4% % 15% 1% Matrix metalloproteinase- P % 1% % 39% 26% Melusin Q9UKP3 NR NR NR NR % 21% 31% Membrane-bound aminopeptidase P O % 75% % 22% % Monocyte chemotactic protein 1 P % 72% % 1% 26% Myeloperoxidase P % 1% % 1% % Myoglobin P % 5% % 17% % Natriuretic peptides B P60 NR NR NR NR NR NR NR NR NR NR NR NR NR NF-kappa-B essential modulator Q9Y6K % 52% NR NR NR NR NR % 20% 15% N-terminal pro-b-type natriuretic peptide NR NR NR NR NR NR NR NR Osteoprotegerin O % 74% % 11% 7% Ovanrian cancer-related tumor marker CA 5 QWXI % 6% NR NR NR NR NR % 20% 21% Pappalysin-1 Q NR 6% NR % 21% 5% Pentraxin-related protein PTX3 P26022 NR 2 NR NR NR % 20% 14% Placenta growth factor P % 73% % 13% 7% Platelet endothelial cell adhesion molecule P % 79% % % 13% Platelet-derived growth factor subunit B P % 56% % 14% 17% Prolactin P % 79% % 14% 9% Protein S0-A P % 206% % 22% 30% Proteinase-activated receptor 1 P % 4% NR NR NR NR NR 6% 14% 17% Proto-oncogene tyrosine-protein kinase Src P % 45% % % 15% P-selectin glycoprotein ligand 1 Q % 57% % 20% 30% Receptor for advanced glycosylation end products Q % 46% % 13% % Renin P % 0% % 13% 9% Resistin Q9HD % 75% % 1% 21% SIR2-like protein QIXJ % 27% % 20% 22% Spondin-1 Q9HCB % 31% % 13% 13% ST2 protein Q % 75% % 14% 13% Stem cell factor P % 95% % 13% % Thrombomodulin P % 92% % 14% 13% TIM-1 Q96D % 90% % 14% 13% Tissue factor P % 91% % % 17% Tissue-type plasminogen activator P % 36% % 14% 23% TNF-related activation-induced cytokine O % 5% % % 13% TNF-related apoptosis-inducing ligand P % 9% % 15% % TNF-related apoptosis-inducing ligand receptor 2 O % 2% % 15% % Tumor necrosis factor receptor 1 P % 96% % 11% 7% Tumor necrosis factor receptor 2 P % 5% % 14% 14% Tumor necrosis factor receptor superfamily member 5 P % 93% % % 14% Tumor necrosis factor receptor superfamily member 6 P % 6% % % 13% Tumor necrosis factor ligand superfamily member 14 O % 130% % 25% 17% Urokinase plasminogen activator surface receptor Q % 94% % % 9% Vascular endothelial growth factor A P % 77% % 13% % Vascular endothelial growth factor D O % 111% % 13% 11% pg/ml log Proseek Multiplex CVD I Data Package 7

8 2.3 PRECISION REPEATABILITY Intra-assay variation (within-run) was calculated as the mean coefficient of variation (% CV) for 7 individual samples, within each of the 9 separate runs during the validation studies. Inter-assay variation (between-run was calculated as the mean coefficient of variation (% CV), for the same 7 individual samples, between the 9 separate runs during the validation studies. Variation calculations were assessed on linearized values for 90 out of 92 analytes. Assays with values below limit of detection were not reported, see Table 1. Across 90 assays, the mean CV intra-assay and interassay variations were observed to be % and 15%, respectively. The distribution of both inter-assay and inter-assay variations per assay is shown in Figure 4. The mean % CV value in the first analysis ranged from 6% to 9% intra-assay. The mean % CV ranged from 13% to 17% inter-assay, and % to % inter-site, here shown in direct comparison to Olink Bioscience in Figure 5. Overall, the Proseek Multiplex CVD I showed very good reproducibility and repeatability with average intersite variation of 15%. Intra: % Inter: 15% % % % of protein biomarkers >40 % CV Fig 4. Distribution of intra-assay and inter-assay variations of Proseek Multiplex CVD I Intra Inter REPRODUCIBILITY Inter-site variation (between-site) was also investigated during the validation in a β-site study, to estimate the expected variations in values between different laboratories, with different operators and using different equipment. Seven individual samples were distributed to each site together with Proseek Multiplex CVD I reagent kits. Each site was instructed to perform the analysis of the 7 individual samples according to the same run design. Each site was also asked to perform two independent runs. The overall design of the β-site study enabled the estimation of both the intra-assay and inter-assay variations for 3 sites including Olink Bioscience, and the inter-site variation for each site, here shown in Figure 5. β 1 Intra 1: 6% Intra 2: 5% Inter: 17% β 2 Intra 1: 9% Intra 2: 5% Inter: 13% Fig 5. Validation of the Proseek Multiplex CVD I at 2 (β1-β2) different laboratories. Larger boxes shows intra-assay and interassay variations for each site and small boxes represent the inter-site run variations in direct comparison to Olink Bioscience. 2.4 ANALYTICAL SPECIFICITY ENDOGENOUS INTERFERENCE Endogenous interference from heterophilic antibodies, e.g. HAMA, and rheumatoid factor are known to cause problems in immunoassays. To evaluate the potential impact of this specific interference, a special mismatch system was designed. The only way to generate a signal here is by antibody probe pairs being brought into proximity, by cross-binding substances other than antigens, e.g. heterophilic antibodies and similarly acting rheumatoid factor. Two different mismatched probe pairs of varying antibody host species origin were designed and evaluated with a Heterophilic Assessment Panel from Scantibodies Laboratory Inc. (part no. 3KG027) and two sets of samples known to contain rheumatoid factor (< International Units/mL (IU/mL)) and rheumatoid arthritis ( arbitrary units (AU)). No interference could be detected for any of the panel samples, indicating a sufficient blocking ability in all assays in the Proseek Multiplex CVD I Proseek Multiplex CVD I Data Package

9 Table 2. Performance characteristics. Endogenous interference was performed by addition of hemolysate, lipids and bilirubin in plasma EDTA matrix. Reported are the highest tested concentrations without impact on assay performance. Endogenous interference Endogenous interference g/l g/l Targets 1-46 Hemolysate Lipids Bilirubin Targets Hemolysate Lipids Bilirubin Adrenomedullin Matrix metalloproteinase Agouti-related protein Matrix metalloproteinase Angiopoietin-1 receptor Matrix metalloproteinase Beta-nerve growth factor Matrix metalloproteinase Caspase Melusin Cathepsin D Membrane-bound aminopeptidase P Cathepsin L Monocyte chemotactic protein C-C motif chemokine Myeloperoxidase C-C motif chemokine Myoglobin C-C motif chemokine Natriuretic peptides B CD40 ligand NF-kappa-B essential modulator Chitinase-3-like protein N-terminal pro-b-type natriuretic peptide C-X-C motife chemokine Osteoprotegerin C-X-C motif chemokine Ovanrian cancer-related tumor marker CA C-X-C motif chemokine Pappalysin Cystatin-B Pentraxin-related protein PTX Dickkopf-related protein Placenta growth factor Endothelial cell-specific molecule Platelet endothelial cell adhesion molecule Eosinophil cationic protein Platelet-derived growth factor subunit B Epidermal growth factor Prolactin E-selectin Protein S0-A Fatty acid-binding protein, adipocyte Proteinase-activated receptor Fibroblast growth factor Proto-oncogene tyrosine-protein kinase Src Follistatin P-selectin glycoprotein ligand Fractalkine Receptor for advanced glycosylation end products Galanin peptides Renin Galectin Resistin Growth hormone SIR2-like protein Growth/differentiation factor Spondin Heat shock 27 kda protein ST2 protein Heparin-binding EGF-like growth factor Stem cell factor Hepatocyte growth factor Thrombomodulin Interleukin-1 receptor antagonist protein TIM Interleukin Tissue factor Interleukin Tissue-type plasminogen activator Interleukin-6 receptor subunit alpha TNF-related activation-induced cytokine Interleukin TNF-related apoptosis-inducing ligand Interleukin TNF-related apoptosis-inducing ligand receptor Interleukin Tumor necrosis factor receptor Interleukin Tumor necrosis factor receptor Kallikrein Tumor necrosis factor receptor superfamily member Kallikrein Tumor necrosis factor receptor superfamily member Lectin-like oxidized LDL receptor Tumor necrosis factor ligand superfamily member Leptin Urokinase plasminogen activator surface receptor Macrophage colony-stimulating factor Vascular endothelial growth factor A Matrix metalloproteinase Vascular endothelial growth factor D 15g Proseek Multiplex CVD I Data Package 9

10 The potential impact of certain known interfering serum and plasma components was evaluated by using serial dilutions of bilirubin, hemolysate, and lipids, respectively in EDTA plasma, as shown in Figure 6. These additions represent different patient health conditions and/or sample collection irregularities. No interference was detected by addition of lipids while 2 assays were observed to be affected by bilirubin and 23 assays out 92 were altered by hemolysate. The latter is probably due to actual analyte leaking out from the disrupted blood cells rather than disturbance of the assay mechanism. Table 2 shows the highest concentrations without impact on assay performance for each component. A) Hemolysate 24-plex were plotted against the 4-plex, 72-plex and 96-plex for each analyte. The correlation coefficient R 2 value generated by linear regression analysis reflects the correlation between the multiplex assays. The R 2 values were >0.99 for the different multiplex blocks, as shown in Figure 7, demonstrating the scalability of the system. A) 24-plex (dcq) y = x R² = g/l 7.5 g/l 3.75 g/l 1. g/l 0.94 g/l 0.47 g/l 0.23 g/l Serum plex (dcq) B) Lipids B) y = 1.017x R² = Serum 24-plex (dcq) C) Bilirubin plex (dcq) Serum C) y = 1,025x - 0,427 R² = 0,9971 Fig 6. Endogenous interference. Levels tested for hemolysate were g/l hemoglobin, lipids and bilirubin The highest hemolysate concentration translates to about % hemolysis. 24-plex (dcq) 2.5 SCALABILITY Assay performance was further evaluated with regard to scalability, meaning the capability of the Proseek Multiplex technology to maintain the same quality of performance irrespective of multiplex grade. A stepwise increase of multiplex grade (24, 4, 72 and 96) was performed and the observed dcq values for the plex (dcq) Fig 7. Scalability of the Proseek Mutliplex technology platform. This experiment was performed using the Proseek Multiplex Oncology I panel. Human serum samples were analyzed with a 24-plex, 4-plex and 72-plex assay and the complete Proseek Mutliplex Oncology I panel. The observed dcq (log2) values were plotted, and the correlation coefficient R 2 value was generated by linear regression. Proseek Multiplex CVD I Data Package

11 3. References 1. Lundberg M, Eriksson A, Tran B, Assarsson E and Fredriksson S. Homogeneous antibody-based proximity extension assays provide sensitive and specific detection of owabundant proteins in human blood. Nucleic Acid Res 6 June (2011). doi:.93/nar/gkr424 Proseek Multiplex CVD I Data Package 11

12 This product is for research use only. Not for use in human diagnostic or therapeutic procedures. This product includes a license for non-commercial use of Proseek products. Commercial users may require additional licenses. Please contact Olink Proteomics AB for details. There are no warranties, expressed or implied, which extend beyond this description. Olink Proteomics AB is not liable for property damage, personal injury, or economic loss caused by this product. The following trademarks are owned by Olink AB: Olink, Olink Bioscience and Proseek. This product is covered by several patents and patent applications including US 6,511,09, US 7,306,904, and related US and foreign patents. This product is sold under license from PHRI Properties, Inc. and may be used under PHRI Properties patent rights outside the field of human in vitro diagnostics. Components in the Proseek Multiplex Probe Kit utilise Lightning-Link technology and are provided under license from Innova Biosciences. 20 Olink Proteomics AB. All third party trademarks are the property of their respective owners. 0969, v1.3, Olink Proteomics Dag Hammarskjölds v. 52B SE Uppsala, Sweden

Data Package. Multiplex Oncology I 96 96

Data Package. Multiplex Oncology I 96 96 Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection

More information

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension.

Extend and pre-amplify 92 unique DNA reporter sequences by proximity extension. VALIDATION DATA 1. Introduction Olink Inflammation is a reagent kit measuring 92 inflammation related human protein biomarkers simultaneously. The analytical performance of the product has been carefully

More information

VALIDATION DATA. Multiplex CVD II 96 96

VALIDATION DATA. Multiplex CVD II 96 96 VALIDATION DATA Multiplex CVD II 96 96 Table of contents 1. INTRODUCTION 3 1.1 Technology 3 1.2 Quality Controls 3 1.3 Data analysis 3 2. PERFORMANCE CHARACTERISTICS 4 2.1 Sample types 4 2.2 Analytical

More information

Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies

Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Effects of cigarette smoking on cardiovascularrelated protein profiles in two community-based cohort studies Abstract Background: Cardiovascular diseases account for the largest fraction of smoking-induced

More information

FirePlex Multiplex Immunoassay product list

FirePlex Multiplex Immunoassay product list FirePlex Multiplex Immunoassay product list Contents Purchasing the assay Human - pre-designed panels Human list of analytes Human protein standard mixes Mouse - pre-designed panels Mouse list of analytes

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Willeit K, Pechlaner R, Willeit P, et al. Association between vascular cell adhesion molecule 1 and atrial fibrillation. JAMA Cardiol. Published online March 2, 2017. doi:10.1001/jamacardio.2017.0064

More information

Nori Rabbit IL-2 ELISA Kit DataSheet

Nori Rabbit IL-2 ELISA Kit DataSheet Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the

More information

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs

Cytokines, adhesion molecules and apoptosis markers. A comprehensive product line for human and veterinary ELISAs Cytokines, adhesion molecules and apoptosis markers A comprehensive product line for human and veterinary ELISAs IBL International s cytokine product line... is extremely comprehensive. The assays are

More information

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA.

AUTOANTIBODY SYSTEM. Detect Quantify Classify PROFILING. ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. AUTOANTIBODY PROFILING SYSTEM ITSI Biosciences LLC 633 Napoleon Street Johnstown, PA 15901, USA. Detect Quantify Classify Phone: +1-814-262-7331; Fax: +1-814-262-7334, Email: itsi@itsibio.com Website:

More information

Supplemental Material

Supplemental Material Supplemental Material The metabolic syndrome, inflammation and colorectal cancer risk; an evaluation of large panels of plasma protein markers using repeated, prediagnostic samples Sophia Harlid, Robin

More information

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration

MCP uL 25uL 25uL 25uL Typical Dilution 1:2 None None None Manufacturer Defined Minimum Detectible Concentration Units: pg/ml pg/ml pg/ml pg/ml Assay Name RnD Systems Millipore Magnetic Hormone ELISA Adipokine Panel 2 Panel Catalog Number DCP HADK2MAG-61K HCYTOMAG-6K HMHMAG-34K EGF, FGF-2, Eotaxin, TGF-a, G-CSF,

More information

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D )

Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D ) 1 SUPPLEMENTAL TABLES Effects of Ole e 1 allergen on human bronchial epithelial cells cultured at air-liquid interface (No. JIACI-D-17-00149) Juan C. López-Rodríguez 1, Guillermo Solís-Fernández 1, Rodrigo

More information

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.

Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1

More information

DKK-1 ELISA, Cat.No. BI For the quantitative determination of DKK-1 in human serum

DKK-1 ELISA, Cat.No. BI For the quantitative determination of DKK-1 in human serum DKK-1 ELISA, Cat.No. BI-20413 For the quantitative determination of DKK-1 in human serum ASSAY CHARACTERISTICS Method Standard range Conversion factor Sample volume / well Incubation time, temp. Sensitivity

More information

PERIOSTIN ELISA CONTENTS

PERIOSTIN ELISA CONTENTS PERIOSTIN ELISA for the quantitative determination of Periostin in human serum, EDTA plasma, heparin plasma, and citrate plasma Cat. No. BI-20433. 12 x 8 tests CONTENTS ASSAY CHARACTERISTICS Summary...

More information

Instant ELISA Kits. Accelerate Time to Result

Instant ELISA Kits. Accelerate Time to Result Instant ELISA Kits Accelerate Time to Result High quality by design equals performance. 1 Our ELISA portfolio provides you with a complete offering of kits with a reputation of: High sensitivity Reliable

More information

Dilution Factor Serum Plasma Urine CSF (Other)

Dilution Factor Serum Plasma Urine CSF (Other) R-PLEX s and Assay/Antibody Combinations The tables below provide the dilution factors and primary diluent combinations for samples tested with R-PLEX s. These dilution factors and diluent combinations

More information

Speciality and Research Controls

Speciality and Research Controls Controls Speciality and Research Product Range Product Antimicrobial Array 1 Plus Control 3 x 1 ml AMC5084 Antimicrobial Control II 3 x 1 ml AMC5035 Antimicrobial Control III 3 x 1 ml AMC5036 Growth Promoter

More information

Hexagon PSA. Design Verification. Contents

Hexagon PSA. Design Verification. Contents Design Verification Hexagon PSA Contents 1. Function...2 2. Sensitivity, Dynamic Range and Traceability...2 Description of Control Materials...2 Analytical Sensitivity...2 3. Clinical Evaluation...3 Evaluation

More information

ProcartaPlex multiplex immunoassays for the Luminex platform

ProcartaPlex multiplex immunoassays for the Luminex platform ProcartaPlex multiplex immunoassays for the Luminex platform Get exactly the panel you want Optimize your research with ProcartaPlex multiplex immunoassays What would the ability to simultaneously quantitate

More information

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet

GSI Canine IL-5 ELISA Kit-2 Plates DataSheet Interleukin5 (IL5) is a secreted glycoprotein that belongs to the α-helical group of cytokines (1, 2, 3). Unlike other family members, it is present as a covalently linked antiparallel dimer (4, 5). IL-5

More information

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents

Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents Aptamer- based proteomic profiling for predic?ng early mortality in heart failure pa?ents 2016 SomaLogic, Inc. Florence Pinet, Inserm UMR1167, Univ Lille, Ins?tut Pasteur de Lille, Lille - FRANCE florence.pinet@pasteur-

More information

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it.

Electrolytes. Summary: (This area will include a brief description of what the protocol is used for and why someone would need to use it. Electrolytes Version: 1 Edited by: Jason Kim (note that the following list should be linked to the appropriate location.) Summary Reagents and Materials Protocol Reagent Preparation Reagent 1 Reagent 2

More information

9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay

9607 Dr. Perry Road Suite 103. Ijamsville, MD Tel: (301) Fax: (301) Ultrasensitive Samoa Human IL-33 Immunoassay AssayGate, Inc. 9607 Dr. Perry Road Suite 103. Ijamsville, MD 21754. Tel: (301)874-0988. Fax: (301)560-8288. Ultrasensitive Samoa Human IL-33 Immunoassay INTRODUCTION Interleukin-33 (IL-33), a cytokine

More information

Growth Factors. BIT 230 Walsh Chapter 7

Growth Factors. BIT 230 Walsh Chapter 7 Growth Factors BIT 230 Walsh Chapter 7 3 Definitions Autocrine: a mode of hormone action in which a hormone affects the function of the cell type that produced it. Paracrine: Relating to the release of

More information

Human Neurology 3-Plex A

Human Neurology 3-Plex A Human Neurology 3-Plex A SUMMARY AND EXPLANATION OF THE TEST The Human N3PA assay is a digital immunoassay for the quantitative determination of total Tau, Aβ42, and Aβ40 in human plasma and CSF. Determination

More information

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma

Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma P909 Immunological biomarkers predictive of clinical response to chemotherapy and maintenance HAART in HIV + patients with Kaposi sarcoma Tedeschi R, Bidoli E 2, Bortolin MT, Pratesi C, Basaglia G, Zanussi

More information

The Role of Microenvironment in the Control of Tumor Angiogenesis

The Role of Microenvironment in the Control of Tumor Angiogenesis The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti The Role of Microenvironment in the Control of Tumor Angiogenesis Domenico Ribatti Department of Basic Medical Sciences,

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of rat TNF-alpha concentrations in cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

ELISA kits for Cancer

ELISA kits for Cancer ELISA kits for Cancer Interest in any of the products, request or order them at Bio-Connect Diagnostics. Bio-Connect Diagnostics B.V. T NL +31 (0)26 326 44 60 T BE +32 (0)2 502 12 53 Begonialaan 3a F NL

More information

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018

Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette. Liz Mason Kunming, China 26 th October 2018 Assessing Changes In Biomarkers Of Effect In Smokers Who Switch To A Closed System Electronic Cigarette Liz Mason Kunming, China 26 th October 2018 CONTENT 1. Background Biomarkers of exposure and effect

More information

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures.

TNF-alpha ELISA. For Research Use Only. Not For Use In Diagnostic Procedures. TNF-alpha ELISA For the quantitative determination of TNF-alpha in serum, plasma, buffered solution or cell culture medium. For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number:

More information

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26

Subject Index. Bcl-2, apoptosis regulation Bone marrow, polymorphonuclear neutrophil release 24, 26 Subject Index A1, apoptosis regulation 217, 218 Adaptive immunity, polymorphonuclear neutrophil role 31 33 Angiogenesis cancer 178 endometrium remodeling 172 HIV Tat induction mechanism 176 inflammatory

More information

BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples

BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples BNP Fragment EIA (Cat.No. BI-20852W) For the Determination of BNP Fragment in Human Samples ASSAY CHARACTERISTICS Method Competitive Enzyme Immunoassay, HRP/TMB. Microtiter plates are coated with a polyclonal

More information

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic

Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic Elaborating ELAD Mechanism of Action and Linking Cell-Based Models to the Clinic September 9, 2017 Patricia W Bedard, Jason Lapetoda, Jagadeesha Dammanahalli, Jessica Van Allen, Susan Lin, Lee Landeen

More information

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive

TECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)

More information

Supplemental Figure Legends

Supplemental Figure Legends Supplemental Figure Legends Supplemental Figure 1. Antibody array analysis of conditioned media from endothelial cells after treatment with exosomes (*p

More information

RayBio Human Thyroglobulin ELISA Kit

RayBio Human Thyroglobulin ELISA Kit RayBio Human Thyroglobulin ELISA Kit Catalog #: ELH-Thyroglobulin User Manual Last revised July 6, 2017 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite

More information

WideScreen BeadPlex Multiplex Assays. Spring 2010

WideScreen BeadPlex Multiplex Assays. Spring 2010 WideScreen BeadPlex Multiplex Assays Spring 2010 Cancer Panels Cancer Biomarkers Cancer Panel 1 (Biomarkers) Cancer Panel 2 (Growth Factors) MMP Panel Cat No: BPHCP001-6 CA 125 CEA (Carcinoembryonic Antigen)

More information

ProcartaPlex Multiplex Immunoassays

ProcartaPlex Multiplex Immunoassays ProcartaPlex Immunoassay ProcartaPlex Multiplex Immunoassays Get exactly the panel you want What would the ability to simultaneously quantitate more than 60 cytokines or other soluble biomarkers from a

More information

RayBio Human ENA-78 ELISA Kit

RayBio Human ENA-78 ELISA Kit RayBio Human ENA-78 ELISA Kit Catalog #: ELH-ENA78 User Manual Last revised April 15, 2016 Caution: Extraordinarily useful information enclosed ISO 13485 Certified 3607 Parkway Lane, Suite 100 Norcross,

More information

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No. Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human TNF-alpha in serum, plasma and cell culture supernatants. general information Catalogue Number Product Name Species cross-reactivity

More information

LDL (Human) ELISA Kit

LDL (Human) ELISA Kit LDL (Human) ELISA Kit Cat. No.:DEIA3864 Pkg.Size:96T Intended use This immunoassay kit allows for the specific measurement of human low density lipoprotein, LDL concentrations in cell culture supernates,

More information

Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer

Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Original Article Multiplexed immunoassay-based serum cytokine profiling for potential prognosis predictors in patients with metastatic breast cancer Hongyan Huang, Yanbin Zhang, Sha Li, Jing Zhao, Xiaoli

More information

Circulating Levels of Inflammatory Proteins and Survival in Patients with

Circulating Levels of Inflammatory Proteins and Survival in Patients with Circulating Levels of Inflammatory Proteins and Survival in Patients with Gallbladder Cancer Zhiwei Liu 1 *, Troy J. Kemp 2, Yu-Tang Gao 3, Amanda Corbel 1, Emma E. McGee 1, Juan Carlos Roa 4,5, Bingsheng

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Biomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia

Biomarkers in drug discovery and development. Margit Wissenbach, PhD Dir Business Development Scandinavia Biomarkers in drug discovery and development Margit Wissenbach, PhD Dir Business Development Scandinavia Aptuit: A Truly Integrated R&D Offering Integrated Discovery Integrated Development IND Candidate

More information

BIOMARKER ELISAs for CLINICAL RESEARCH

BIOMARKER ELISAs for CLINICAL RESEARCH BIOMARKER s BIOMARKER s for CLINICAL RESEARCH QUANTITATIVE EASY-TO-USE RELIABLE Features & Benefits Characterized epitope-mapped antibodies Validated for clinical samples according to ICH and FDA guidelines

More information

Dear Valuable Readers, Thank you for the support

Dear Valuable Readers, Thank you for the support Newsletter Dear Valuable Readers, Inside the issue- Message from the promoter Directors PSA-Glycan YBL-Top Renal Markers Our upcoming Products CA 15-3 Validation reports Welcome to our second newsletter

More information

Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit

Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit Rat Mullerian Inhibiting Substance/Anti-Mullerian hormone, MIS/AMH ELISA kit Catalog No. E0228r (96 tests) Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS!

More information

Hepatic Inflammation and Cellular Therapy

Hepatic Inflammation and Cellular Therapy Hepatic Inflammation and Cellular Therapy Lee K. Landeen, Jessica Van Allen, Patricia W. Bedard Vital Therapies, Inc., San Diego, CA, USA Alcoholic Hepatitis: Role of Inflammation Inflammatory Mediators

More information

Human Leptin ELISA Kit

Human Leptin ELISA Kit Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone

More information

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates

Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Protein Arrays High Throughput Protein Quantification from Total Cell Lysates Dr. Markus Ehrat Mr. Markus Tobler Zeptosens A Division of Bayer (Schweiz) AG Benkenstr. 254 CH-4108 Witterswil Switzerland

More information

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57

TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b NF-kB pathway cluster, Enrichment Score: 3.57 Appendix 2. Highly represented clusters of genes in the differential expression of data. Immune Cluster, Enrichment Score: 5.17 GO:0048584 positive regulation of response to stimulus GO:0050778 positive

More information

HbA1c (Human) ELISA Kit

HbA1c (Human) ELISA Kit HbA1c (Human) ELISA Kit Cat. No.:DEIA3509 Pkg.Size:96T Intended use GHbA1c (Human) ELISA Kit is a sandwich enzyme immunoassay for the quantitative measurement of human GHbA1c. General Description vhemoglobin,

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

human Total Cathepsin B Catalog Number: DY2176

human Total Cathepsin B Catalog Number: DY2176 human Total Cathepsin B Catalog Number: DY2176 This DuoSet ELISA Development kit contains the basic components required for the development of sandwich ELISAs to measure natural and recombinant human Total

More information

colorimetric sandwich ELISA kit datasheet

colorimetric sandwich ELISA kit datasheet colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity

More information

Product Manual. Human LDLR ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures

Product Manual. Human LDLR ELISA Kit. Catalog Number. FOR RESEARCH USE ONLY Not for use in diagnostic procedures Product Manual Human LDLR ELISA Kit Catalog Number STA-386 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is an essential component of cellular membranes,

More information

Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on. CUBE analyser (CA0100)

Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on. CUBE analyser (CA0100) Evaluation Report: Eurolyser CRP test (ST0100 and ST0102) on CUBE analyser (CA0100) Location Location: Eurolyser Diagnostica GmbH Operators: Simone Wieser; Franz Helminger; Michael Gruber Date: July-November

More information

Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed and Secreted (CCL5 / RANTES) Kit

Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed and Secreted (CCL5 / RANTES) Kit TECHNICAL DATA SHEET AlphaLISA Research Reagents Caution: For Laboratory Use. A research chemical for research purposes only. Human C-C Motif Chemokine 5 / Regulated Upon Activation Normal T-cell Expressed

More information

Insulin (Porcine/Canine) ELISA

Insulin (Porcine/Canine) ELISA Insulin (Porcine/Canine) ELISA For the quantitative measurement of insulin in Porcine/Canine serum and plasma (EDTA) For Research Use Only. Not For Use In Diagnostic Procedures. Catalog Number: 80-INSPO-E01

More information

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT

ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS. Choompone Sakonwasun, MD (Hons), FRCPT ACTIVATION AND EFFECTOR FUNCTIONS OF CELL-MEDIATED IMMUNITY AND NK CELLS Choompone Sakonwasun, MD (Hons), FRCPT Types of Adaptive Immunity Types of T Cell-mediated Immune Reactions CTLs = cytotoxic T lymphocytes

More information

Chronic heart failure (CHF) is a complex syndrome that

Chronic heart failure (CHF) is a complex syndrome that Temporal Patterns of 14 Blood Biomarker candidates of Cardiac Remodeling in Relation to Prognosis of Patients With Chronic Heart Failure The Bio-SHiFT Study Elke Bouwens, MD;* Milos Brankovic, MD, PhD;*

More information

The Adiponectin Turbidimetric Immunoassay Reagent Kit

The Adiponectin Turbidimetric Immunoassay Reagent Kit The Adiponectin Turbidimetric Immunoassay Reagent Kit Catalogue number: 51010 For the quantitative determination of Adiponectin in human serum and plasma This package insert must be read in its entirety

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Full inter-omic cross-sectional correlation network Statistically-significant inter-omic cross-sectional Spearman correlations (p adj

More information

REPRODUCTIVE CYCLE OF FEMALE MAMMAL

REPRODUCTIVE CYCLE OF FEMALE MAMMAL REPRODUCTIVE CYCLE OF FEMALE MAMMAL Fig. 8-12 Secondary follicles growing follicles increase in number of layers of granulosa cells Tertiary follicles maturing follicles antrum formation fluid filled space

More information

Cholera host response gene networks: preliminary studies

Cholera host response gene networks: preliminary studies www.bioinformation.net Volume 13(10) Hypothesis Cholera host response gene networks: preliminary studies Paul Shapshak 1 *, Charurut Somboonwit 1, 2, Shu Cao 1, John T. Sinnott 1, 2 1Division of Infectious

More information

Technical Bulletin No. 162

Technical Bulletin No. 162 CPAL Central Pennsylvania Alliance Laboratory Technical Bulletin No. 162 cobas 6800 HCV Viral Load Assay - New Platform - June 1, 2017 Contact: Heather Habig, MLS (ASCP) CM, MB CM, 717-851-1422 Operations

More information

Autoimmune APPLICATION NOTES. MyriadRBM.com. Myriad RBM s Biomarker Testing Lab: CLIA Certified ID # 45D Supports GLP Studies

Autoimmune APPLICATION NOTES. MyriadRBM.com. Myriad RBM s Biomarker Testing Lab: CLIA Certified ID # 45D Supports GLP Studies I N N O V AT I V E B I O M A R K E R S O L U T I O N S Autoimmune APPLICATION NOTES Myriad RBM s Biomarker Testing Lab: CLIA Certified ID # 45D137483 Supports GLP Studies MyriadRBM.com Autoimmune diseases

More information

Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit

Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit Human Thyroid-Peroxidase Antibody, TPO-Ab ELISA Kit Catalog No: E0442h 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers

Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Biomarker Discovery: Prognosis and Management of Chronic Diabetic Foot Ulcers Joseph Colasurdo, BS Dr. William M. Scholl College of Podiatric Medicine July 29, 2017 S Disclosure of Conflicts of Interest

More information

[ APPLICATION NOTE ] High Sensitivity Intact Monoclonal Antibody (mab) HRMS Quantification APPLICATION BENEFITS INTRODUCTION WATERS SOLUTIONS KEYWORDS

[ APPLICATION NOTE ] High Sensitivity Intact Monoclonal Antibody (mab) HRMS Quantification APPLICATION BENEFITS INTRODUCTION WATERS SOLUTIONS KEYWORDS Yun Wang Alelyunas, Henry Shion, Mark Wrona Waters Corporation, Milford, MA, USA APPLICATION BENEFITS mab LC-MS method which enables users to achieve highly sensitive bioanalysis of intact trastuzumab

More information

Insulin ELISA. For the quantitative determination of insulin in serum and plasma

Insulin ELISA. For the quantitative determination of insulin in serum and plasma Insulin ELISA For the quantitative determination of insulin in serum and plasma For In Vitro Diagnostic use within the United States of America. This product is for Research Use Only outside of the United

More information

2 Screen Islet Cell Autoantibody Human ELISA

2 Screen Islet Cell Autoantibody Human ELISA 2 Screen Islet Cell Autoantibody Human ELISA Cat. No.:DEIA4453 Pkg.Size:96T Intended use The 2 Screen Islet Cell autoantibody (2 Screen) ELISA kit is intended for use by professional persons only, for

More information

Technical Bulletin No. 161

Technical Bulletin No. 161 CPAL Central Pennsylvania Alliance Laboratory Technical Bulletin No. 161 cobas 6800 HIV-1 Viral Load Assay - New Platform - June 1, 2017 Contact: Heather Habig, MLS (ASCP) CM, MB CM, 717-851-1422 Operations

More information

AlphaScreen TNFα Binding Assay Kit: A Homogeneous, Sensitive and High-Throughput Assay for Screening TNFα Receptors

AlphaScreen TNFα Binding Assay Kit: A Homogeneous, Sensitive and High-Throughput Assay for Screening TNFα Receptors AlphaScreen TNFα Binding Assay Kit: A Homogeneous, Sensitive and High-Throughput Assay for Screening TNFα Receptors Bouchard N., Legault M. and Wenham D. PerkinElmer BioSignal, 1744 William, suite 3, Montréal,

More information

Mouse C-Peptide ELISA Kit

Mouse C-Peptide ELISA Kit Mouse C-Peptide ELISA Kit Cat.No: DEIA4507 Lot. No. (See product label) Size 96T Intended Use The Mouse C-Peptide ELISA kit is for the quantitative determination of c-peptide in mouse serum, plasma, and

More information

Mercodia Equine Insulin ELISA

Mercodia Equine Insulin ELISA Mercodia Equine Insulin ELISA Directions for Use 10-1205-01 REAGENTS FOR 96 DETERMINATIONS Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden EXPLANATION OF SYMBOLS USED ON LABELS =

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Morinaga Mouse C-peptide ELISA Kit

Morinaga Mouse C-peptide ELISA Kit Morinaga Mouse C-peptide ELISA Kit For the quantitative determination of C-peptide in mouse serum, plasma, and fluid 96wells For Laboratory Use Only, not for use in diagnostic procedure Please read full

More information

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids

EXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles

More information

Biomarkers in Acute Cardiac Disease Samir Arnaout, M.D.FESC Associate Professor of Medicine Internal Medicine i & Cardiology American University of Beirut Time course of the appearance of various markers

More information

renoprotection therapy goals 208, 209

renoprotection therapy goals 208, 209 Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization

More information

InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024

InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024 User Protocol CBA024 Rev. 23 May 2005 RFH Page 1 of 6 InnoZyme Myeloperoxidase Activity Kit Cat. No. CBA024 Table of Contents Page Storage 1 Intended Use 1 Background 1 Principle of the Assay 2 Materials

More information

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones

Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological

More information

LIPASE liquicolor. Design Verification. Multipurpose Reagent

LIPASE liquicolor. Design Verification. Multipurpose Reagent Design Verification LIPASE liquicolor Multipurpose Reagent CONTENTS 1 Introduction... 2 2 Imprecision... 2 3 Linearity and Detection Limit... 2 3.1 Linearity... 2 3.2 Detection Limit... 3 4 Recovery of

More information

Genetics and Cancer Ch 20

Genetics and Cancer Ch 20 Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)

More information

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response

More information

Colorectal cancer - CEA

Colorectal cancer - CEA Colorectal cancer - CEA What is carcinoembryonic antigen? Human carcinoembryonic antigen (CEA) (MW = 175000 200000 g/mol) is a glycoprotein involved in cell adhesion. It is normally produced during fetal

More information

Chemokine Panel 1 (human) Kits

Chemokine Panel 1 (human) Kits Chemokine Panel 1 (human) Kits Eotaxin, MIP-1β, Eotaxin-3, TARC, IP-10, MIP-1α, IL-8, MCP-1, MDC, MCP-4 V-PLEX V-PLEX Plus Multiplex Kits K15047D K15047G Individual Assay Kits Human Eotaxin K151NSD K151NSG

More information

Insulin ELISA. For the quantitative determination of insulin in serum and plasma.

Insulin ELISA. For the quantitative determination of insulin in serum and plasma. Insulin ELISA For the quantitative determination of insulin in serum and plasma. For In Vitro Diagnostic use within the United States of America. This product is for Research Use Only outside of the United

More information

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman

basic Fibroblast Growth Factor 2 (FGF-b; Sf9 insect cell-derived), rhuman D15001 C-60014 Angiopoietin 1 (HeLa cell-derived), (Ang-1), rhuman 20 µg 32,000 D15002 C-60016 Apolipoprotein A1, (APO-A1), rhuman 100 µg 32,000 D15003 C-60017 Apolipoprotein E2, (APO-E2), rhuman 500 µg

More information

Multiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex

Multiplex Suspension Arrays NF-k p65 EGFR Smad2 TGF- c-jun Akt IL-17A/F Stat1 IL-12p70 IGF-IR MEK1 Bio-Plex Multiplex Suspension Arrays NF-kβ p65 TGF-β1 c-jun Smad2 EGF IL-17A/F Akt IGF-IR Stat1 MEK1 IL-12p70 Bio-Plex Multiplex Immunoassays Analyte Guide Summer 2014 2014 Bio-Rad Laboratories, Inc. The Power

More information

Mouse Leptin ELISA Kit Instructions

Mouse Leptin ELISA Kit Instructions V.6/Mar/2008 CRYSTAL CHEM INC. Mouse Leptin ELISA Kit Instructions For the quantitative determination of leptin in mouse serum or plasma and fluid Catalog #: 90030 96 Assays For Research Use Only. Not

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Canine Thyroid Stimulating Hormone, TSH ELISA Kit

Canine Thyroid Stimulating Hormone, TSH ELISA Kit Canine Thyroid Stimulating Hormone, TSH ELISA Kit Catalog No: E0463c 96 Tests Operating instruction www.eiaab.com FOR RESEARCH USE ONLY; NOT FOR THERAPEUTIC OR DIAGNOSTIC APPLICATIONS! PLEASE READ THROUGH

More information