QMS REPORT 146 JUNE 2008 QUALITY IN MICROBIOLOGY SCHEME
|
|
- Rosalind Wade
- 6 years ago
- Views:
Transcription
1 QMS REPORT 146 JUNE 2008 QUALITY IN MICROBIOLOGY SCHEME This report contains the results returned from the analysis of test materials distributed to laboratories in the June 2008 round. The despatch date for the test materials was the 10 June 2008 and the deadline for return of results on the 27 June 2008
2 CONTENTS SECTION 1 INTRODUCTION... 1 SECTION 2 TEST MATERIAL CONTENTS AND ASSIGNED VALUES... 3 SECTION 3 TABLES AND GRAPHS OF RESULTS Table 1 Salmonella species QM06F Table 2 Listeria species QM07F Table 3 Listeria monocytogenes QM07F Table 4 Clostridium species QM10F Table 5 Clostridium perfringens QM10F Table 6 Vibrio species QM13F Table 7 Vibrio parahaemolyticus QM13F Table 8 Total aerobic mesophilic count QM16F Histogram of z-scores Table 9 Escherichia coli QM16F Table 10 Escherichia coli QM16F Histogram of z-scores Table 11 Coliforms QM16F Histogram of z-scores Table 12 Enterobacteriaceae QM16F Histogram of z-scores Table 13 Total aerobic mesophilic count QM16D Histogram of z-scores Table 14 Escherichia coli QM16D Table 15 Escherichia coli QM16D Histogram of z-scores Table 16 Coliforms QM16D Histogram of z-scores Table 17 Enterobacteriaceae QM16D Histogram of z-scores Table 18 Coagulase positive staphylococci QM17F Histogram of z-scores Table 19 Bacillus cereus QM17F Histogram of z-scores... 76
3 Table 20 Escherichia coli QM20F Histogram of z-scores Table 21 Thermotolerant coliforms QM20F Histogram of z-scores Table 22 Escherichia coli O157 QM22D Table 23 Yeast QM23F Histogram of z-scores Table 24 Mould QM23F Table 25 Aerobic psychrotrophic organisms QM25F Histogram of z-scores Table 26 Pseudomonas species QM26D Histogram of z-scores SECTION 4 COMMENTS APPENDIX I AVAILABILITY OF TEST MATERIALS APPENDIX II PERFORMANCE ASSESSMENT CRITERIA APPENDIX III QUALITY CONTROL APPENDIX IV DISTRIBUTORS
4 SECTION 1 - INTRODUCTION Quality in Microbiology Scheme Food is embodied in every aspect of modern society, fulfilling sociological and cultural needs as well as basic survival and nutritional ones. All consumers should have confidence that the food they choose will be safe and wholesome to eat. Food is therefore regularly tested throughout the supply chain for the presence of undesirable micro-organisms, in order to ensure that it is of acceptable microbiological quality. Laboratories carrying out such microbiological testing need to be able to demonstrate that they are producing accurate and meaningful results. This can be done by conducting a comprehensive quality assurance programme, which includes regular participation in a suitable proficiency testing (PT) scheme. The Quality in Microbiology Scheme (QMS) is a PT scheme intended for use by microbiologists working in the food and dairy industries. The scheme includes a wide range of micro-organisms relevant to foods, including indicator organisms, spoilage organisms, and pathogens. Test materials Test materials are representative of food and dairy products. They may or may not contain the target organisms, along with relevant background flora. Inoculum levels for the target organisms will usually be within the following range; Detection tests 0 to 10,000 cfu g -1 Enumeration tests 0 to 100,000 cfu g -1 Micro-organisms may be reference strains sourced from national culture collections, or may be fully characterised wild strains. The full range and availability of test materials in QMS is determined on an annual basis and issued on a Schedule of Availability (Appendix I). Atypical strains may occasionally be included in test materials. Atypical strains can occur in real foods and could be undetected or mis-identified. It therefore represents a realistic challenge to occasionally include atypical strains within a PT scheme. Quality Control The quality of test materials is an essential factor of any PT scheme, with test materials required to be sufficiently homogenous, stable for at least the timescale of the round and similar in nature to the samples routinely analysed by participants. For QMS, quality control tests are performed on every batch of test material prepared. Quality control test results are reported in Appendix III. Performance Assessment The assigned value for enumerated parameters is the robust mean of participant results after transformation to log 10 (unless otherwise stated). The assigned value for qualitative parameters is determined from the test material formulation. All participant results are reported in tables as well as enumeration results being depicted graphically (Section 3). Additionally, each laboratory receives an individual summary of their submitted results. Enumeration results are subject to statistical assessment to help detect trends and enable comparison, using a performance indicator known as a z-score. All results are transformed to log 10 prior to statistical analysis. z score = (x X) σ x = the result reported by the participating laboratory X = the assigned value σ = the standard deviation for proficiency assessment The standard deviation used for proficiency assessment, also called the target standard deviation, is reported in Appendix II. Page 1
5 Advice/feedback Technical comments are included in Section 4. These describe the sample contents, the overall distribution of results, methodologies used and may also suggest possible reasons behind poor performance. Although not exhaustive, the most frequently identified reasons behind unsatisfactory results in QMS are described below: Calculation error Mis-calculation of the dilution factor or failing to take into account the volumes tested often gives results that are a factor of 10 or 100 times higher or lower than the assigned value. Poor quality agar or reagents Agar is highly sensitive to temperatures, particularly to overheating. Overheating can result in the release of compounds that may be detrimental to the growth of micro-organisms. Many selective agars also contain supplements that are intended to recover particular organisms, but if added at too high a concentration, can actually inhibit growth of the same organism, e.g. coliforms are sensitive to bile salts, which are used in agar selective for coliforms. Such problems can be monitored by the use of internal quality control checks using reference organisms. However, reference organisms are carefully nurtured for this very purpose, and stressed organisms, such as those found in foods and in proficiency test materials, will not be as robust. Inappropriate methodology Poor results may be due to use of inappropriate methods. For example, participants may report the use of VRBGA to obtain a coliform result, although this agar actually gives a total Enterobacteriaceae count. Transcription error Part of the challenge of performing laboratory tests is the ability to accurately report results. Transcription errors, e.g. reporting the right result but on the wrong form or in the wrong units, are just as important as any other source of error and care must be taken to check results are reported correctly. Inadequate confirmation Occasionally, participants assume that colony growth on selective agar is confirmation enough, and do not perform further, often relatively simple, confirmatory tests. Conversely, colonies may be immediately discounted if they do not initially appear as expected. Micro-organisms belonging to the same species can exhibit different characteristics, and it takes experience to correctly identify organisms from morphology alone. There are many other possible reasons for a single unsatisfactory result, including statistical chance. It is therefore important to interpret the results from PT schemes within the context of an all-round quality assurance programme, including internal quality control, use of validated methods and reference materials. A single poor result is not indicative of overall laboratory performance, but neither is a single good result. Ideally, PT results should be monitored over time to detect unusual bias or repeated unsatisfactory results which could be due to internal performance. In the event of obtaining an unsatisfactory result, repeat samples are available after every distribution. Further information on the scope and organisation of our proficiency testing schemes is available in the LGC Standards Proficiency Testing General Protocol and Individual Scheme Description. Contact details for QMS Scheme coordinator: Tracey Noblett For any enquiries or feedback please contact qms@lgcpt.com Page 2
6 SECTION 2 - ASSIGNED VALUES Test Material QM06F146 Salmonella species Contents: Salmonella Dublin Test Material QM07F146 Listeria species Listeria monocytogenes Contents: Listeria monocytogenes Test Material QM10F146 Clostridium species Clostridium perfringens Contents: Clostridium bifermentans Test Material QM13F146 Vibrio species Vibrio parahaemolyticus Contents: Aeromonas hydrophila Test Material QM16F146 Total aerobic mesophilic count Escherichia coli Escherichia coli Coliforms Enterobacteriaceae Contents: Escherichia coli, Staphylococcus caprae Test Material QM16D146 Total aerobic mesophilic count Escherichia coli Escherichia coli Coliforms Enterobacteriaceae Contents: Escherichia coli, Staphylococcus caprae Test Material QM17F146 Coagulase positive staphylococci Bacillus cereus Contents: Staphylococcus aureus, Bacillus cereus Test Material QM20F146 Escherichia coli Thermotolerant coliforms Contents: Escherichia coli, Klebsiella oxytoca Assigned Value/Intended Result Detected Assigned Value/Intended Result Detected Detected Assigned Value/Intended Result Detected <10 cfu/g Assigned Value/Intended Result Not Detected Not Detected Assigned Value/Intended Result 1,840 cfu/g Detected 200 cfu/g 220 cfu/g 210 cfu/g Assigned Value/Intended Result 1,220 cfu/g Detected 200 cfu/g 200 cfu/g 160 cfu/g Assigned Value/Intended Result 1,500 cfu/g 700 cfu/g Assigned Value/Intended Result 4,600 cfu/g 5,600 cfu/g Page 3
7 Test Material QM22D146 Escherichia coli O157 (non-toxigenic strain) Contents: Escherichia coli O157 non-toxigenic Test Material QM23F146 Assigned Value/Intended Result Detected Assigned Value/Intended Result Yeast Mould Contents: Saccharomyces cerevisiae 6,300 cfu/g <10 cfu/g Test Material QM25F146 Aerobic psychrotrophic organisms Contents: Pseudomonas fluorescens Test Material QM26D146 Pseudomonas species Contents: Pseudomonas fluorescens Assigned Value/Intended Result 2,650 cfu/g Assigned Value/Intended Result 1,580 cfu/g Page 4
8 SECTION 3 TABLES AND GRAPHS OF RESULTS QUALITY IN MICROBIOLOGY SCHEME
9
10 TABLE 1 SALMONELLA SPECIES - OATMEAL Test Material 06F146 Intended Result Detected Lab ID Result Lab ID Result MC0141 JT Detected MC0886 AB Detected MC0379 NJ Detected MC0900 AC Detected MC0431 AN Detected MC0900 JC Detected MC0431 VC Detected MC0900 LH Detected MC0431 YB Detected MC0900 SC Detected MC0433 DN Detected MC0920 MF Detected MC0433 LS Detected MC0945 GT Detected MC0453 fp Detected MC0945 SE Detected MC0453 m Detected MC1027 CV Detected MC0453 s Detected MC1027 SB Detected MC0453 sb Detected MC1027 SC Detected MC0456 BC Detected MC1042 DG Detected MC0483 ML Detected MC1042 DG Detected MC0483 VC Detected MC1096 F.B Detected MC0485 CF Detected MC1096 PF Detected MC0485 CF Detected MC1097 LC Detected MC0485 GY Detected MC1097 M.G. Detected MC0485 GY Detected MC1097 RS Detected MC0562 AN Detected MC1141 LC Detected MC0562 AN Detected MC1159 D Detected MC0562 PM Detected MC1159 D Detected MC0562 PM Detected MC1160 ac Detected MC0579 BB Detected MC1160 ac Detected MC0608 EC Detected MC1160 mt Detected MC0657 as Detected MC1160 mt Detected MC0657 as Detected MC1160 sb Detected MC0657 as Detected MC1160 sb Detected MC0673 kc Detected MC1177 A Detected MC0689 hm Detected MC1184 BB Detected MC0689 smk Detected MC1184 CD Detected MC0696 AG Detected MC1184 ML Detected MC0696 LS Detected MC1226 LP Detected MC0696 PC Detected MC1226 MP Detected MC0719 LF Detected MC1226 NP Detected MC0722 C.T. Detected MC1228 AT Detected MC0722 C.T. Detected MC1228 JK Detected MC0722 D.G. Detected MC1228 JS Detected MC0722 D.G. Detected MC1228 MK Detected MC0722 F.P. Detected MC1266 BM Detected MC0722 F.P. Detected MC1266 mg Detected MC0722 I.S. Detected MC1266 pm Detected MC0722 I.S. Detected MC1266 sd Detected MC0722 M.P. Detected MC1363 PL Detected MC0722 M.P. Detected MC1419 DB Detected MC0738 KOB Detected MC1419 EK Detected MC0738 SG Detected MC1447 SiCh Detected MC0748 AS Detected MC1449 B.Z. Detected MC0748 LS Detected MC1449 F.M. Detected MC0752 AR Detected MC1449 L M Detected MC0752 BB Detected MC1450 anna Detected MC0752 CS Detected MC1452 AD Detected MC0752 MN Detected MC1455 UJ Detected MC0752 VS Detected MC1467 CV Detected MC0778 ER Detected MC1467 EP Detected MC0816 SH Detected MC1467 EP Detected Page 5
11 TABLE 1 SALMONELLA SPECIES - OATMEAL Test Material 06F146 Intended Result Detected Lab ID Result Lab ID Result MC1467 KA Detected MC2041 EDF Detected MC1467 KA Detected MC2041 EDF Detected MC1493 d.v. Detected MC2041 F.F. Detected MC1565 as Detected MC2041 F.F. Detected MC1603 AD Detected MC2043 MF Detected MC1603 AD Detected MC2043 VG Detected MC1603 AD Detected MC2065 a Detected MC1603 AD Detected MC2065 SJ Detected MC1603 AD Detected MC2107 PC Detected MC1603 AD Detected MC2135 FJ Detected MC1633 GG Detected MC2149 JS Detected MC1633 SM Detected MC2161 F. Detected MC1636 js Detected MC2178 EM Detected MC1640 jde Detected MC2178 EM Detected MC1653 EQ Detected MC2178 GM Detected MC1662 BA Detected MC2178 GM Detected MC1662 FM Detected MC2178 KAS Detected MC1684 B.P. Detected MC2178 KAS Detected MC1684 M.L. Detected MC2178 RMK Detected MC1697 NS Detected MC2178 RMK Detected MC1723 RO Detected MC2180 R.C. Detected MC1727 AG Detected MC2180 R.C. Detected MC1727 AG Detected MC2180 R.C. Detected MC1727 AG Detected MC2180 R.C. Detected MC1727 SM Detected MC2184 AP Detected MC1727 SM Detected MC2184 AP Detected MC1727 SM Detected MC2184 FP Detected MC1727 TT Detected MC2184 FP Detected MC1727 TT Detected MC2184 NO Detected MC1727 TT Detected MC2184 NO Detected MC1728 HP Detected MC2184 SB Detected MC1741 H.G Detected MC2184 SB Detected MC1741 H.G Detected MC2247 OP Detected MC1741 M Detected MC2281 AH Detected MC1741 M Detected MC2281 KO Detected MC1747 B Detected MC2281 LP Detected MC1761 BK Detected MC2287 JS Detected MC1761 BM Detected MC2287 JS Detected MC1780 GM Detected MC2287 JS Detected MC1792 KC Detected MC2287 JS Detected MC1792 LC Detected MC2287 JS Detected MC1920 A Detected MC2287 JS Detected MC1926 SDL Detected MC2294 FJCB Detected MC1938 JMW Detected MC2294 FJCB Detected MC1938 JMW Detected MC2294 FJCB Detected MC1946 eb Detected MC2294 FJCB Detected MC1946 LR Detected MC2294 FSL4 Detected MC1946 LR Detected MC2294 FSL4 Detected MC1946 LR Detected MC2294 FSL4 Detected MC1946 LR Detected MC2294 FSL4 Detected MC1946 LR Detected MC2310 A Detected MC2000 GG Detected MC2310 L Detected MC2000 GG Detected MC2310 N Detected MC2008 vb Detected MC2310 P Detected MC2008 vb Detected MC2310 R Detected Page 6
12 TABLE 1 SALMONELLA SPECIES - OATMEAL Test Material 06F146 Intended Result Detected Lab ID Result Lab ID Result MC2310 T Detected MC2994 LB Detected MC2402 CG Not Detected MC2994 MB Detected MC2402 KJ Not Detected MC2994 VD Detected MC2423 FAK Detected MC3002 AMM Detected MC2458 BR Detected MC3002 JAG Detected MC2458 CP Detected MC3002 MH Detected MC2459 jlh Detected MC3002 SR Detected MC2463 CM Detected MC3003 AD Detected MC2492 D.M. Not Detected MC3003 AN Detected MC2492 S.G. Not Detected MC3003 IT Detected MC2509 MP Detected MC3003 JW Detected MC2509 MT Detected MC3003 JW Detected MC2587 A Detected MC3003 LS Detected MC2587 B Detected MC3003 LS Detected MC2612 KR Detected MC3003 RZ Detected MC2612 KR Detected MC3003 RZ Detected MC2614 PS Detected MC3003 WB Detected MC2660 CF Detected MC3072 GD Detected MC2660 CF Detected MC3072 MR Detected MC2660 DR Detected MC3072 YP Detected MC2660 DR Detected MC3076 AR Detected MC2660 JM Detected MC3076 FDP Detected MC2660 JM Detected MC3076 MN Detected MC2660 OS Detected MC3113 EJ Detected MC2660 OS Detected MC3113 MP Detected MC2664 EM Detected MC3113 PS Detected MC2664 GC Detected MC3113 RAG Detected MC2731 FL Detected MC3113 TES Detected MC2731 FL Detected MC3113 UG Detected MC2731 LP Detected MC3126 BA Detected MC2731 LP Detected MC3126 OP Detected MC2731 PP Detected MC3176 C.G. Not Detected MC2731 PP Detected MC3176 I.M. Not Detected MC2731 SG Detected MC3277 JG Detected MC2731 SG Detected MC3277 LK Detected MC2731 SM Detected MC3286 DLM Detected MC2731 SM Detected MC3286 JSW Detected MC2735 E.M. Detected MC3286 KRS Detected MC2742 CL Not Detected MC3294 AG Detected MC2742 HG Not Detected MC3294 SF Detected MC2742 VB Not Detected MC3299 JW Detected MC2798 ANN Detected MC3317 L.C: Detected MC2798 LAL Detected MC3317 M.G. Detected MC2798 MOL Detected MC3317 M.T. Detected MC2813 cv Detected MC3317 P.F. Detected MC2813 so Detected MC3348 jmp Detected MC2813 sr Detected MC3348 kf Detected MC2850 np Detected MC3348 mm Detected MC2886 B&S Detected MC3385 T.K. Not Detected MC2908 JT Detected MC3392 GC Detected MC2916 G.T. Detected MC3394 MGG Detected MC2979 MB Not Detected MC3394 VM Detected MC2994 AO Detected MC3406 stel Detected MC2994 DB Detected MC3416 B Detected MC2994 FV Detected MC3416 C Detected Page 7
13 TABLE 1 SALMONELLA SPECIES - OATMEAL Test Material 06F146 Intended Result Detected Lab ID Result Lab ID Result MC3423 ALN Detected MC3948 RB Detected MC3423 ALN Detected MC3948 SB Detected MC3423 MR Detected MC3949 DG Detected MC3423 MR Detected MC3949 DG Detected MC3424 VL Not Detected MC3949 DG Detected MC3452 SG Detected MC3949 FG Detected MC3452 SG Detected MC3949 FG Detected MC3493 c.b. Detected MC3949 FG Detected MC3493 f.p. Detected MC3984 DIG Detected MC3520 JES Detected MC3984 DOW Detected MC3551 LM Detected MC3984 IGM Detected MC3636 SA Detected MC3990 IP Detected MC3647 JP Detected MC3990 RT Detected MC3743 BG Detected MC3996 HD Detected MC3743 LA Detected MC4040 AMP Detected MC3743 LB Detected MC4040 AMP Detected MC3751 A Detected MC4040 AMP Detected MC3751 B Detected MC4040 AMP Detected MC3751 C Detected MC4040 AMP Detected MC3751 D Detected MC4071 LL Detected MC3756 PAP Detected MC4201 CL Not Detected MC3762 jk Detected MC4201 HB Not Detected MC3771 FC Detected MC4201 HT Not Detected MC3771 LD Detected MC4288 QMS Detected MC3771 MB Detected MC4298 SMS Detected MC3773 AA Detected MC4300 RA Detected MC3773 ce Detected MC4301 LAB Detected MC3773 ce Detected MC4301 LABR Detected MC3773 EG Detected MC4301 MLAB Detected MC3794 ELAB Detected MC4302 ELAB Detected MC3794 MLAB Detected MC4303 EL Detected MC3794 RLAB Detected MC4303 MLAB Detected MC3818 EF Detected MC4303 MLAB Detected MC3818 EI Detected MC4304 DH Detected MC3846 AM Detected MC4323 CM Detected MC3846 AP Detected MC4323 DP Detected MC3846 AS Detected MC4363 FM Detected MC3846 ET Detected MC4364 DR Not Detected MC3846 GH Detected MC4364 EP Not Detected MC3846 JL Detected MC4364 MB Not Detected MC3846 RM Detected MC4365 MG Detected MC3846 SH Detected MC4365 SB Detected MC3913 isik Detected MC4365 SC Detected MC3946 AS Detected MC4383 sdl Detected MC3946 CF Detected MC4383 ts Detected MC3946 CF Detected MC4385 FC Detected MC3946 FC Detected MC4385 RP Detected MC3946 FM Detected MC4409 C.V: Detected MC3946 FM Detected MC4411 GA Detected MC3946 LC Detected MC4411 VT Detected MC3946 MF Detected MC4413 AR Detected MC3946 NC Detected MC4436 rd Detected MC3946 NC Detected MC4445 Mikr Detected MC3948 EG Detected MC4446 JT Detected MC3948 MF Detected MC4454 AKY Detected Page 8
14 TABLE 1 SALMONELLA SPECIES - OATMEAL Test Material 06F146 Intended Result Detected Lab ID Result Lab ID Result MC4454 BS Detected MC4454 PD Detected MC4454 CC Detected MC4455 A Detected MC4454 EK Detected Page 9
15 TABLE 2 LISTERIA SPECIES - OATMEAL Test Material 07F146 Intended Result Detected Lab ID Result Lab ID Result MC0141 JT Detected MC1165 SD Detected MC0212 JM Detected MC1166 B Detected MC0212 KR Detected MC1166 B Detected MC0212 PJ Detected MC1166 C Detected MC0213 CC Detected MC1166 C Detected MC0213 SW Detected MC1166 L Detected MC0213 VB Detected MC1166 L Detected MC0307 tf Detected MC1166 MN Detected MC0431 AN Detected MC1166 MN Detected MC0431 VC Detected MC1177 A Detected MC0431 YB Detected MC1226 LP Detected MC0433 DN Detected MC1226 MP Detected MC0433 LS Detected MC1226 NP Detected MC0456 BC Detected MC1393 bsrb Detected MC0483 ML Detected MC1393 KDPR Detected MC0483 VC Detected MC1393 SLVN Detected MC0485 CF Detected MC1393 SVHR Detected MC0485 GY Detected MC1447 SiCh Detected MC0485 GY Detected MC1449 B.Z. Detected MC0673 rs Detected MC1449 F.M. Detected MC0719 LF Detected MC1449 L M Detected MC0748 AS Detected MC1450 anna Detected MC0748 LM Detected MC1455 UJ Detected MC0748 LS Detected MC1493 d.v. Detected MC0876 MT Detected MC1533 KPH Detected MC0876 PS Detected MC1571 AV Detected MC0876 TF Detected MC1571 AV Detected MC0886 AB Detected MC1571 FC Detected MC0900 AC Detected MC1571 FC Detected MC0900 JC Detected MC1571 LL Detected MC0900 LH Detected MC1571 LL Detected MC0900 SC Detected MC1571 LO Detected MC0915 FML Detected MC1571 LO Detected MC0945 GT Detected MC1571 VR Detected MC0945 SE Detected MC1571 VR Detected MC0956 AC Detected MC1603 AD Detected MC0956 AM Detected MC1603 AD Detected MC0956 DL Detected MC1603 AD Detected MC1027 CV Detected MC1603 AD Detected MC1027 SB Detected MC1605 CT Detected MC1027 SC Detected MC1653 EQ Detected MC1031 jph Detected MC1675 edrm Detected MC1031 jph Detected MC1675 edrm Detected MC1096 F.B Detected MC1675 R Detected MC1096 PF Detected MC1675 R Detected MC1097 LC Detected MC1727 AG Detected MC1097 M.G. Detected MC1727 AG Detected MC1097 RS Detected MC1727 SM Detected MC1104 CR Detected MC1727 SM Detected MC1104 JG Detected MC1727 TT Detected MC1104 RF Detected MC1727 TT Detected MC1165 GC Detected MC1761 BK Detected MC1165 RF Detected MC1761 BM Detected MC1165 RJ Detected MC1764 HM Detected MC1165 SC Detected MC1792 KC Detected Page 10
16 TABLE 2 LISTERIA SPECIES - OATMEAL Test Material 07F146 Intended Result Detected Lab ID Result Lab ID Result MC1792 LC Detected MC2994 LB Detected MC1920 A Detected MC2994 MB Detected MC1936 SS Detected MC2994 VD Detected MC1936 VP Detected MC3014 DW Detected MC1997 KS Detected MC3286 DLM Detected MC1997 KS Detected MC3286 JSW Detected MC1997 KS Detected MC3286 KRS Detected MC2000 GG Detected MC3294 AG Detected MC2163 AS Detected MC3294 SF Detected MC2163 CH Detected MC3317 L.C: Detected MC2163 DW Detected MC3317 M.G. Detected MC2163 EA Detected MC3317 M.T. Detected MC2163 EC Detected MC3317 P.F. Detected MC2163 MD Detected MC3386 e.c. Detected MC2163 OH Detected MC3386 e.c. Detected MC2163 SAM Detected MC3386 t.c. Detected MC2163 VA Detected MC3386 t.c. Detected MC2163 VW Detected MC3392 GC Detected MC2174 SA Detected MC3394 MGG Detected MC2206 M.T. Detected MC3394 VM Detected MC2261 DD Detected MC3423 ALN Detected MC2261 EJ Detected MC3423 ALN Detected MC2261 GH Detected MC3423 MR Detected MC2261 LB Detected MC3423 MR Detected MC2261 MW Detected MC3424 VL Detected MC2261 NE Detected MC3493 c.b. Detected MC2261 PF Detected MC3493 f.p. Detected MC2261 RH Detected MC3743 BG Detected MC2261 SF Detected MC3743 LA Detected MC2261 SM Detected MC3743 LB Detected MC2321 HP Detected MC3756 PAP Detected MC2458 BR Detected MC3762 jk Detected MC2458 CP Detected MC3862 IRE Detected MC2511 BM Detected MC3862 LORI Detected MC2511 CG Detected MC3946 CF Detected MC2511 ML Detected MC3946 CF Detected MC2587 A Detected MC3946 FC Detected MC2587 B Detected MC3946 FC Detected MC2731 FL Detected MC3946 FM Detected MC2731 LP Detected MC3946 FM Detected MC2731 PP Detected MC3946 LC Detected MC2731 SG Detected MC3946 LC Detected MC2731 SM Detected MC3946 NC Detected MC2735 E.M. Detected MC3946 NC Detected MC2798 ANN Detected MC3948 EG Detected MC2798 LAL Detected MC3948 MF Detected MC2798 MOL Detected MC3948 RB Detected MC2813 cv Detected MC3948 SB Detected MC2813 so Detected MC3949 DG Detected MC2813 sr Detected MC3949 FG Detected MC2850 np Detected MC3960 GGL Detected MC2916 G.T. Detected MC4071 LL Detected MC2994 AO Detected MC4114 MR Detected MC2994 DB Detected MC4114 US Detected MC2994 FV Detected MC4144 CP Detected Page 11
17 TABLE 2 LISTERIA SPECIES - OATMEAL Test Material 07F146 Intended Result Detected Lab ID Result Lab ID Result MC4144 DD Detected MC4365 SC Detected MC4201 CL Detected MC4383 sdl Detected MC4201 HB Detected MC4383 ts Detected MC4201 HT Detected MC4385 FC Detected MC4323 CM Detected MC4385 RP Detected MC4323 DP Detected MC4436 rd Detected MC4363 FM Detected MC4454 AKY Detected MC4364 DR Detected MC4454 BS Detected MC4364 EP Detected MC4454 CC Detected MC4364 MB Detected MC4454 EK Detected MC4365 MG Detected MC4454 PD Detected MC4365 SB Detected Page 12
18 TABLE 3 LISTERIA MONOCYTOGENES - OATMEAL Test Material 07F146 Intended Result Detected Lab ID Result Lab ID Result MC0141 JT Detected MC1097 LC Detected MC0212 JM Detected MC1097 M.G. Detected MC0212 KR Detected MC1097 RS Detected MC0212 PJ Detected MC1104 CR Detected MC0213 AT Detected MC1104 JG Detected MC0213 CC Detected MC1104 RF Detected MC0213 SW Detected MC1165 GC Detected MC0213 VB Detected MC1165 RF Detected MC0390 MO Detected MC1165 RJ Detected MC0390 TB Detected MC1165 SC Detected MC0431 AN Detected MC1165 SD Detected MC0431 VC Detected MC1166 B Detected MC0431 YB Detected MC1166 B Detected MC0433 DN Detected MC1166 C Detected MC0433 LS Detected MC1166 C Detected MC0453 fp Not Detected MC1166 L Detected MC0453 m Not Detected MC1166 L Detected MC0453 s Not Detected MC1166 MN Detected MC0453 sb Not Detected MC1166 MN Detected MC0456 BC Detected MC1177 A Detected MC0483 ML Detected MC1226 LP Detected MC0483 ML Detected MC1226 MP Detected MC0483 VC Detected MC1226 NP Detected MC0483 VC Detected MC1393 bsrb Detected MC0485 CF Detected MC1393 KDPR Detected MC0485 CF Detected MC1393 SLVN Detected MC0673 rs Detected MC1393 SVHR Detected MC0719 LF Detected MC1447 SiCh Detected MC0748 AS Detected MC1449 B.Z. Detected MC0748 FR Detected MC1449 F.M. Detected MC0748 JA Detected MC1449 L M Detected MC0748 LM Detected MC1450 anna Detected MC0748 LS Detected MC1455 UJ Detected MC0748 SA Detected MC1467 CV Detected MC0876 MT Detected MC1467 EP Detected MC0876 PS Detected MC1467 KA Detected MC0876 TF Detected MC1493 d.v. Detected MC0886 AB Detected MC1533 KPH Detected MC0900 AC Detected MC1571 AV Detected MC0900 JC Detected MC1571 AV Detected MC0900 LH Detected MC1571 FC Detected MC0900 SC Detected MC1571 FC Detected MC0915 FML Detected MC1571 LL Detected MC0945 GT Detected MC1571 LL Detected MC0945 SE Detected MC1571 LO Detected MC0956 AC Detected MC1571 LO Detected MC0956 AM Detected MC1571 VR Detected MC0956 DL Detected MC1571 VR Detected MC1027 CV Detected MC1603 AD Detected MC1027 SB Detected MC1603 AD Detected MC1027 SC Detected MC1603 AD Detected MC1031 jph Detected MC1603 AD Detected MC1031 jph Detected MC1605 CT Detected MC1096 F.B Detected MC1653 EQ Detected MC1096 PF Detected MC1675 edrm Detected Page 13
19 TABLE 3 LISTERIA MONOCYTOGENES - OATMEAL Test Material 07F146 Intended Result Detected Lab ID Result Lab ID Result MC1675 edrm Detected MC2511 BM Detected MC1675 R Detected MC2511 CG Detected MC1675 R Detected MC2511 ML Detected MC1727 AG Detected MC2587 A Detected MC1727 AG Detected MC2587 B Detected MC1727 AG Detected MC2731 FL Detected MC1727 SM Detected MC2731 LP Detected MC1727 SM Detected MC2731 PP Detected MC1727 SM Detected MC2731 SG Detected MC1727 TT Detected MC2731 SM Detected MC1727 TT Detected MC2735 E.M. Detected MC1727 TT Detected MC2798 ANN Detected MC1761 BK Detected MC2798 LAL Detected MC1761 BM Detected MC2798 MOL Detected MC1764 HM Detected MC2813 cv Detected MC1792 KC Detected MC2813 so Detected MC1792 LC Detected MC2813 sr Detected MC1920 A Detected MC2850 np Detected MC1936 SS Detected MC2916 G.T. Detected MC1936 VP Detected MC2994 AO Detected MC1997 KS Detected MC2994 DB Detected MC1997 KS Detected MC2994 FV Detected MC2000 GG Detected MC2994 LB Detected MC2000 GG Detected MC2994 MB Detected MC2163 AS Detected MC2994 VD Detected MC2163 CH Detected MC3014 DW Detected MC2163 CO Detected MC3126 BA Detected MC2163 DW Detected MC3126 OP Detected MC2163 EA Detected MC3176 C.G. Detected MC2163 EC Detected MC3176 I.M. Detected MC2163 MD Detected MC3286 DLM Detected MC2163 OH Detected MC3286 JSW Detected MC2163 VA Detected MC3286 KRS Detected MC2163 VW Detected MC3294 AG Detected MC2174 SA Detected MC3294 SF Detected MC2206 M.T. Detected MC3317 L.C: Detected MC2261 DD Detected MC3317 M.G. Detected MC2261 EJ Detected MC3317 M.T. Detected MC2261 GH Detected MC3317 P.F. Detected MC2261 LB Detected MC3386 e.c. Detected MC2261 MW Detected MC3386 e.c. Detected MC2261 NE Detected MC3386 t.c. Detected MC2261 PF Detected MC3386 t.c. Detected MC2261 RH Detected MC3392 GC Detected MC2261 SF Detected MC3394 MGG Detected MC2261 SM Detected MC3394 VM Detected MC2278 Timo Detected MC3423 ALN Detected MC2294 FJCB Detected MC3423 ALN Detected MC2294 FJCB Detected MC3423 MR Detected MC2294 FJCB Detected MC3423 MR Detected MC2294 FSL4 Detected MC3424 VL Detected MC2294 FSL4 Detected MC3455 AG Detected MC2294 FSL4 Detected MC3455 AG Detected MC2321 HP Detected MC3455 MG Detected MC2423 FAK Detected MC3455 MG Detected Page 14
20 TABLE 3 LISTERIA MONOCYTOGENES - OATMEAL Test Material 07F146 Intended Result Detected Lab ID Result Lab ID Result MC3493 c.b. Detected MC4144 CP Detected MC3493 f.p. Detected MC4144 DD Detected MC3756 PAP Detected MC4153 AMJ Detected MC3762 jk Detected MC4153 DSP Detected MC3835 RL Detected MC4153 EBH Detected MC3862 IRE Detected MC4153 IA Detected MC3862 LORI Detected MC4153 IBD Detected MC3946 AS Detected MC4201 CL Detected MC3946 CF Detected MC4201 HB Detected MC3946 CF Detected MC4201 HT Detected MC3946 FC Detected MC4306 GB Detected MC3946 FM Detected MC4306 GB Detected MC3946 FM Detected MC4306 MPW Detected MC3946 LC Detected MC4306 MPW Detected MC3946 MF Detected MC4323 CM Detected MC3946 NC Detected MC4323 DP Detected MC3946 NC Detected MC4363 FM Detected MC3948 EG Detected MC4364 DR Detected MC3948 MF Detected MC4364 EP Detected MC3948 RB Detected MC4364 MB Detected MC3948 SB Detected MC4365 MG Detected MC3949 DG Detected MC4365 SB Detected MC3949 DG Detected MC4365 SC Detected MC3949 DG Detected MC4385 FC Detected MC3949 FG Detected MC4385 RP Detected MC3949 FG Detected MC4426 IS Detected MC3949 FG Detected MC4436 rd Detected MC3960 GGL Detected MC4449 SP Not Detected MC3990 IP Detected MC4454 AKY Detected MC3990 RT Detected MC4454 BS Detected MC4071 LL Detected MC4454 CC Detected MC4114 MR Detected MC4454 EK Detected MC4114 US Detected MC4454 PD Detected Page 15
21 TABLE 4 CLOSTRIDIUM SPECIES - OATMEAL Test Material 10F146 Intended Result Detected Lab ID Result Lab ID Result MC0243 CH Detected MC1493 d.v. Detected MC0243 JH Detected MC1493 g.f. Detected MC0243 SC Detected MC1493 i.f. Detected MC0390 MO Detected MC1512 ABJ Detected MC0390 TB Detected MC1512 CA Detected MC0431 AN Detected MC1512 SB Detected MC0431 VC Detected MC1512 SM Detected MC0431 YB Detected MC1512 SW Detected MC0433 DN Detected MC1601 JC Detected MC0433 LS Detected MC1636 js Detected MC0456 BC Detected MC1653 EQ Detected MC0483 AM Detected MC1696 DM Detected MC0483 ML Detected MC1710 as Detected MC0483 VC Detected MC1710 md Detected MC0485 CF Detected MC1712 AC Detected MC0562 AN Detected MC1712 AD Detected MC0562 PM Detected MC1712 DD Detected MC0673 rs Detected MC1712 FC Detected MC0719 LF Detected MC1712 RG Detected MC0748 AS Detected MC1713 AR Detected MC0748 FR Detected MC1713 AR Detected MC0748 JA Detected MC1713 DD Detected MC0748 LM Detected MC1713 DD Detected MC0748 LS Detected MC1713 TDC Detected MC0890 PS Detected MC1713 TDC Detected MC0945 GT Detected MC1727 AG Detected MC0945 SE Detected MC1727 AG Detected MC1001 IH Detected MC1727 SM Detected MC1096 F.B Detected MC1727 SM Detected MC1096 PF Detected MC1727 TT Detected MC1097 LC Detected MC1727 TT Detected MC1097 RS Detected MC1752 JR Detected MC1165 CS Detected MC1761 BK Detected MC1165 GC Detected MC1761 BM Detected MC1165 JL Detected MC1792 KC Detected MC1165 RF Detected MC1792 LC Detected MC1165 ST2 Detected MC1836 GP Detected MC1226 LP Detected MC1836 RL Detected MC1226 MP Detected MC1869 PN Detected MC1226 NP Detected MC1920 A Detected MC1228 AT Detected MC1920 B Detected MC1228 JK Detected MC1920 C Detected MC1228 JS Detected MC1920 D Detected MC1228 MK Detected MC1926 SDL Detected MC1317 NEU Detected MC1985 ER Detected MC1317 Tho Detected MC2000 GG Detected MC1426 lm Detected MC2176 AB Detected MC1426 ss Detected MC2176 AB Detected MC1447 SiCh Detected MC2176 GB Detected MC1449 B.Z. Detected MC2176 GB Detected MC1449 F.M. Detected MC2240 al Detected MC1449 L M Detected MC2240 gm Detected MC1483 az Detected MC2240 pm Detected MC1483 sb Detected MC2240 vg Detected MC1483 vb Detected MC2331 BN Detected Page 16
22 TABLE 4 CLOSTRIDIUM SPECIES - OATMEAL Test Material 10F146 Intended Result Detected Lab ID Result Lab ID Result MC2331 IZZ Detected MC3934 BS Detected MC2331 TS Detected MC3934 BW Detected MC2440 OX Detected MC3946 CF Detected MC2517 GK Detected MC3946 FC Detected MC2517 IV Detected MC3946 FM Detected MC2569 ga Detected MC3946 LC Detected MC2569 lr Detected MC3946 NC Detected MC2731 FL Detected MC3948 EG Detected MC2731 LP Detected MC3948 MF Detected MC2731 PP Detected MC3948 RB Detected MC2731 SG Detected MC3948 SB Detected MC2731 SM Detected MC3949 DG Detected MC2735 E.M. Detected MC3949 FG Detected MC2778 ES Detected MC3963 GL Detected MC2850 np Detected MC3963 GL Detected MC2868 AZ Detected MC3963 GL Detected MC2868 EK Detected MC3963 KK Detected MC2868 MG Detected MC3963 KK Detected MC2868 RJ Detected MC3963 KK Detected MC2916 G.T. Detected MC3963 NM Detected MC3002 AMM Detected MC3963 NM Detected MC3002 BM Detected MC3963 NM Detected MC3002 JAG Detected MC3984 DIG Detected MC3002 LK Detected MC3984 DOW Detected MC3002 MW Detected MC3984 IGM Detected MC3002 SC Detected MC3990 RT Detected MC3002 SS Detected MC4071 LL Detected MC3081 ACCh Detected MC4296 AM Not Detected MC3123 GH Detected MC4296 CC Not Detected MC3123 LK Detected MC4296 JC Not Detected MC3123 RG Detected MC4296 KL Not Detected MC3123 TJ Detected MC4296 PHY Not Detected MC3319 Alco Detected MC4296 SP Not Detected MC3392 GC Detected MC4301 LAB Detected MC3394 MGG Detected MC4302 LABR Detected MC3394 VM Detected MC4303 LAB Detected MC3482 CH Detected MC4304 DH Detected MC3482 sk Detected MC4323 CM Detected MC3493 c.b. Detected MC4323 DP Detected MC3493 f.p. Detected MC4348 P.U Detected MC3683 DPD Detected MC4363 FM Detected MC3683 JFL Detected MC4364 DR Detected MC3683 TEL1 Detected MC4364 EP Detected MC3770 EJ Detected MC4364 MB Detected MC3770 EO Detected MC4387 A Detected MC3794 RLAB Detected MC4387 B Detected MC3829 PLA Detected MC4387 C Detected MC3829 PLA Detected MC4387 D Detected MC3829 RBT Detected MC4387 g Detected MC3829 RBT Detected MC4387 h Detected MC3858 MM Detected MC4402 AMC Detected MC3934 AH Detected MC4402 CE Detected MC3934 AW Detected Page 17
23 TABLE 5 CLOSTRIDIUM PERFRINGENS - OATMEAL Test Material 10F146 ASSIGNED VALUE z-score + 2 z-score - 2 <10 cfu/g N/A N/A Lab ID Result z-score Lab ID Result z-score MC0136 CK 2,000 MC1097 RS <10 MC0136 MM 1,900 MC1165 CS <10 MC0136 MZ 2,000 MC1165 CS <10 MC0243 CH 680 MC1165 GC 200 MC0243 JH 1,730 MC1165 GC <10 MC0243 SC 1,930 MC1165 JL 240 MC0379 MG <10 MC1165 JL <10 MC0379 NJ <10 MC1165 RF 660 MC0379 VB <10 MC1165 RF <10 MC0415 BS <10 MC1165 ST2 30 MC0415 JH <10 MC1165 ST2 <10 MC0415 KA <10 MC1226 LP 4,400 MC0415 LO <10 MC1226 MP 4,700 MC0415 RK <10 MC1226 NP 6,000 MC0431 AN <10 MC1228 AT 1,500 MC0431 VC <10 MC1228 JK 1,700 MC0431 YB <10 MC1228 JS 1,400 MC0433 DN 1,600 MC1228 MK 1,500 MC0433 DN 1,800 MC1317 NEU <10 MC0433 LS 2,000 MC1317 Tho <10 MC0433 LS 2,500 MC1426 lm <10 MC0456 BC 890 MC1426 ss <10 MC0483 AM <10 MC1447 SiCh 1,080 MC0483 ML <10 MC1483 az <10 MC0483 VC <10 MC1483 sb <10 MC0485 CF <10 MC1483 vb <10 MC0562 AN 1,743 MC1493 d.v. <10 MC0562 AN 1,711 MC1493 g.f. <10 MC0562 PM 1,558 MC1493 i.f. <10 MC0562 PM 1,824 MC1509 pc <10 MC0673 rs <10 MC1509 YZ <10 MC0719 LF 0 MC1512 ABJ 2,100 MC0738 C 650 MC1512 CA 2,200 MC0738 KOB 770 MC1512 SB 1,900 MC0738 KOB 770 MC1512 SM 1,900 MC0738 MB 680 MC1512 SW 3,000 MC0738 RH 700 MC1601 JC <10 MC0738 SG 710 MC1602 int <2 MC0900 AC <10 MC1602 int <2 MC0900 AS <10 MC1602 int <2 MC0900 EMA <10 MC1602 int <2 MC0900 ES <10 MC1602 int <2 MC0900 GH <10 MC1636 js 0 MC0900 JB <10 MC1653 EQ 1,100 MC0900 JC <10 MC1653 EQ <10 MC0900 LH <10 MC1684 B.P. <100 MC0900 MM <10 MC1684 M.L. <100 MC0900 SC <10 MC1696 DM <10 MC0945 GT 1,200 MC1710 as <10 MC0945 SE 1,000 MC1710 as <10 MC1096 F.B <10 MC1710 md <10 MC1096 PF <10 MC1710 md <10 MC1097 LC <10 MC1712 AC <10 Page 18
24 TABLE 5 CLOSTRIDIUM PERFRINGENS - OATMEAL Test Material 10F146 ASSIGNED VALUE z-score + 2 z-score - 2 <10 cfu/g N/A N/A Lab ID Result z-score Lab ID Result z-score MC1712 AD <10 MC2261 DD <10 MC1712 DD <10 MC2261 EJ <10 MC1712 FC <10 MC2261 GH <10 MC1712 RG <10 MC2261 LB <10 MC1713 AR <10 MC2261 MG <10 MC1713 AR <10 MC2261 MW <10 MC1713 AR <10 MC2261 NE <10 MC1713 AR <10 MC2261 PF <10 MC1713 DD <10 MC2261 SF <10 MC1713 DD <10 MC2261 SM <10 MC1713 DD <10 MC2331 BN 1,100 MC1713 TDC <10 MC2331 IZZ 1,100 MC1713 TDC <10 MC2331 TS 1,100 MC1713 TDC <10 MC2440 OX 1,700 MC1752 JR 880 MC2517 GK <10 MC1761 BK <10 MC2517 IV <10 MC1761 BM <10 MC2569 ga <100 MC1792 KC Not Detected MC2569 lr <100 MC1792 LC Not Detected MC2731 FL <10 MC1836 GP <10 MC2731 LP <10 MC1836 RL <10 MC2731 PP <10 MC1869 PN 1,450 MC2731 SG <10 MC1891 MBV <10 MC2731 SM <10 MC1891 MBV <10 MC2735 E.M. 1,000 MC1920 A 950 MC2778 ES 1,450 MC1920 B 800 MC2813 cv 1,000 MC1920 C 850 MC2813 so 800 MC1920 D 930 MC2813 sr 800 MC1926 SDL 3,200 MC2850 np <10 MC1985 ER 1,200 MC2869 AG <10 MC2000 GG <10 MC2869 CF <10 MC2065 a 380 MC2869 CR <10 MC2065 SJ 390 MC2869 DT <10 MC2176 AB <10 MC2869 EG <10 MC2176 AB <10 MC2869 JL <10 MC2176 AB <10 MC2869 LO <10 MC2176 AB <10 MC2869 LS <10 MC2176 GB <10 MC2869 RS <10 MC2176 GB <10 MC2916 G.T. <10 MC2176 GB <10 MC2979 SL 0.1 MC2176 GB <10 MC2982 AB 1,230 MC2184 AP <10 MC2982 CBO 1,290 MC2184 AP <10 MC2982 KW 1,270 MC2184 FP <10 MC2982 TOS 1,300 MC2184 FP <10 MC3000 TA 0 MC2184 NO <10 MC3000 TB 0 MC2184 NO <10 MC3002 AMM 630 MC2184 SB <10 MC3002 BM 720 MC2184 SB <10 MC3002 JAG 770 MC2240 al <10 MC3002 LK 880 MC2240 gm <10 MC3002 MW 630 MC2240 pm <10 MC3002 SS 1,100 MC2240 vg <10 MC3003 AD 2,000 Page 19
25 TABLE 5 CLOSTRIDIUM PERFRINGENS - OATMEAL Test Material 10F146 ASSIGNED VALUE z-score + 2 z-score - 2 <10 cfu/g N/A N/A Lab ID Result z-score Lab ID Result z-score MC3003 AN 2,500 MC3829 RBT 2,200 MC3003 IT 2,400 MC3858 MM <10 MC3003 JW 2,300 MC3934 AH 2,700 MC3003 RZ 1,900 MC3934 AW 3,000 MC3003 WB 1,700 MC3934 BS 2,600 MC3081 ACCh 1,900 MC3934 BW 2,900 MC3081 ACCh 1,888 MC3946 CF <10 MC3081 ACCh 1,500 MC3946 FC <10 MC3081 ACCh 1,750 MC3946 FM <10 MC3112 mr2 <100 MC3946 LC <10 MC3112 mr2 <100 MC3946 NC <10 MC3112 mr2 <100 MC3948 EG <100 MC3123 GH <10 MC3948 MF <100 MC3123 LK <10 MC3948 RB <100 MC3123 RG <10 MC3948 SB <100 MC3123 TJ <10 MC3949 DG <10 MC3317 L.C: 1,300 MC3949 FG <10 MC3317 M.G. 1,500 MC3963 GL 2,150 MC3317 M.T. 1,000 MC3963 GL 2,150 MC3317 P.F. 1,100 MC3963 GL 2,050 MC3319 Alco <10 MC3963 KK 1,650 MC3355 AI 800 MC3963 KK 1,500 MC3355 MB 1,100 MC3963 KK 1,600 MC3392 GC <10 MC3963 NM 1,830 MC3394 MGG 750 MC3963 NM 1,760 MC3394 VM 400 MC3963 NM 1,600 MC3482 CH 2,300 MC3990 RT <10 MC3482 dd 2,000 MC3990 RT <10 MC3482 lc 2,100 MC4071 LL <10 MC3482 ob 2,000 MC4296 AM <10 MC3482 PH 2,200 MC4296 CC <10 MC3482 sk 1,900 MC4296 JC <10 MC3493 c.b. 190 MC4296 KL <10 MC3493 c.b. 200 MC4296 PHY <10 MC3493 f.p. 180 MC4296 SP <10 MC3493 f.p. 200 MC4298 SMS <10 MC3683 DPD <10 MC4300 LAB <10 MC3683 DPD Not Detected MC4300 MLAB <10 MC3683 JFL <10 MC4301 LAB <10 MC3683 JFL Not Detected MC4301 MLAB <10 MC3683 TEL1 Not Detected MC4302 LABR <10 MC3683 TEL1 <10 MC4302 MLAB <10 MC3770 EJ 2,000 MC4303 LAB <10 MC3770 EJ 1,650 MC4303 MLAB <10 MC3770 EJ 1,820 MC4304 DH <10 MC3770 EO 2,100 MC4323 CM 2,800 MC3770 EO 1,750 MC4323 DP 1,900 MC3770 EO 1,950 MC4348 P.U 1,870 MC3794 MLAB 470 MC4364 DR <10 MC3794 RLAB 350 MC4364 EP <10 MC3829 PLA 2,227 MC4364 MB <10 MC3829 PLA 2,230 MC4365 SB 1,000 MC3829 RBT 2,180 MC4365 SC 750 Page 20
26 TABLE 5 CLOSTRIDIUM PERFRINGENS - OATMEAL Test Material 10F146 ASSIGNED VALUE z-score + 2 z-score - 2 <10 cfu/g N/A N/A Lab ID Result z-score Lab ID Result z-score MC4383 sdl 2,500 MC4387 C 7,000 MC4383 ts 2,200 MC4387 D 7,500 MC4387 A 7,100 MC4387 g 7,100 MC4387 B 7,400 MC4387 h 7,300 Page 21
27 TABLE 6 VIBRIO SPECIES - OATMEAL Test Material 13F146 Intended Result Not Detected Lab ID Result Lab ID Result MC0425 CR Not Detected MC2748 LM Not Detected MC0425 DD Not Detected MC2943 ED Not Detected MC0425 EM Not Detected MC2943 EP Not Detected MC0425 SJ Not Detected MC2943 MDe Not Detected MC0425 UK Not Detected MC2943 YC Not Detected MC0440 NP Not Detected MC3002 AMM Not Detected MC0467 AJ Not Detected MC3002 MH Not Detected MC0959 PS Not Detected MC3002 SR Not Detected MC0959 PS Not Detected MC3285 Ms. Not Detected MC1105 SC Not Detected MC3344 IGA Not Detected MC1228 AV Not Detected MC3591 CR Not Detected MC1228 ID Not Detected MC3591 DO Not Detected MC1228 ZJ Not Detected MC3591 PW Not Detected MC1228 ZS Not Detected MC3591 RP Not Detected MC1522 mk Not Detected MC3591 SK Not Detected MC1764 HM Detected MC3594 MPG Not Detected MC1937 A.M. Not Detected MC3988 AD Not Detected MC1937 A.M. Not Detected MC3988 AD Not Detected MC1937 A.M. Not Detected MC3988 AD Not Detected MC1937 A.M. Not Detected MC3988 AD Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC4201 CL Not Detected MC1937 A.M. Not Detected MC4201 HB Not Detected MC2180 R.C. Not Detected MC4201 HT Not Detected MC2180 R.C. Not Detected MC4315 AC Not Detected MC2569 ga Not Detected MC4315 SL Not Detected MC2569 lr Not Detected MC4435 EJ Not Detected MC2728 CBA Not Detected Page 22
28 TABLE 7 VIBRIO PARAHAEMOLYTICUS - OATMEAL Test Material 13F146 Intended Result Not Detected Lab ID Result Lab ID Result MC0425 CR Not Detected MC1937 A.M. Not Detected MC0425 CR Not Detected MC2180 R.C. Not Detected MC0425 DD Not Detected MC2180 R.C. Not Detected MC0425 DD Not Detected MC2526 isol Not Detected MC0425 EM Not Detected MC2569 ga Not Detected MC0425 EM Not Detected MC2569 lr Not Detected MC0425 SJ Not Detected MC2728 CBA Not Detected MC0425 SJ Not Detected MC2748 LM Not Detected MC0425 UK Not Detected MC2801 LG Not Detected MC0425 UK Not Detected MC2943 ED Not Detected MC0440 NP Not Detected MC2943 EP Not Detected MC0467 AJ Not Detected MC2943 MDe Not Detected MC0673 kc Not Detected MC2943 YC Not Detected MC0959 PS Not Detected MC3002 AMM Not Detected MC0959 PS Not Detected MC3002 MH Not Detected MC1105 SC Not Detected MC3002 SR Not Detected MC1122 IF Detected MC3285 Ms. Not Detected MC1122 IF Detected MC3344 IGA Not Detected MC1122 IF Not Detected MC3591 CR Not Detected MC1122 IF Not Detected MC3591 DO Not Detected MC1149 AG Not Detected MC3591 PW Not Detected MC1149 CA Not Detected MC3591 RP Not Detected MC1149 DL Not Detected MC3591 SK Not Detected MC1228 AV Not Detected MC3594 MPG Not Detected MC1228 ID Not Detected MC3988 AD Not Detected MC1228 ZJ Not Detected MC3988 AD Not Detected MC1228 ZS Not Detected MC3988 AD Not Detected MC1522 mk Not Detected MC3988 AD Not Detected MC1764 HM Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC3988 AV Not Detected MC1937 A.M. Not Detected MC4201 CL Not Detected MC1937 A.M. Not Detected MC4201 HB Not Detected MC1937 A.M. Not Detected MC4201 HT Not Detected MC1937 A.M. Not Detected MC4315 AC Not Detected MC1937 A.M. Not Detected MC4315 SL Not Detected MC1937 A.M. Not Detected MC4435 EJ Not Detected Page 23
29 TABLE 8 TOTAL AEROBIC MESOPHILIC COUNT - OATMEAL Test Material 16F146 ASSIGNED VALUE z-score + 2 z-score - 2 1,840 cfu/g 9,222 cfu/g 367 cfu/g Lab ID Result z-score Lab ID Result z-score MC0136 BG 1, MC0487 BA 1, MC0136 MM 1, MC0579 BB 4, MC0136 MZ 1, MC0608 EC 6, MC0141 JW 1, MC0608 MF 6, MC0141 MS 1, MC0673 kc 3, MC0243 CH 1, MC0692 L 2, MC0243 JH 2, MC0719 LF 2, MC0243 SC 1, MC0738 C 1, MC0264 CD 2, MC0738 KOB 1, MC0264 CG 6, MC0738 MB 1, MC0264 JW 1, MC0738 RH 1, MC0264 NP 5, MC0738 SG 1, MC0264 VM 2, MC0748 AS MC0264 YT 7, MC0748 FR MC0279 P.R 2, MC0748 JA MC0307 ad 2, MC0748 LM MC0307 tf 2, MC0748 LS MC0315 LDZ 23, MC0816 SH 3, MC0379 MG 2, MC0843 SL 20, MC0379 NJ 2, MC0843 SL 18, MC0379 VB 2, MC0843 SL 19, MC0390 MO 1, MC0886 MR MC0390 TB MC0886 RPJ MC0410 BF 1, MC0902 CB 1, MC0410 LD 1, MC0902 MC 2, MC0415 BS 7, MC0902 PK 1, MC0415 JH 8, MC0925 DG 1, MC0415 KA 6, MC0925 LAW 1, MC0415 LO 7, MC0925 TP 1, MC0415 RK 7, MC0945 GT 1, MC0431 AN 2, MC0945 SE 1, MC0431 VC 2, MC0978 gb MC0431 YB 2, MC0978 hm MC0433 DN 1, MC0978 js MC0433 DN 1, MC0978 mv MC0433 LS 1, MC0978 no MC0433 LS 1, MC0978 sa MC0444 SC 1, MC0978 tb MC0444 SC 1, MC0988 mvg 1, MC0453 fp 2, MC1001 IH 1, MC0453 m 3, MC1020 SF 1, MC0453 s 2, MC1027 CV 1, MC0453 sb 2, MC1027 SB 2, MC0456 BC 6, MC1027 SC 2, MC0483 ML 1, MC1096 F.B 1, MC0483 ML 2, MC1096 PF 1, MC0483 VC 1, MC1097 LC 1, MC0483 VC 1, MC1097 RS 1, MC0485 CF 1, MC1104 CR 1, MC0485 CF 1, MC1104 JG 1, MC0485 CF 1, MC1104 MT MC0485 GY 1, MC1104 RB MC0485 GY 1, MC1104 RF 5, Page 24
30 TABLE 8 TOTAL AEROBIC MESOPHILIC COUNT - OATMEAL Test Material 16F146 ASSIGNED VALUE z-score + 2 z-score - 2 1,840 cfu/g 9,222 cfu/g 367 cfu/g Lab ID Result z-score Lab ID Result z-score MC1127 AH 3, MC1727 AG 3, MC1127 EK 4, MC1727 SM 3, MC1127 MB 2, MC1727 TT 3, MC1127 TC 4, MC1741 H.G 13, MC1127 TC1 1, MC1741 M 12, MC1141 LC 5, MC1761 BH 3, MC1226 LP 1, MC1761 BK 5, MC1226 MP 1, MC1761 BM 5, MC1226 NP 1, MC1764 HM 2, MC1228 AT 1, MC1768 BRI 3, MC1228 AT 2, MC1768 CYN 3, MC1228 JK 1, MC1768 SHA 3, MC1228 JK 2, MC1786 EMG 3, MC1228 JS 1, MC1786 JB 3, MC1228 JS 1, MC1786 PC 2, MC1228 MK 1, MC1786 PMM 3, MC1228 MK 1, MC1786 POD 3, MC1229 AS 2, MC1792 KC 8, MC1243 mc 6, MC1792 LC 7, MC1422 ElL 2, MC1920 A MC1447 SiCh 1, MC1926 SDL 1, MC1449 B.Z. 1, MC1948 QAR 1, MC1449 B.Z. 1, MC1948 QAR 1, MC1449 F.M. 1, MC1985 ER 2, MC1449 F.M. 2, MC2000 GG 2, MC1449 L M 1, MC2000 GG 1, MC1449 L M 2, MC2051 SD 3, MC1450 anna 1, MC2083 JS 3, MC1467 CV 4, MC2083 JS 3, MC1467 EP 2, MC2083 JS MC1467 KA 3, MC2083 JS MC1493 d.v. 1, MC2083 JS 1, MC1493 g.f. 1, MC2083 JS MC1493 i.f. 1, MC2083 JVH MC1518 SLA 1, MC2083 JVH MC1576 IB MC2083 JVH 1, MC1576 IB MC2083 JVH 1, MC1576 IB MC2127 SLA 1, MC1576 IB MC2135 JG 1, MC1576 IB MC2135 LLB 1, MC1603 AD 2, MC2135 PG 2, MC1603 AD 3, MC2149 JS 2, MC1603 AD 3, MC2152 ch 14, MC1603 AD 3, MC2152 sa 14, MC1629 VF 3, MC2152 sy 13, MC1636 js 3, MC2247 OP 3, MC1653 EQ 3, MC2331 BN 2, MC1653 EQ 2, MC2331 IZZ 1, MC1688 CK 2, MC2331 TS 2, MC1688 CK 2, MC2346 dhr 1, MC1701 GB 1, MC2402 CG 1, MC1716 A.C MC2402 KJ 1, MC1723 RO MC2423 FAK 3, Page 25
31 TABLE 8 TOTAL AEROBIC MESOPHILIC COUNT - OATMEAL Test Material 16F146 ASSIGNED VALUE z-score + 2 z-score - 2 1,840 cfu/g 9,222 cfu/g 367 cfu/g Lab ID Result z-score Lab ID Result z-score MC2423 FAK 3, MC2916 G.T. 1, MC2423 JVS 3, MC2979 MB 4, MC2423 JVS 3, MC2979 MB 4, MC2423 JWK 2, MC2982 EP MC2423 JWK 2, MC2982 IL MC2458 BR 3, MC2982 JC 1, MC2458 CP 3, MC2982 MS 1, MC2460 AN1 2, MC3002 JAG MC2460 AN2 1, MC3002 JAG MC2460 MA1 2, MC3002 JCG MC2460 MA2 2, MC3002 KA MC2460 PA1 2, MC3002 KA 1, MC2460 PA2 1, MC3002 LK MC2460 PA3 2, MC3002 LK MC2460 SO1 1, MC3002 SC 1, MC2460 SO2 1, MC3003 AD 1, MC2463 SM 2, MC3003 AN 1, MC2489 MC 2, MC3003 IT 1, MC2492 D.M. 1, MC3003 JW 1, MC2492 S.G. 1, MC3003 RZ 1, MC2505 AHA 2, MC3003 WB 1, MC2505 LKO 2, MC3072 GD 1, MC2587 A 1, MC3072 MR 1, MC2587 B 1, MC3072 YP 1, MC2610 TF 1, MC3076 AR MC2612 KR 1, MC3076 FDP 1, MC2612 KR 1, MC3076 MN 1, MC2612 KR 1, MC3112 mr MC2612 KR 2, MC3112 mr MC2647 CV 1, MC3112 mr MC2647 NE 1, MC3126 BA 1, MC2731 FL 1, MC3126 OP 1, MC2731 LP 1, MC3132 PS 1, MC2731 PP 1, MC3133 BN 4, MC2731 SG MC3133 Peb 5, MC2731 SM 1, MC3164 RM MC2735 E.M. 1, MC3168 FDV 1, MC2738 b.o. 3, MC3168 Y 1, MC2759 BS 3, MC3175 MJ 7, MC2759 DS 2, MC3175 NZ 5, MC2771 A 1, MC3175 TB 6, MC2771 J 1, MC3176 C.G. 2, MC2771 S 1, MC3176 I.M. 1, MC2798 ANN 1, MC3209 BR 2, MC2798 LAL 1, MC3209 BR 2, MC2798 MOL 2, MC3209 BR 2, MC2813 cv 1, MC3209 BR 2, MC2813 so 1, MC3230 ANG 1, MC2813 sr 2, MC3230 MOT 1, MC2839 MM 3, MC3285 Ms. 2, MC2839 SM 2, MC3286 DLM 1, MC2850 np 2, MC3286 JSW 1, MC2894 GV 2, MC3286 KRS 1, Page 26
Spherical Bearings Heavy Duty Equipments
Spherical Bearings Heavy Duty Equipments Highlights Quality Service Price Wbf Replacement Parts adaptableto > Caterpillar >Komatsu >Volvo 1 WBF SPHERICAL BEARINGS adaptable to Caterpillar Part No. Description
More informationDeclaration of conformity Adapter
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA Document ID: 34466 Editing status: 2017-05-19 2 CFR FDA stands for Food and Drug Administration, a U.S. authority.
More informationEOPS PROBATION STUDENT LIST
EOPS PROBATION STUDENT LIST Fall 2018 EOPS The following students have been placed on EOPS Probation due to their not satisfying the semester g.p.a. and/or semester units completed requirements of the
More informationQMAS. Scheme Description. Quality in Meat and Fish Analysis Scheme
QMAS Quality in Meat and Fish Analysis Scheme Scheme Description LGC Standards Proficiency Testing 1 Chamberhall Business Park Chamberhall Green Bury Lancashire BL9 0AP United Kingdom Telephone: +44 (0)
More informationThe Effects of Hydrophilic Contact Lens Wear on the Reduction of Progressive Myopia in Adolescents. by Bob Deck
The Effects of Hydrophilic Contact Lens Wear on the Reduction of Progressive Myopia in Adolescents by Bob Deck The purpose of this retrospective study was to evaluate the effects of hydrophilic contact
More informationMolecular and Cellular Tumor Pathology Laboratory, Cancer Center Karolinska,
Antiproliferative Effects of 1α-OH-vitD 3 in Malignant Melanoma. Potential Therapeutic implications Lucia Spath 1,+, Alessandra Ulivieri 1,4+, Luca Lavra 1,4, Laura Fidanza 2, Marta Carlesimo 2, Maria
More informationSupplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E,
Supplementary Figure 1. FACS analysis of cells infected with TY93/H5N1 GFP-627E, TY93/H5N1 GFP-627K, or the TY93/H5N1 PB2(588-759) virus library. To establish our GFP- FACS screening platform, we compared
More informationAppendix A: International Classification of Diseases, 10th Revision, Clinical Modification Codes (ICD-10) Utilized for VTE Events
Online Appendices to Mahan et al. External validation of a risk assessment model for venous thromboembolism in the hospitalised acutely-ill medical patient (VTE-VALOURR) (Thromb Haemost 2014; 112.4) Appendix
More informationQMS. Scheme Description. Quality in Microbiology Scheme
QMS Quality in Microbiology Scheme Scheme Description LGC Standards Proficiency Testing 1 Chamberhall Business Park Chamberhall Green Bury, BL9 0AP UK. Telephone: +44 (0) 161 762 2500 Fax: +44 (0) 161
More informationAspects of Hypoglycemia
Aspects of Hypoglycemia Erik T. Paterson 1 M.D. Abstract To two groups of patients the standard six hour oral glucose tolerance test was administered. Over 80 percent of both groups had abnormal responses
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationOur next questions are about Contingency Management.
II.B.04.01 01 Our next questions are about Contingenc t. Higgins and Petr (1999) describe Contingenc t as the sstematic reinforcement of desired behaviors and the withholding of reinforcement or punishment
More informationProficiency Testing. Food Microbiology. April 2015
Proficiency Testing Food Microbiology April 215 Edition Version 1 (215-5-28) Editor in chief Hans Lindmark, head of Biology department, National Food Agency Responsible for the scheme Laurence Nachin,
More informationA Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech
More informationGenetic Analysis of Allosteric Signaling in RhaR from Escherichia coli and Characterization of the VirF Protein from Shigella flexneri
Genetic Analysis of Allosteric Signaling in RhaR from Escherichia coli and Characterization of the VirF Protein from Shigella flexneri By Bria Collette Kettle Submitted to the graduate degree program in
More informationAFPS. Scheme Description. Animal Feeds Proficiency Testing Scheme
AFPS Animal Feeds Proficiency Testing Scheme Scheme Description LGC Standards Proficiency Testing 1 Chamberhall Business Park Chamberhall Green Bury, BL9 0AP UK. Telephone: +44 (0) 161 76 500 Fax: +44
More informationVimta Labs Ltd., Life Sciences Facility, Plot No. 5, Alexandria Knowledge Park, Genome Valley, Shameerpet, Hyderabad, Telangana
Last Amended on - Page 1 of 14 I. DRUGS & PHARMACEUTICALS 1. Biological Assays Antibiotics And Other Drugs Bulk Drugs & Their Formulations: Erythromycin, Gentamicin, Nystatin IP Appendix 9.1 2.2.10 BP
More information(43) Publication date: 04 September 2014 ( ) (22) Filing Date: 27 February 2014 ( )
(54) Title (EN): INCOHERENT TYPE-III MATERIALS FOR CHARGE CARRIERS CONTROL DEVICES (54) Title (FR): MATÉRIAUX DE TYPE III INCOHÉRENTS POUR DISPOSITIFS DE RÉGULATION DE PORTEURS DE CHARGES (72) Inventor(s):
More informationmodified dye uptake assay including formazan test EC 90 not tested plaque reduction assay
Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes
More informationComplementary Medicine or Food. Peter Kissane Chief Operating Officer Sphere Healthcare
Complementary Medicine or Food Peter Kissane Chief Operating Officer Sphere Healthcare Therapeutic Goods Act (1990) defines what are Medicines Rx, OTC & Complementary Medicines Complementary Medicines
More informationIPC REVISION WORKING GROUP. Ninth Session Geneva, June 2 to 13, 2003
E IPC/WG/9/3 ORIGINAL: English only DATE: May 23, 2003 WORLD INTELLECTUAL PROPERTY ORGANIZATION GENEVA SPECIAL UNION FOR THE INTERNATIONAL PATENT CLASSIFICATION (IPC UNION) IPC REVISION WORKING GROUP Ninth
More informationQuantitative immunochemical tests: evidence on accuracy and implementation considerations in the Czech MUDr.. Petr Kocna, CSc.
Quantitative immunochemical tests: evidence on accuracy and implementation considerations in the Czech MUDr.. Petr Kocna, CSc. European Digestive Cancer Days, Prague - 26. September 2017 QUANTITATIVE FIT
More informationWO 2012/ A3. 15 November 2012 ( ) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International
More informationDCP Networks
www.bps.org.uk/dcp DCP Networks To support and promote clinical psychology, working collaboratively with people who use our services and wider communities to improve wellbeing and to promote the unique
More informationThin Film PV Technologies CIGS PV Technology
Thin Film PV Technologies CIGS PV Technology Week 5.3 Arno Smets CIGS NiA1 MgF 2 TCO (ZnO:Al) TCO (intrinsic ZnO) CdS (n-type) CuInSe 2 (p-type) Mo Glass CIGS IV- semiconductors: III- V semiconductors:
More informationConveyor System MM3. Chain width 83mm MODU System MM3 conveyor is also available in stainless steel. See page DM1.
Conveyor System MM3 Conveyor System MM3 Chain width 83mm MODU System MM3 conveyor is also available in stainless steel. See page DM1. Features Suitable for a wide range of applications. Examples of application
More informationDeclaration of conformity VEGAVIB 61
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA Document ID: 32556 Editing status: 2016-10-25 2 CFR FDA stands for Food and Drug Administration, a U.S. authority.
More informationDeclaration of conformity VEGABAR 82
Declaration of conformity acc. to VO (EG) 1935/2004 and VO (EU) 10/2011 as well as acc. to FDA and USP Class VI as well as ADI-free Document ID: 47480 Editing status: 2018-09-11 2 CFR FDA stands for Food
More informationProficiency Testing. Food Microbiology. October 2015
Proficiency Testing Food Microbiology October 215 Edition Version 1 (215-11-26) Editor in chief Hans Lindmark, head of Biology department, National Food Agency Responsible for the scheme Laurence Nachin,
More informationVirological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication
Virological failure to Protease inhibitors in Monotherapy is linked to the presence of signature mutations in Gag without changes in HIV-1 replication Oscar Blanch-Lombarte Rome, 7-9 June, 2017 European
More informationPRESSUREMAP DEVICE TYPES
PRESSUREMAP DEVICE TYPES INTRODUCTION This section contains tables listing the CPAMS letter coding used by PressureMAP, the PressureMAP device types, and the 289H LSS and Dial-a-Ducer transducer types.
More informationSUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation
SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.
More informationLIST OF PUBLISHED STANDARDS
Report : 08-0-0 Page o : Of 9 LST OF PUBLSHED STDRDS Total Count: 06 umber SS umber pproved mendment SBS/TC 04 SS 49:0.0 ible gelatin 0-09-6 0-09-6 06-09-6 SS 88:007.0 Commercial dextrose and liquid glucose
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationDeselection 2011 QU Biochemistry DISPLAY_CALL_NO TITLE_BRIEF PUB_DATE
DISPLAY_CALL_NO TITLE_BRIEF PUB_DATE QU 4 B347i 1970 Introduction to organic and biological chemistry 1970 QU 4 B361m 1999 Medical biochemistry / 1999 QU 4 B615a2 1981 Biochemistry : a problems approach
More informationHCV NS3 Protease Drug Resistance
test code: cpt code: 10000 87902 category: Infectious Disease HCV genotype 1a CODON Glecaprevir 1a Grazoprevir 1a Paritaprevir 1a Simeprevir 1a Voxilaprevir 1a V36A S 13 R 10 Comment V36C V36G V36I V36L
More informationThe Czech National Health Care Information System (NH-IS) and its strategy in building population-based reporting
The Czech National Health Care Information System (NH-IS) and its strategy in building population-based reporting Evropská unie Evropský sociální fond Operační program Zaměstnanost Regional reporting of
More informationCalypso Application. License for card and portable objects.
Calypso Application License for card and portable objects. I N N O V A T R O N CalypsoLicense page 1 / 6 Innovatron, 27 rue de Bassano, 75008 Paris, France 1. License Policy General Presentation Innovatron
More informationRegulation (EC) No 2073/2005. foodstuffs CA
Regulation (EC) No 2073/2005 on Microbiological criteria for foodstuffs CA 26.02.2008 Ari Hörman Microbiological criteria Main objectives To ensurea high level of human health protection Reduction of human
More informationFederation of State Boards of Physical Therapy Jurisdiction Licensure Reference Guide Topic: Retaking NPTE
The table below lists the requirements for retaking the National Physical Therapy Exam (NPTE) for each jurisdiction. Summary Number of attempts on NPTE limited? 16 27 Number of attempts allowed before
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ISO/IEC 17043:2010 Proficiency Testing Group FAPAS, FEPAS, GeMMA & LEAP Sand Hutton York North Yorkshire YO41 1LZ Contact: Judith Marshall
More informationGSJ Geochemical Reference Samples. Igneous Rock. Sedimentary Rock. For Instrumental analysis. Reference value for environmental analysis -1
GSJ Geochemical Reference Samples Igneous Rock Recommended and preferable (asterisked) values (major elements in % and minor and trace elements in ppm, unless otherwise noted) N. Imai, S. Terashima, S.
More informationFederation of State Boards of Physical Therapy Jurisdiction Licensure Reference Guide Topic: Direct Access
Each licensing authority indicates the level of direct access allowed in the jurisdiction and the type of limitations that apply to this access. There are two tables: Types and Limits Referrals TYPES AND
More informationRated 10 out of 10 by B.F What do you like about our services? the workout is always different
Testimonials: Rated 10 out of 10 by F.C. I trained with Deana for over a year. I loved how positive, upbeat, and strong she was. I learned so much and I ve never been healthier! Due to a new work schedule
More informationFOODBALT 2014 MICROBIOLOGICAL QUALITY OF MEAT PREPARATIONS AND MEAT PRODUCTS
MICROBIOLOGICAL QUALITY OF MEAT PREPARATIONS AND MEAT PRODUCTS Aija Melngaile, Elina Ciekure, Olga Valcina Institute of Food Safety, Animal Health and Environment BIOR, Lejupes Street 3, Riga, Latvia,
More informationZDBRPM HP, 1750RPM,3PH,60HZ,L3203,TEBC,FOOT
Product Information Packet ZBPM3 HP, 7PM,3PH,HZ,L33,BC,FOO Copyright ll product information within this document is subject to Baldor lectric Company copyright protection, unless otherwise noted. Product
More informationTANZANIA BUREAU OF STANDARDS
TBS/AFDC 22 (5279) P3 Dried meat Specification DRAFT TANZANIA STANDARD TANZANIA BUREAU OF STANDARDS Dried meat Specification 0 FOREWORD Dried meat is a meat product obtained through appropriate techniques
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
Schedule of ccreditation United Kingdom ccreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ccredited to The Old Mill Oxford Road Stoke-on-Trent ST6 6QP Contact: Samantha
More informationEnhanced safety in breast implants
Enhanced safety in breast implants Introduction Despite significant improvements in implant quality, rupture of breast implants is still possible If leak is suspected: Detection by palpation Experienced
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK ISO/IEC 17043:2010 Proficiency Testing Group FAPAS, FEPAS, GeMMA & LEAP Sand Hutton York North Yorkshire YO41 1LZ Contact: Judith Marshall
More informationB. Food and Animal Feed 1. Aerobic Plate Count ISO 4833: Enumeration of Spores of ISO 15213:2003 Sulphite Reducing Bacteria
AsureQuality Singapore Pte. Ltd. Certificate No. : LA-2010-0467-A 29 Tai Seng Avenue #06-07 Natural Cool Lifestyle Hub Issue No. : 13 Singapore 534119 Date : 3 July 2017 FIELD OF TESTING : Chemical and
More informationProficiency Testing. Food Microbiology. January Kirsi Mykkänen, Irina Boriak and Marianne Törnquist
Proficiency Testing Food Microbiology January 216 Kirsi Mykkänen, Irina Boriak and Marianne Törnquist Edition Version 1 (216-4-29) Editor in chief Hans Lindmark, head of Biology department, National Food
More informationFederation of State Boards of Physical Therapy Jurisdiction Licensure Reference Guide Topic: Direct Access
Each licensing authority indicates the level of direct access allowed in the jurisdiction and the type of limitations that apply to this access. There are two tables: Types and Limits Referrals TYPES AND
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Gateway House Ipswich Road Needham Market Ipswich Suffolk IP6 8EL Contact: Mr R Page Tel: +44 (0)1449 721637 Fax: +44 (0)1449 721553 E-Mail:
More informationCOSMETICS. Cosmetics & Toiletries Proficiency Testing Scheme. Scheme Description
COSMETICS Cosmetics & Toiletries Proficiency Testing Scheme Scheme Description LGC Standards Proficiency Testing 1 Chamberhall Business Park, Chamberhall Green, Bury Lancashire BL9 0AP United Kingdom Telephone:
More informationGlen Pinna General Manager, Biotech Laboratories. Session A1 Food Safety
Session A1 Food Safety Using a Biological Testing Laboratory Water and surface testing Validating the quality of water used to wash produce or incorporate into food Monitoring of food surface cleaning
More information(Communicated at the meeting of February 22, 1930.)
Physics. ~ On the structure af the spectrum af ianized Argan (Ar. ll. By T. L. DE BRUN. (Communicated by Prof. P. ZEEMAN.) (Communicated at the meeting of February 22, 1930.) 1. ntraductian. n former papers
More informationEurofins Food Testing Ireland Limited
Unit 1-3, Dungarvan Business Park, Dungarvan, Co. Waterford Testing Laboratory Registration number: 299T is accredited by the Irish National Board (INAB) to undertake testing as detailed in the Schedule
More informationHCV NS3 Protease Drug Resistance
test code: cpt code: 10000 87902 category: Infectious Disease HCV genotypes 1a CODON Simeprevir 1a Boceprevir 1a Telaprevir 1a Paritaprevir 1a Grazoprevir 1a V36A Comment R 3 R 10, 11 R 16 S 24 V36C V36G
More informationP SERIES. 250 psi NFPA Pneumatic Cylinder TECHNICAL BROCHURE. Bore Sizes from 11/2 to 14
Actuation Solutions and Systems for the P SERIES 250 psi NFPA Pneumatic Cylinder Bore Sizes from 11/2 to 14 Actuation Solutions and Systems for the Design & Materials Temperature Ratings Low Temp. -54
More information(43) International Publication Date. 15 July 2010 ( ) WO 2010/ A3. (19) World Intellectual Property Organization International Bureau
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date (10) International
More informationAlpha Analytical Services Ltd
Cappagh Cross, Fermoy, Co. Cork Testing Laboratory Registration number: 237T is accredited by the Irish National Board (INAB) to undertake testing as detailed in the Schedule bearing the Registration Number
More information(Press Release) The Results of Radioactive Material Monitoring of the Surface Water Bodies within Ibaraki Prefecture
(P l) h l f dc Ml M f h fc W Bd h Ib Pfc Fd, Dcb 2, 2011 W E D, E M B, M f h E Dc l: 03-5521-8316 chbd: 03-3581-3351 Dc: b Yhd (x. 6610) Dp Dc: F (x. 6614) Cd: H H (x. 6628) I ccdc h h Cph d M Pl dd b
More informationProduct Information Packet ZDBRPM HP, 1750RPM,3PH,60HZ,L3213,TEBC,FOOT
Product Information Packet ZBPM HP, 7PM,PH,HZ,L,BC,FOO Copyright ll product information within this document is subject to BB Motors and Mechanical Inc. copyright protection, unless otherwise noted. Product
More informationGuidance on the safety and shelf-life of vacuum and modified atmosphere packed chilled foods. January 2004 (DRAFT)
Guidance on the safety and shelf-life of vacuum and modified atmosphere packed chilled foods January 2004 (DRAFT) Introduction This document provides advice on vacuum and modified atmosphere packaged (VP/MAP)
More informationAccredited Proficiency Testing Provider
Accredited Proficiency Testing Provider A2LA has accredited QUALITY ASSURANCE AND TESTING CENTER 3 (QUATEST 3) Dong Nai Province, VIETNAM This accreditation covers the specific proficiency testing schemes
More informationProduct Information Packet IDBRPM HP 1750 TEBC FL V
Product Information Packet IBPM7 7 HP 7 BC FL V Copyright ll product information within this document is subject to BB Motors and Mechanical Inc. copyright protection, unless otherwise noted. Product Information
More informationP G K R P E W M G W L K P R G G A V N Y A R P L Q G R V T M T R D V Y S D T A F
Supplementary Figure 1 VRC01 45-08-110497H 45-08-212510H 45-08-511533H 45-08-541880H Q V Q L V Q S G G Q M K K P G E S M R I S C R A S G Y E F I D C T L N W I R L A CAGGTGCAGCTGGTGCAGTCTGGGGGTCAGATGAAGAAGCCTGGCGAGTCGATGAGAATTTCTTGTCGGGCTTCTGGATATGAATTTATTGATTGTACGCTAAATTGGATTCGTCTGGCC
More informationttabl National Accreditation Board for Testing and Calibration Laboratories Department of Science &Technology, India CERI'IFICATE OF ACCREDITATION.
ttabl National Accreditation Board for Testing and Calibration Laboratories Department of Science &Technology, India CERI'IFICATE OF ACCREDITATION. CENTRE FOR ANALYSIS AND LEARNING IN LIVESTOCK AND.FOOD
More informationSupplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP
Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP Frequency Domain Mammals a 3 S/P b Mammals a 3 S/P b
More informationALLTRADE FORKLIFT PARTS PTE LTD
ATTENTION PAGE : 1 (HALLA) FAC0300060 FAC0300080 FAC0311070 FAC0311240 FAD0300600 OK675-15-010 OK675-15-082 OS211-15-173 OS213-15-172 QK0905-15 (HANGCA) 053022 053023 198911A 36010-L9000-G00 40DH-512000
More informationProduct Information Packet ZDFRPM21254C 25HP, 1750RPM,3PH,60HZ,2162C,TEFC,FOOT
Product Information Packet ZFPMC HP, 7PM,PH,HZ,C,FC,FOO Copyright ll product information within this document is subject to BB Motors and Mechanical Inc. copyright protection, unless otherwise noted. Product
More informationSCOPE OF ACCREDITATION TO ISO/IEC 17043:2010
SCOPE OF ACCREDITATION TO ISO/IEC 17043:2010 QUALITY ASSURANCE AND TESTING CENTER 3 (QUATEST 3) Head Office: 49 Pasteur, District 1, Nguyen Thai Binh Ward, Ho Chi Minh City, Vietnam Truong Thanh Son, Acting
More informationTANZANIA BUREAU OF STANDARDS
TBS/AFDC 14 (5259) P3 Ghee Specification DRAFT TANZANIA STANDARD TANZANIA BUREAU OF STANDARDS Ghee Specification 0 FOREWORD Ghee is a milk product obtained from butter or cream. In Tanzania manufacture
More informationVARIATION IN MEASUREMENT OF HIV RNA VIRAL LOAD
VARIATION IN MEASUREMENT OF HIV RNA VIRAL LOAD SOURCES OF VARIATION (RANDOM VS SYSTEMATIC) MAGNITUDE OF EACH SOURCE CONSEQUENCES FOR CONFIDENCE LIMITS AROUND MEASUREMENTS AND CHANGES DATA FROM ROCHE HIV
More informationWO 2014/ A3 P O P C T. 6 February 2014 ( )
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International
More informationDRAFT UGANDA STANDARD
DRAFT UGANDA STANDARD DUS 1801 First Edition 2017-mm-dd Dried Fish Maws Specification Reference number DUS 1801:2017 UNBS 2017 DUS 1801: 2017 Compliance with this standard does not, of itself confer immunity
More informationCADWELD TO THERMOWELD CROSS REFERENCE FOR CATHODIC PROTECTION
ECN 2215 REV "B" 05/08 THE ULTIMATE CONNECTION A DIVISION OF CONTINENTAL INDUSTRIES TO THERMOWELD CROSS REFERENCE FOR CATHODIC PROTECTION 4102 SOUTH 74TH EAST AVENUE / P.O. BOX 994 TULSA, OKLAHOMA 74101
More informationSCOPE OF ACCREDITATION
Standards Council of Canada 600-55 Metcalfe Street Ottawa, ON K1P 6L5 Canada Conseil canadien des normes 55, rue Metcalfe, bureau 600 Ottawa, ON K1P 6L5 Canada SCOPE OF ACCREDITATION Canadian Food Inspection
More informationBacillus subtilis GR-101 Aspergillus oryzae GB-107
EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Reference Materials and Measurements Community Reference Laboratory for Feed Additives JRC.DDG.D.6/CvH/DM/hn/ARES (2010) 212880 CRL Evaluation Report
More informationFederation of State Boards of Physical Therapy Jurisdiction Licensure Reference Guide Topic: Direct Access
Each licensing authority indicates the level of direct access allowed in the jurisdiction and the type of limitations that apply to this access. There are three tables: Types and Limits Specific Limits
More informationFluid and Semen. S. H. Ying, M.D., E. Day, M.D., W. F. Whitmore, Jr., M.D., and H. J. Tagnon, M.D.*
Fibrinolytic Activity in Human Prostatic Fluid and Semen S. H. Ying, M.D., E. Day, M.D., W. F. Whitmore, Jr., M.D., and H. J. Tagnon, M.D.* IT HAS BEEN KNOWN since the work of Huggins and Neall that human
More informationBETWEEN. The lnquiries, Complaints and Reports Committee of the College of. -and-
CPO File No. 2015-0099/2016-0120 DISCIPLINE COMMITTEE OF THE COLLEGE OF PHYSIOTHERAPISTS OF ONTARIO BETWEEN COLLEGE OF PHYSIOTHERAPISTS OF ONTARIO -and- MOHANNAD BAKRI, Registration Number 12180 NOT CE
More information!"#$%&" '($&)*+,"-.(/%*+,"
!"#$%&" '($&)*+,"-.(/%*+," 01%/2),3"4).5"61%7$28"6%9)$5"%$"#/2++7! The Healthy Schools Partnership: Innovative Energy Balance Programming with RD Nutrition Coaches :%871"6%815;"
More informationFood Division Chain of Custody LA Testing Order Number (Lab Use Only):
LA Testing Order Number (Lab Use Only): Report To Contact Name: Email Results To: Company Name: Project Name: PO #: Street: Turnaround Time (TAT) Options* - Please check one City: State: Zip/Postal Code:
More informationUSA National Mental Healthcare Nonprofit Exempt Organization Financial Analysis as of December 14, 2015 January 24, 2016 ANSA-H2
USA National Mental Healthcare Nonprofit Exempt Organization Financial Analysis as of December 14, 2015 January 24, 2016 ANSA-H2 Prepared by David Yoo, HanaSoul Consulting, Omaha, Nebraska dcyoo@cox.net
More informationRecent Minima of 161 Eclipsing Binary Stars
Samolyk, JAAVSO Volume 38, 2010 85 Recent Minima of 161 Eclipsing Binary Stars Gerard Samolyk P.O. Box 20677; Greenfield, WI 53220; gsamolyk@wi.rr.com Received September 23, 2009; accepted September 25,
More informationCPTR title slide. A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance
CPTR title slide A Standardized System for Grading Mutations in Mycobacterium tuberculosis for Association with Drug Resistance PAOLO MIOTTO CPTR 2017 Workshop, March 20 23 The Need A lack of user-friendly
More informationHistory (August 2010) Therapy for Experienced Patients. History (September 2010) History (November 2010) 12/2/11
(August 2010) Therapy for Experienced Patients Hiroyu Hatano, MD, MHS Assistant Professor of Medicine University of California San Francisco Medical Management of AIDS December 2011 42M HIV (CD4=450, VL=6250,
More informationHow sarcoma/gist research & expert care are organized in Italy
How sarcoma/gist research & expert care are organized in Italy Organization of care Historical migration for medical care PR VA LC VI TV BG LU GR PG CN AL MI Desi o LO PV Alzano Lombardo CO Casalpusterlen
More informationNEW DEVELOPMENTS IN CATALYSIS
You are now at www.wernerblank.com HOME NEWS PUBLICATIONS LECTURES PATENTS DOWNLOADS NEW DEVELOPMENTS IN CATALYSIS Werner J. Blank King Industries Inc. Science Road Norwalk, CT 06952 USA wblank@kingindustries.com
More informationWorkforce Data The American Board of Pediatrics
Workforce Data 2009-2010 The American Board of Pediatrics Caution. Before using this report as a resource, please read the information below! Please use caution when comparing data in this version of the
More informationGeoPT28 AN INTERNATIONAL PROFICIENCY TEST FOR ANALYTICAL GEOCHEMISTRY LABORATORIES REPORT ON ROUND 28 (Shale, SBC-1) / January 2011
GeoPT28 AN INTERNATIONAL PROFICIENCY TEST FOR ANALYTICAL GEOCHEMISTRY LABORATORIES REPORT ON ROUND 28 (Shale, SBC-1) / January 2011 Peter C. Webb 1 *, Michael Thompson 2, Philip J. Potts 1 and Stephen
More informationThis annex is valid from: to Replaces annex dated: Location(s) where activities are performed under accreditation
Eurins K.B.B.L. B.V. Location(s) where activities are performed under accreditation ead Office Industrieweg 16 8131V ijhe Location Abbreviation/ location code ead fice Industrieweg 16 8131V ijhe Boseind
More informationMicrobial Evaluation of Cooked Foods Served in the Central Restaurant of Tehran University of Medical Sciences in Winter and Summer 2015
Iranian Journal of Health, Safety & Environment, Vol.3 No.4, pp. 62-625 Microbial Evaluation of Cooked Foods Served in the Central Restaurant of Tehran University of Medical Sciences in Winter and Summer
More informationKENYA STANDARD KS 1284: 2018 ICS Substitute vinegar Specification
KENYA STANDARD KS 1284: 2018 ICS 67.220.20 Substitute vinegar Specification KEBS 2018 Fourth Edition 2018 KS 1284: 2018 TECHNICAL COMMITTEE REPRESENTATION The following organizations were represented on
More informationDownloaded from journal.bums.ac.ir at 13:12 IRST on Monday March 11th 2019
187 " 15 Downloaded from journal.bums.ac.ir at 1:12 IRST on Monday March 11th 2019 2 1! "# - -.'!" #$ %& 9 %.. / 01$ 2 4& 5'6 78. - ) *+ %!,+ 9 9 26 >.+
More informationQDCS. Scheme Description. Quality in Dairy Chemistry Scheme
QDCS Quality in Dairy Chemistry Scheme Scheme Description LGC Standards Proficiency Testing 1 Chamberhall Business Park Chamberhall Green Bury Lancashire BL9 0AP United Kingdom Telephone: +44 (0) 161 762
More informationProficiency Testing. Food Microbiology. April Jonas Ilbäck
Proficiency Testing Food Microbiology April 218 Jonas Ilbäck Edition Version 1 (218-6-15) Editor in chief Hans Lindmark, head of Biology department, National Food Agency Responsible for the scheme Jonas
More informationASSESSMENT OF QOL IN PATIENTS WITH PRADER WILLY SYNDROME
ASSESSMENT OF QOL IN PATIENTS WITH PRADER WILLY SYNDROME Aiming at investigating the relationship between QoL and clinical picture in patients with PWS, we conducted a multicentric study with prospective
More information