Supplementary Table 1. Binding and Activity of BIM and related melanocortin receptor agonists. hmc5r Ki(nM) hmc1r EC 50 (nm)
|
|
- Molly White
- 5 years ago
- Views:
Transcription
1 BIM does not alter animal behaviour Activation of the melanocortin pathways has been associated with several non-feeding related activities. Increased yawning, muscular stiffness, stretching and penile erection have all been described as consequences of activation of the melanocortin pathways (32; 40-42). Observation of the animals before, during and after the administration of BIM verified that we did not see these side effects in our animals. The lack of muscular stiffness can also be observed by the increase in activity during the treatment period. Adverse effects that could result in confounding factors in regards to food intake are headaches, asthenia, nausea, vomiting and diarrhea, as mentioned in clinical studies with another MC4R agonist (32). Cages were inspected daily for vomiting and diarrhea, both of which were never observed. At all times, the monkeys were eager to accept a small peanut butter treat in the afternoon. From personal observations the peanut butter treat will be rejected when the animal has nausea, for instance when induced by GLP-1 administration (data not shown). Further, studies in beagles also failed to demonstrate an increase in nausea (personal communication with M Culler). In contrast, LY caused gapping, a sign of nausea in 2 animals. This is consistent with the findings of the clinical study with LY (32). Finally, food intake did return to normal levels during the course of drug tre ment in the current experiment. Supplementary Table 1. Binding and Activity of BIM and related melanocortin receptor agonists Binding Activity Compound hmc1r hmc3r hmc4r hmc5r hmc1r hmc3r hmc4r hmc5r BIM LY MT-II NDP- -MSH MSH MSH MSH MSH MSH Supplementary Table 2. Serum chemistry during and after treatment with BIM (0.5 mg/kg/day) Measured Variable Average Value on Drug Average Value off Drug Units Alanine Transaminase 58 ± 8 81 ± 14 Iu/L (ALT) Blood Urea Nitrogen (BUN) 11 ± ± 1 mg/dl Creatinine 1.1 ± ± 0.03 mg/dl tbilirubin 0.3 ± ± 0.03 mg/dl Albumin 3 ± ± 0.04 g/dl Creatinine Kinase 1750 ± ± 240 Iu/L
2 Supplementary Figure 1. Overview of the experimental outline with timeframes. Arrows indicate minipumps implantations, exchanges or removals. Stars denote timepoints during which the DEXA scanning and the intravenous GTT were performed.
3 Supplementary Figure 2. Food intake is decreased in lean NHP treated with BIM A) Daily food intake measured during exposure of the animals (n=6) to a minipump filled with saline (weeks 1, 3, 5 and 7) or increasing doses of BIM (weeks 2, 4 and 6). B) Food intake was calculated as a daily average over 5 days during the minipump implantations. Data was analyzed as a repeated measures ANOVA (p<0.0001) with Bonferroni post hoc testing. Each dose was significantly decreased compared to weeks 3 and 5 (p<0.05 for 0.17 dose, p<0.001 for 0.5 and 1.5 mg/kg/day dose). None of the doses were significantly different from each other. Supplementary Figure 3. Individual body weight graphs for all 12 animals treated with BIM (0.5 mg/kg/day).
4 Supplementary Figure 4. Food Intake (A) and Body Weight (B) during the treatment period (0.5 mg/kg/day) and an extended washout period. An ivgtt test was performed 12 weeks after washout where we calculated HOMA-IR (C) and the total insulin secretion during the glucose bolus (D). All data was analysed using ANOVA with repeated measures and Dunnett s posthoc test; p<0.05 was considered significant.
5 Supplementary Figure 5. Changes in food intake (A), body weight (B), insulin sensitivity (C) and cardiovascular parameters (D+E) during an 8 week treatment with 0.17 mg/kg/day subcutaneously of BIM
6 Supplementary Figure 6. Representative plots of 4 animals treated with 0.5 mg/kg/day of BIM or LY All changes in systolic blood pressure and heart rate are represented as changes compared to the vehicle period preceding the compound. Both vehicle and compound were delivered via osmotic minipump as described in the materials and method section. One animal is not reported as we noticed an increase of 50mm Hg two hours post-implantation of the 0.17 mg/kg/day dose. This animal was removed from the 0.5 mg/kg/day LY experiment. However, no increases were noted when this animal was given 0.5 mg/kg/day of BIM
Understanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationSITA 100 mg (n = 378)
Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)
More informationSupplementary Online Content
Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationa Supplementary Figure 1 Celastrol Withaferin A Individual drugs
Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
More informationChemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationSponsor / Company: Sanofi Drug substance(s): Insulin Glargine (HOE901) Insulin Glulisine (HMR1964)
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company: Sanofi Drug substance(s):
More informationSupplementary Online Content
Supplementary Online Content Engebretson SP, Hyman LG, Michalowicz BS, et al. The effect of nonsurgical periodontal therapy on hemoglobin A1c levels among persons with type 2 diabetes and chronic periodontitis:
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationDiabetic Ketoacidosis
6/9/2018 Management of Diabetic Ketoacidosis STAT 183 Individual Project Prepared for: Dr. Karen Huaying Xu Prepared by: Albert Sosa UNIVERSITY OF CALIFORNIA, RIVERSIDE Table of Contents I Introduction
More informationClinical Trial Synopsis
Clinical Trial Synopsis Title of Study: A Phase III, Open-Label, Fixed-Dose Study to Determine the Safety of Long-Term Administration of TAK-375 in Subjects With Chronic Insomnia Protocol Number: Name
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationA Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation
Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationDiabetic Ketoacidosis
Diabetic Ketoacidosis Definition: Diabetic Ketoacidosis is one of the most serious acute complications of diabetes. It s more common in young patients with type 1 diabetes mellitus. It s usually characterized
More informationVICTOSA and Renal impairment DR.R.S.SAJAD
VICTOSA and Renal impairment DR.R.S.SAJAD February 2019 Main effect of GLP-1 is : Stimulating glucose dependent insulin release from the pancreatic islets. Slow gastric emptying Inhibit inappropriate
More informationFLUIDS/ELECTROLYTES. Sahir Kalim, MD MMSc. Department of Medicine, Division of Nephrology, Massachusetts General Hospital Harvard Medical School
FLUIDS/ELECTROLYTES Sahir Kalim, MD MMSc Department of Medicine, Division of Nephrology, Massachusetts General Hospital Harvard Medical School Dr. Kalim has no potential conflicts of interest to disclose.
More informationSupplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
More informationDocumentation Dissection
History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationDEFINITIONS FOR FLUID STATUS & TARGET WEIGHT
Home Dialysis Interest Group HEALTHCARE TEAM TOOL DEFINITIONS FOR STATUS & TARGET WEIGHT BALANCED EXCESS DEFICIT Illustrations provided by: 1 BALANCE OF THE HOME HEMODIALYSIS PATIENT Dialysis Weight**
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More informationDelacroix et al Renal effects of renal denervation Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate
Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate Supplementary Table 1: Ranking each patient based on the number of measurements showing a numerical improvement. Rank at each
More informationPatient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith
Patient Chart #203 Becky Smith 1 Property of CSCLV CSCLV Rev: 06/04/2018 Chief Complaint: Abdominal pain. Informant: Parents. HISTORY & PHYSICAL HPI: Ill looking patient, healthy until 2 days ago when
More informationDIABETIC KETOACIDOSIS (DKA) K E M I A D E Y E R I, P G Y - 1
DIABETIC KETOACIDOSIS (DKA) K E M I A D E Y E R I, P G Y - 1 QUESTION # 1 7 year old boy comes to the ER with a 2 week history of abdominal pain and weight loss. Further history reveals polyuria and polydipsia,
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Solomon SD, Uno H, Lewis EF, et al. Erythropoietic response
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationDr. Dafalla Ahmed Babiker Jazan University
Dr. Dafalla Ahmed Babiker Jazan University objectives Overview Definition of dehydration Causes of dehydration Types of dehydration Diagnosis, signs and symptoms Management of dehydration Complications
More informationSYNOPSIS. Administration: subcutaneous injection Batch number(s):
SYNOPSIS Title of the study: A randomized, double-blind, placebo-controlled, 2-arm parallel-group, multicenter 24-week study followed by an extension assessing the efficacy and safety of AVE0010 on top
More informationSupplementary Online Content
Supplementary Online Content Dhabangi A, Ainomugisha B, Cserti-Gazdewich C, et al. Effect of transfusion of red blood cells with longer vs shorter storage duration on elevated blood lactate levels in children
More informationCASE-BASED SMALL GROUP DISCUSSION MHD II
MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby
More informationTABLE OF CONTENTS GENERAL INFORMATION... 1
BIOO RESEARCH PRODUCTS Glucose Assay Kit Manual Catalog #: 5611-01 BIOO Scientific Corp. 2011 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 1 Required Materials
More informationBIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L
Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationRenal Function and Associated Laboratory Tests
Renal Function and Associated Laboratory Tests Contents Glomerular Filtration Rate (GFR)... 2 Cockroft-Gault Calculation of Creatinine Clearance... 3 Blood Urea Nitrogen (BUN) to Serum Creatinine (SCr)
More informationPHENTOLAMINE MESYLATE INJECTION SANDOZ STANDARD 5 mg/ ml THERAPEUTIC CLASSIFICATION Alpha-adrenoreceptor Blocker
PACKAGE INSERT Pr PHENTOLAMINE MESYLATE INJECTION SANDOZ STANDARD 5 mg/ ml THERAPEUTIC CLASSIFICATION Alpha-adrenoreceptor Blocker ACTIONS AND CLINICAL PHARMACOLOGY Phentolamine produces an alpha-adrenergic
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationKeeping track of your numbers
Keeping track of your numbers If you have relapsed or refractory multiple myeloma, keeping track of your numbers can help you take an active role in your care. It s also one way you and your doctor can
More informationCORE CLINICAL DATASET
The following pages are the CORE CLINICAL DATASET for Ebolavirus disease. The forms are featured in order of priority. Therefore, when resources are limited, data collection can be reduced as required
More informationINSTRUCTIONS: 1. Use codetable on page 1 for modifications / termination reasons
Radiation Therapy Oncology Group Phase III Head & Neck Cancer Treatment Summary Form AMENDED DATA YES INSTRUCTIONS: 1 Use codetable on page 1 for modifications / termination reasons SUMMARY OF SYSTEMIC
More information1 Acute Lymphoblastic Leukaemia
1 Acute Lymphoblastic Leukaemia 1.05 Intensification - Philadelphia Negative Patients Indication ALL Philadelphia negative patients Pre-treatment Evaluation The intensification module begins two weeks
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationNewer and Expensive treatment of diabetes. Endocrinology Visiting Associate Professor Institute of Medicine TUTH
Newer and Expensive treatment of diabetes Jyoti Bhattarai MD Endocrinology Visiting Associate Professor Institute of Medicine TUTH Four out of every five people with diabetes now live in developing countries.
More information23-Aug-2011 Lixisenatide (AVE0010) - EFC6014 Version number: 1 (electronic 1.0)
SYNOPSIS Title of the study: A randomized, double-blind, placebo-controlled, parallel-group, multicenter 24-week study followed by an extension assessing the efficacy and safety of AVE0010 on top of metformin
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationClinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine
Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA
More informationDoes Bicarbonate Concentration Predict Hospitalization among Children with Gastroenteritis?
Does Bicarbonate Concentration Predict Hospitalization among Children with Gastroenteritis? Muin Habashneh MD*, Mohammad Alrwalah MD* ABSTRACT Objective: To determine the relationship between bicarbonate
More informationSupplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of
Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of phosphatidylserine and phosphatidylcholine. The instrinsic
More informationStudent Note Outline: Introduction to Specialty Feeds
Student Note Outline: Introduction to Specialty Feeds Protein Supplements More than 20% protein Animal Protein Supplements inedible tissues from meat packing Surplus milk products marine sources feather
More informationSupplementary Online Content
Supplementary Online Content Geller AI, Shehab N, Lovegrove MC, et al. National estimates of insulin-related hypoglycemia and errors leading to emergency department visits and hospitalizations. JAMA Internal
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationAdlyxin. (lixisenatide) New Product Slideshow
Adlyxin (lixisenatide) New Product Slideshow Introduction Brand name: Adlyxin Generic name: Lixisenatide Pharmacological class: Glucagon-like peptide-1 (GLP-1) receptor agonist Strength and Formulation:
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationRini Purwanti Sekretaris PD IPDI Jatim
Kidney Emergency Rini Purwanti Sekretaris PD IPDI Jatim overview The kidneys are a pair of small ( about the size of your fist-sized ), bean shaped organs that lie on either side of your spine, located
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationSupplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan
More informationNon-insulin treatment in Type 1 DM Sang Yong Kim
Non-insulin treatment in Type 1 DM Sang Yong Kim Chosun University Hospital Conflict of interest disclosure None Committee of Scientific Affairs Committee of Scientific Affairs Insulin therapy is the mainstay
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationErtugliflozin (Steglatro ) 5 mg daily. May increase to 15 mg daily. Take in the morning +/- food. < 60: Do not initiate; discontinue therapy
Sodium-glucose Cotransporter-2 (SGLT2) s Inhibit SGLT in proximal renal tubules, reducing reabsorption of filtered glucose from tubular lumen Lowers renal threshold for glucose à increase urinary excretion
More informationReport Reference Guide. THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1
Report Reference Guide THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1 How to use this guide Each type of CareLink report and its components are described in the following sections.
More informationAssessment of "Average of Normals" Quality Control Procedures and Guidelines for Implementation
Assessment of "Average of Normals" Quality Control Procedures and Guidelines for Implementation GEORGE S. CEMBROWSKI, M.D., PH.D., ELLIOT P. CHANDLER, M.D., AND JAMES O. WESTGARD, PH.D. The capabilities
More informationGeneral Chemistry Scheme Guide
General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....
More informationHematologic and Chemical Changes Observed during and after Cardiac Arrest in a Canine Model A Pilot Study
Hematologic and Chemical Changes Observed during and after Cardiac Arrest in a Canine Model A Pilot Study Barry E. Bleske, Pharm.D., Jessica Song, Pharm.D., Moses S. S. Chow, Pharm.D., Jeffrey Kluger,
More informationSummary ID# Clinical Study Summary: Study B4Z-JE-LYBD
CT Registry ID#5286 Page 1 Summary ID# 5286 Clinical Study Summary: Study B4Z-JE-LYBD An Open Label, Dose-Titration Safety Study of Hydrochloride in Outpatient Japanese Children with Attention-Deficit/Hyperactivity
More informationGLUCOSE MONITORING. How. When
GLUCOSE MONITORING Why Self-monitoring of blood glucose is the best way to see how your body handles food, activity, diabetes medication (pills and/or insulin), stress and illness. You can also see what
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationPractical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010
Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE Robert R. Henry, MD Authors and Disclosures CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Introduction Type 2 diabetes
More informationTable S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group
Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,
More informationComparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
More informationForm 8: Post Transplant Annual Followup
Page 1 of 7 Show trials/registries Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Print this Form t Started 1
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationMacaque Food and Water Restriction Policy Adopted by UCAR 11/20/13
Macaque Food and Water Restriction Policy Adopted by UCAR 11/20/13 The Animal Welfare Act requires that primates be given access to food at least once per day and to water no less than twice daily for
More informationLNA-mediated silencing of microrna-122 in African green monkeys
LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured
More informationSHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH
IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity
More informationWhat is meant by Thrombotic Microangiopathy (TMA)?
What is meant by Thrombotic Microangiopathy (TMA)? Thrombotic Microangiopathy (TMA) is a group of disorders characterized by injured endothelial cells, microangiopathic hemolytic anemia (MAHA), with its
More informationReport Reference Guide
Report Reference Guide How to use this guide Each type of CareLink report and its components are described in the following sections. Report data used to generate the sample reports was from sample patient
More informationBIOO LIFE SCIENCE PRODUCTS
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
More information(For National Authority Use Only) Name of Study Drug: to Part of Dossier:
2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115
More informationCommittee for Risk Assessment RAC. Opinion. on the specific target organ toxicity of 2-benzotriazol-2-yl-4,6-di-tert-butylphenol (UV- 320)
Committee for Risk Assessment RAC Opinion on the specific target organ toxicity of 2-benzotriazol-2-yl-4,6-di-tert-butylphenol (UV- 320) EC number: 223-346-6 CAS number: 3846-71-7 and 2-(2H-benzotriazol-2-yl)-4,6-ditertpentylphenol
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationRadiographic Procedures III (RAD 228)
Radiographic Procedures III (RAD 228) Urinary System RADIOGRAPHIC EXAMINATIONS Urinary System Antegrade Exam IVU Functional test Hypertensive evaluation as per protocol Retrograde Exams Retrograde Urography
More informationAbnormal Liver Chemistries. Lauren Myers, MMsc. PA-C Oregon Health and Science University
Abnormal Liver Chemistries Lauren Myers, MMsc. PA-C Oregon Health and Science University Disclosure 1. The speaker/planner Lauren Myers, MMSc, PA-C have no relevant financial relationships to disclose
More informationForm 8: Post Transplant Annual Followup
Page 1 of 8 Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Toggle Question Year/Info Print this Form t Started
More informationRN Diabetes Medication Titration Protocol
Metformin (Glucophage) Biguanide Medication titration: Time 0 APC or MD Start Metformin 500mg (500mg in the morning, taken with food) Week 1 Week 2 Metformin 1000mg (500mg in the morning and 500mg in the
More informationGENERAL. Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry)
GENERAL Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry) ESSAY ANSWER QUESTIONS 2 Questions - each question is worth 35 marks.all questions should be attempted Question
More informationCRRT Fundamentals Pre-Test. AKI & CRRT 2017 Practice Based Learning in CRRT
CRRT Fundamentals Pre-Test AKI & CRRT 2017 Practice Based Learning in CRRT Question 1 A 72-year-old man with HTN presents to the ED with slurred speech, headache and weakness after falling at home. He
More informationVITROS MicroSlide Assay Summary
ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationCase TWO. Vital Signs: Temperature 36.6degC BP 137/89 HR 110 SpO2 97% on Room Air
Mr N is a 64year old Chinese gentleman who is a heavy drinker, still actively drinking, and chronic smoker of >40pack year history. He has a past medical history significant for Hypertension, Hyperlipidemia,
More informationDiabetes: Inpatient Glucose control
Diabetes: Inpatient Glucose control Leanne Current, PharmD, BCPS This activity is funded through the Medicaid section 1115(a) Demonstration Texas Healthcare Transformation and Quality Improvement Program
More informationDisclaimer. Chapter 3 Disorder of Water, Electrolyte and Acid-base Professor A. S. Alhomida. Disorder of Water and Electrolyte
Disclaimer King Saud University College of Science Department of Biochemistry The texts, tables, figures and images contained in this course presentation (BCH 376) are not my own, they can be found on:
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationMy Transplant Log. Patient Education. After a kidney/pancreas transplant. Vital Signs
Patient Education Page 20-1 My Transplant Log After a kidney/pancreas transplant This section of the Guide to Your Kidney/Pancreas Transplant explains the tests you will have after your transplant. It
More informationEffects of Dietary Zinc and Endotoxin Challenge on Immune Function in Weanling Pigs
2000 Animal Science Research Report Pages 154-159 Effects of Dietary Zinc and Endotoxin Challenge on Immune Function in Weanling Pigs S. Mandali, M.Rincker, S.D. Carter, A.B. Arquitt, E. Droke, B.J.Stoecker
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationStudy No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:
The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.
More information