Supplementary Table 1. Binding and Activity of BIM and related melanocortin receptor agonists. hmc5r Ki(nM) hmc1r EC 50 (nm)

Size: px
Start display at page:

Download "Supplementary Table 1. Binding and Activity of BIM and related melanocortin receptor agonists. hmc5r Ki(nM) hmc1r EC 50 (nm)"

Transcription

1 BIM does not alter animal behaviour Activation of the melanocortin pathways has been associated with several non-feeding related activities. Increased yawning, muscular stiffness, stretching and penile erection have all been described as consequences of activation of the melanocortin pathways (32; 40-42). Observation of the animals before, during and after the administration of BIM verified that we did not see these side effects in our animals. The lack of muscular stiffness can also be observed by the increase in activity during the treatment period. Adverse effects that could result in confounding factors in regards to food intake are headaches, asthenia, nausea, vomiting and diarrhea, as mentioned in clinical studies with another MC4R agonist (32). Cages were inspected daily for vomiting and diarrhea, both of which were never observed. At all times, the monkeys were eager to accept a small peanut butter treat in the afternoon. From personal observations the peanut butter treat will be rejected when the animal has nausea, for instance when induced by GLP-1 administration (data not shown). Further, studies in beagles also failed to demonstrate an increase in nausea (personal communication with M Culler). In contrast, LY caused gapping, a sign of nausea in 2 animals. This is consistent with the findings of the clinical study with LY (32). Finally, food intake did return to normal levels during the course of drug tre ment in the current experiment. Supplementary Table 1. Binding and Activity of BIM and related melanocortin receptor agonists Binding Activity Compound hmc1r hmc3r hmc4r hmc5r hmc1r hmc3r hmc4r hmc5r BIM LY MT-II NDP- -MSH MSH MSH MSH MSH MSH Supplementary Table 2. Serum chemistry during and after treatment with BIM (0.5 mg/kg/day) Measured Variable Average Value on Drug Average Value off Drug Units Alanine Transaminase 58 ± 8 81 ± 14 Iu/L (ALT) Blood Urea Nitrogen (BUN) 11 ± ± 1 mg/dl Creatinine 1.1 ± ± 0.03 mg/dl tbilirubin 0.3 ± ± 0.03 mg/dl Albumin 3 ± ± 0.04 g/dl Creatinine Kinase 1750 ± ± 240 Iu/L

2 Supplementary Figure 1. Overview of the experimental outline with timeframes. Arrows indicate minipumps implantations, exchanges or removals. Stars denote timepoints during which the DEXA scanning and the intravenous GTT were performed.

3 Supplementary Figure 2. Food intake is decreased in lean NHP treated with BIM A) Daily food intake measured during exposure of the animals (n=6) to a minipump filled with saline (weeks 1, 3, 5 and 7) or increasing doses of BIM (weeks 2, 4 and 6). B) Food intake was calculated as a daily average over 5 days during the minipump implantations. Data was analyzed as a repeated measures ANOVA (p<0.0001) with Bonferroni post hoc testing. Each dose was significantly decreased compared to weeks 3 and 5 (p<0.05 for 0.17 dose, p<0.001 for 0.5 and 1.5 mg/kg/day dose). None of the doses were significantly different from each other. Supplementary Figure 3. Individual body weight graphs for all 12 animals treated with BIM (0.5 mg/kg/day).

4 Supplementary Figure 4. Food Intake (A) and Body Weight (B) during the treatment period (0.5 mg/kg/day) and an extended washout period. An ivgtt test was performed 12 weeks after washout where we calculated HOMA-IR (C) and the total insulin secretion during the glucose bolus (D). All data was analysed using ANOVA with repeated measures and Dunnett s posthoc test; p<0.05 was considered significant.

5 Supplementary Figure 5. Changes in food intake (A), body weight (B), insulin sensitivity (C) and cardiovascular parameters (D+E) during an 8 week treatment with 0.17 mg/kg/day subcutaneously of BIM

6 Supplementary Figure 6. Representative plots of 4 animals treated with 0.5 mg/kg/day of BIM or LY All changes in systolic blood pressure and heart rate are represented as changes compared to the vehicle period preceding the compound. Both vehicle and compound were delivered via osmotic minipump as described in the materials and method section. One animal is not reported as we noticed an increase of 50mm Hg two hours post-implantation of the 0.17 mg/kg/day dose. This animal was removed from the 0.5 mg/kg/day LY experiment. However, no increases were noted when this animal was given 0.5 mg/kg/day of BIM

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

SITA 100 mg (n = 378)

SITA 100 mg (n = 378) Supplementary Table 1. Summary of Sulfonylurea Background Therapy at Baseline and During the Treatment Period. Sulfonylurea at baseline, n (%) SITA 100 mg (n = 378) CANA 300 mg (n = 377) Total (N = 755)

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Larsen JR, Vedtofte L, Jakobsen MSL, et al. Effect of liraglutide treatment on prediabetes and overweight or obesity in clozapine- or olanzapine-treated patients with schizophrenia

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs

a Supplementary Figure 1 Celastrol Withaferin A Individual drugs Supplementary Figure 1 a 17 27 HSPA1A SLC7A11 HMOX1 GSTA1 DUSP4 GML CHAC1 CDKN1A GSTA4 CA6 BHLHE41 NR1D1 HSPB1 PTX3 HP NFKBIA VDR MVD HAS2 ANGPT1 WDR6 TGFB3 IDI1 VCAM1 H1F HMGCS1 CXCL5 STEAP4 NOS2 b Enrichment

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.

Supplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody. ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *

More information

Sponsor / Company: Sanofi Drug substance(s): Insulin Glargine (HOE901) Insulin Glulisine (HMR1964)

Sponsor / Company: Sanofi Drug substance(s): Insulin Glargine (HOE901) Insulin Glulisine (HMR1964) These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription. Sponsor / Company: Sanofi Drug substance(s):

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Engebretson SP, Hyman LG, Michalowicz BS, et al. The effect of nonsurgical periodontal therapy on hemoglobin A1c levels among persons with type 2 diabetes and chronic periodontitis:

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Diabetic Ketoacidosis

Diabetic Ketoacidosis 6/9/2018 Management of Diabetic Ketoacidosis STAT 183 Individual Project Prepared for: Dr. Karen Huaying Xu Prepared by: Albert Sosa UNIVERSITY OF CALIFORNIA, RIVERSIDE Table of Contents I Introduction

More information

Clinical Trial Synopsis

Clinical Trial Synopsis Clinical Trial Synopsis Title of Study: A Phase III, Open-Label, Fixed-Dose Study to Determine the Safety of Long-Term Administration of TAK-375 in Subjects With Chronic Insomnia Protocol Number: Name

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation

A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Diabetic Ketoacidosis

Diabetic Ketoacidosis Diabetic Ketoacidosis Definition: Diabetic Ketoacidosis is one of the most serious acute complications of diabetes. It s more common in young patients with type 1 diabetes mellitus. It s usually characterized

More information

VICTOSA and Renal impairment DR.R.S.SAJAD

VICTOSA and Renal impairment DR.R.S.SAJAD VICTOSA and Renal impairment DR.R.S.SAJAD February 2019 Main effect of GLP-1 is : Stimulating glucose dependent insulin release from the pancreatic islets. Slow gastric emptying Inhibit inappropriate

More information

FLUIDS/ELECTROLYTES. Sahir Kalim, MD MMSc. Department of Medicine, Division of Nephrology, Massachusetts General Hospital Harvard Medical School

FLUIDS/ELECTROLYTES. Sahir Kalim, MD MMSc. Department of Medicine, Division of Nephrology, Massachusetts General Hospital Harvard Medical School FLUIDS/ELECTROLYTES Sahir Kalim, MD MMSc Department of Medicine, Division of Nephrology, Massachusetts General Hospital Harvard Medical School Dr. Kalim has no potential conflicts of interest to disclose.

More information

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.

Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. 1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic

More information

Documentation Dissection

Documentation Dissection History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

DEFINITIONS FOR FLUID STATUS & TARGET WEIGHT

DEFINITIONS FOR FLUID STATUS & TARGET WEIGHT Home Dialysis Interest Group HEALTHCARE TEAM TOOL DEFINITIONS FOR STATUS & TARGET WEIGHT BALANCED EXCESS DEFICIT Illustrations provided by: 1 BALANCE OF THE HOME HEMODIALYSIS PATIENT Dialysis Weight**

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

Delacroix et al Renal effects of renal denervation Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate

Delacroix et al Renal effects of renal denervation Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate Supplementary Figure 1: Changes in Ambulatory Blood Pressures and Heart Rate Supplementary Table 1: Ranking each patient based on the number of measurements showing a numerical improvement. Rank at each

More information

Patient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith

Patient: Becky Smith DOB: 01/26/XXXX Age: 5 y/o Attending: Dr. D. Miles Allergies: NKA MR#: 203. Patient Chart #203 Becky Smith Patient Chart #203 Becky Smith 1 Property of CSCLV CSCLV Rev: 06/04/2018 Chief Complaint: Abdominal pain. Informant: Parents. HISTORY & PHYSICAL HPI: Ill looking patient, healthy until 2 days ago when

More information

DIABETIC KETOACIDOSIS (DKA) K E M I A D E Y E R I, P G Y - 1

DIABETIC KETOACIDOSIS (DKA) K E M I A D E Y E R I, P G Y - 1 DIABETIC KETOACIDOSIS (DKA) K E M I A D E Y E R I, P G Y - 1 QUESTION # 1 7 year old boy comes to the ER with a 2 week history of abdominal pain and weight loss. Further history reveals polyuria and polydipsia,

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Solomon SD, Uno H, Lewis EF, et al. Erythropoietic response

More information

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity

Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold

More information

Dr. Dafalla Ahmed Babiker Jazan University

Dr. Dafalla Ahmed Babiker Jazan University Dr. Dafalla Ahmed Babiker Jazan University objectives Overview Definition of dehydration Causes of dehydration Types of dehydration Diagnosis, signs and symptoms Management of dehydration Complications

More information

SYNOPSIS. Administration: subcutaneous injection Batch number(s):

SYNOPSIS. Administration: subcutaneous injection Batch number(s): SYNOPSIS Title of the study: A randomized, double-blind, placebo-controlled, 2-arm parallel-group, multicenter 24-week study followed by an extension assessing the efficacy and safety of AVE0010 on top

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Dhabangi A, Ainomugisha B, Cserti-Gazdewich C, et al. Effect of transfusion of red blood cells with longer vs shorter storage duration on elevated blood lactate levels in children

More information

CASE-BASED SMALL GROUP DISCUSSION MHD II

CASE-BASED SMALL GROUP DISCUSSION MHD II MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby

More information

TABLE OF CONTENTS GENERAL INFORMATION... 1

TABLE OF CONTENTS GENERAL INFORMATION... 1 BIOO RESEARCH PRODUCTS Glucose Assay Kit Manual Catalog #: 5611-01 BIOO Scientific Corp. 2011 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Description... 1 Procedure Overview... 1 Required Materials

More information

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

Renal Function and Associated Laboratory Tests

Renal Function and Associated Laboratory Tests Renal Function and Associated Laboratory Tests Contents Glomerular Filtration Rate (GFR)... 2 Cockroft-Gault Calculation of Creatinine Clearance... 3 Blood Urea Nitrogen (BUN) to Serum Creatinine (SCr)

More information

PHENTOLAMINE MESYLATE INJECTION SANDOZ STANDARD 5 mg/ ml THERAPEUTIC CLASSIFICATION Alpha-adrenoreceptor Blocker

PHENTOLAMINE MESYLATE INJECTION SANDOZ STANDARD 5 mg/ ml THERAPEUTIC CLASSIFICATION Alpha-adrenoreceptor Blocker PACKAGE INSERT Pr PHENTOLAMINE MESYLATE INJECTION SANDOZ STANDARD 5 mg/ ml THERAPEUTIC CLASSIFICATION Alpha-adrenoreceptor Blocker ACTIONS AND CLINICAL PHARMACOLOGY Phentolamine produces an alpha-adrenergic

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Keeping track of your numbers

Keeping track of your numbers Keeping track of your numbers If you have relapsed or refractory multiple myeloma, keeping track of your numbers can help you take an active role in your care. It s also one way you and your doctor can

More information

CORE CLINICAL DATASET

CORE CLINICAL DATASET The following pages are the CORE CLINICAL DATASET for Ebolavirus disease. The forms are featured in order of priority. Therefore, when resources are limited, data collection can be reduced as required

More information

INSTRUCTIONS: 1. Use codetable on page 1 for modifications / termination reasons

INSTRUCTIONS: 1. Use codetable on page 1 for modifications / termination reasons Radiation Therapy Oncology Group Phase III Head & Neck Cancer Treatment Summary Form AMENDED DATA YES INSTRUCTIONS: 1 Use codetable on page 1 for modifications / termination reasons SUMMARY OF SYSTEMIC

More information

1 Acute Lymphoblastic Leukaemia

1 Acute Lymphoblastic Leukaemia 1 Acute Lymphoblastic Leukaemia 1.05 Intensification - Philadelphia Negative Patients Indication ALL Philadelphia negative patients Pre-treatment Evaluation The intensification module begins two weeks

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

Newer and Expensive treatment of diabetes. Endocrinology Visiting Associate Professor Institute of Medicine TUTH

Newer and Expensive treatment of diabetes. Endocrinology Visiting Associate Professor Institute of Medicine TUTH Newer and Expensive treatment of diabetes Jyoti Bhattarai MD Endocrinology Visiting Associate Professor Institute of Medicine TUTH Four out of every five people with diabetes now live in developing countries.

More information

23-Aug-2011 Lixisenatide (AVE0010) - EFC6014 Version number: 1 (electronic 1.0)

23-Aug-2011 Lixisenatide (AVE0010) - EFC6014 Version number: 1 (electronic 1.0) SYNOPSIS Title of the study: A randomized, double-blind, placebo-controlled, parallel-group, multicenter 24-week study followed by an extension assessing the efficacy and safety of AVE0010 on top of metformin

More information

ROUTINE LAB STUDIES. Routine Clinic Lab Studies

ROUTINE LAB STUDIES. Routine Clinic Lab Studies ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

Does Bicarbonate Concentration Predict Hospitalization among Children with Gastroenteritis?

Does Bicarbonate Concentration Predict Hospitalization among Children with Gastroenteritis? Does Bicarbonate Concentration Predict Hospitalization among Children with Gastroenteritis? Muin Habashneh MD*, Mohammad Alrwalah MD* ABSTRACT Objective: To determine the relationship between bicarbonate

More information

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of

Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of Supplementary Figure 1 Binding of PAR1-RIP to (A) anionic liposomes consisting of phosphatidylserine and (B) zwitterionic liposomes composed of phosphatidylserine and phosphatidylcholine. The instrinsic

More information

Student Note Outline: Introduction to Specialty Feeds

Student Note Outline: Introduction to Specialty Feeds Student Note Outline: Introduction to Specialty Feeds Protein Supplements More than 20% protein Animal Protein Supplements inedible tissues from meat packing Surplus milk products marine sources feather

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Geller AI, Shehab N, Lovegrove MC, et al. National estimates of insulin-related hypoglycemia and errors leading to emergency department visits and hospitalizations. JAMA Internal

More information

Kathryn Jones 8/11/2015

Kathryn Jones 8/11/2015 1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry

More information

Adlyxin. (lixisenatide) New Product Slideshow

Adlyxin. (lixisenatide) New Product Slideshow Adlyxin (lixisenatide) New Product Slideshow Introduction Brand name: Adlyxin Generic name: Lixisenatide Pharmacological class: Glucagon-like peptide-1 (GLP-1) receptor agonist Strength and Formulation:

More information

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp

IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification

More information

Rini Purwanti Sekretaris PD IPDI Jatim

Rini Purwanti Sekretaris PD IPDI Jatim Kidney Emergency Rini Purwanti Sekretaris PD IPDI Jatim overview The kidneys are a pair of small ( about the size of your fist-sized ), bean shaped organs that lie on either side of your spine, located

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat

Supplementary files. Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan. medicines Renqing Changjue in rat Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2018 Supplementary files Tissue metabolomics study to reveal the toxicity of a Traditional Tibetan

More information

Non-insulin treatment in Type 1 DM Sang Yong Kim

Non-insulin treatment in Type 1 DM Sang Yong Kim Non-insulin treatment in Type 1 DM Sang Yong Kim Chosun University Hospital Conflict of interest disclosure None Committee of Scientific Affairs Committee of Scientific Affairs Insulin therapy is the mainstay

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Ertugliflozin (Steglatro ) 5 mg daily. May increase to 15 mg daily. Take in the morning +/- food. < 60: Do not initiate; discontinue therapy

Ertugliflozin (Steglatro ) 5 mg daily. May increase to 15 mg daily. Take in the morning +/- food. < 60: Do not initiate; discontinue therapy Sodium-glucose Cotransporter-2 (SGLT2) s Inhibit SGLT in proximal renal tubules, reducing reabsorption of filtered glucose from tubular lumen Lowers renal threshold for glucose à increase urinary excretion

More information

Report Reference Guide. THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1

Report Reference Guide. THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1 Report Reference Guide THERAPY MANAGEMENT SOFTWARE FOR DIABETES CareLink Report Reference Guide 1 How to use this guide Each type of CareLink report and its components are described in the following sections.

More information

Assessment of "Average of Normals" Quality Control Procedures and Guidelines for Implementation

Assessment of Average of Normals Quality Control Procedures and Guidelines for Implementation Assessment of "Average of Normals" Quality Control Procedures and Guidelines for Implementation GEORGE S. CEMBROWSKI, M.D., PH.D., ELLIOT P. CHANDLER, M.D., AND JAMES O. WESTGARD, PH.D. The capabilities

More information

General Chemistry Scheme Guide

General Chemistry Scheme Guide General Chemistry Scheme Guide Copyright WEQAS. All rights reserved. No part of this document may be reproduced or utilised in any form without permission from WEQAS Contents. Scheme details and repertoire.....

More information

Hematologic and Chemical Changes Observed during and after Cardiac Arrest in a Canine Model A Pilot Study

Hematologic and Chemical Changes Observed during and after Cardiac Arrest in a Canine Model A Pilot Study Hematologic and Chemical Changes Observed during and after Cardiac Arrest in a Canine Model A Pilot Study Barry E. Bleske, Pharm.D., Jessica Song, Pharm.D., Moses S. S. Chow, Pharm.D., Jeffrey Kluger,

More information

Summary ID# Clinical Study Summary: Study B4Z-JE-LYBD

Summary ID# Clinical Study Summary: Study B4Z-JE-LYBD CT Registry ID#5286 Page 1 Summary ID# 5286 Clinical Study Summary: Study B4Z-JE-LYBD An Open Label, Dose-Titration Safety Study of Hydrochloride in Outpatient Japanese Children with Attention-Deficit/Hyperactivity

More information

GLUCOSE MONITORING. How. When

GLUCOSE MONITORING. How. When GLUCOSE MONITORING Why Self-monitoring of blood glucose is the best way to see how your body handles food, activity, diabetes medication (pills and/or insulin), stress and illness. You can also see what

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010

Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE Robert R. Henry, MD Authors and Disclosures CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Introduction Type 2 diabetes

More information

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group

Table S2: Anthropometric, clinical, cardiovascular and appetite outcome changes over 8 weeks (baseline-week 8) by snack group Table S1: Nutrient composition of cracker and almond snacks Cracker* Almond** Weight, g 77.5 g (5 sheets) 56.7 g (2 oz.) Energy, kcal 338 364 Carbohydrate, g (kcal) 62.5 12.6 Dietary fiber, g 2.5 8.1 Protein,

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Form 8: Post Transplant Annual Followup

Form 8: Post Transplant Annual Followup Page 1 of 7 Show trials/registries Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Print this Form t Started 1

More information

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of

What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such

More information

Macaque Food and Water Restriction Policy Adopted by UCAR 11/20/13

Macaque Food and Water Restriction Policy Adopted by UCAR 11/20/13 Macaque Food and Water Restriction Policy Adopted by UCAR 11/20/13 The Animal Welfare Act requires that primates be given access to food at least once per day and to water no less than twice daily for

More information

LNA-mediated silencing of microrna-122 in African green monkeys

LNA-mediated silencing of microrna-122 in African green monkeys LNA-mediated silencing of microrna-122 in African green monkeys Supplementary information for Elmen and Lindow et al. February 25, 2008 This document contains details about the clinical parameters measured

More information

SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH

SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity

More information

What is meant by Thrombotic Microangiopathy (TMA)?

What is meant by Thrombotic Microangiopathy (TMA)? What is meant by Thrombotic Microangiopathy (TMA)? Thrombotic Microangiopathy (TMA) is a group of disorders characterized by injured endothelial cells, microangiopathic hemolytic anemia (MAHA), with its

More information

Report Reference Guide

Report Reference Guide Report Reference Guide How to use this guide Each type of CareLink report and its components are described in the following sections. Report data used to generate the sample reports was from sample patient

More information

BIOO LIFE SCIENCE PRODUCTS

BIOO LIFE SCIENCE PRODUCTS BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

(For National Authority Use Only) Name of Study Drug: to Part of Dossier:

(For National Authority Use Only) Name of Study Drug: to Part of Dossier: 2.0 Synopsis Abbott Laboratories Individual Study Table Referring to Part of Dossier: (For National Authority Use Only) Name of Study Drug: Volume: ABT-335 Name of Active Ingredient: Page: ABT-335, A-7770335.115

More information

Committee for Risk Assessment RAC. Opinion. on the specific target organ toxicity of 2-benzotriazol-2-yl-4,6-di-tert-butylphenol (UV- 320)

Committee for Risk Assessment RAC. Opinion. on the specific target organ toxicity of 2-benzotriazol-2-yl-4,6-di-tert-butylphenol (UV- 320) Committee for Risk Assessment RAC Opinion on the specific target organ toxicity of 2-benzotriazol-2-yl-4,6-di-tert-butylphenol (UV- 320) EC number: 223-346-6 CAS number: 3846-71-7 and 2-(2H-benzotriazol-2-yl)-4,6-ditertpentylphenol

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

Radiographic Procedures III (RAD 228)

Radiographic Procedures III (RAD 228) Radiographic Procedures III (RAD 228) Urinary System RADIOGRAPHIC EXAMINATIONS Urinary System Antegrade Exam IVU Functional test Hypertensive evaluation as per protocol Retrograde Exams Retrograde Urography

More information

Abnormal Liver Chemistries. Lauren Myers, MMsc. PA-C Oregon Health and Science University

Abnormal Liver Chemistries. Lauren Myers, MMsc. PA-C Oregon Health and Science University Abnormal Liver Chemistries Lauren Myers, MMsc. PA-C Oregon Health and Science University Disclosure 1. The speaker/planner Lauren Myers, MMSc, PA-C have no relevant financial relationships to disclose

More information

Form 8: Post Transplant Annual Followup

Form 8: Post Transplant Annual Followup Page 1 of 8 Patient Details Hidden Show Show/Hide Annotations Stickies: Toggle All Toggle Open Toggle Resolved Form 8: Post Transplant Annual Followup Toggle Question Year/Info Print this Form t Started

More information

RN Diabetes Medication Titration Protocol

RN Diabetes Medication Titration Protocol Metformin (Glucophage) Biguanide Medication titration: Time 0 APC or MD Start Metformin 500mg (500mg in the morning, taken with food) Week 1 Week 2 Metformin 1000mg (500mg in the morning and 500mg in the

More information

GENERAL. Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry)

GENERAL. Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry) GENERAL Compulsory module GEN II Example questions (Acute and Routine Clinical Chemistry) ESSAY ANSWER QUESTIONS 2 Questions - each question is worth 35 marks.all questions should be attempted Question

More information

CRRT Fundamentals Pre-Test. AKI & CRRT 2017 Practice Based Learning in CRRT

CRRT Fundamentals Pre-Test. AKI & CRRT 2017 Practice Based Learning in CRRT CRRT Fundamentals Pre-Test AKI & CRRT 2017 Practice Based Learning in CRRT Question 1 A 72-year-old man with HTN presents to the ED with slurred speech, headache and weakness after falling at home. He

More information

VITROS MicroSlide Assay Summary

VITROS MicroSlide Assay Summary ACET Acetaminophen ALB Albumin EDTA 10 9 TDM PV Specialty 5.5 4 PV Isotonic saline or 10 200 μg/ml 66 1323 μmol/l (μmol/l = μg/ml x 6.616) 1.00 6.00 g/dl 10.0-60.0 g/l (g/l = g/dl x 10) Therapeutic: 670

More information

Routine Clinic Lab Studies

Routine Clinic Lab Studies Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection

More information

Case TWO. Vital Signs: Temperature 36.6degC BP 137/89 HR 110 SpO2 97% on Room Air

Case TWO. Vital Signs: Temperature 36.6degC BP 137/89 HR 110 SpO2 97% on Room Air Mr N is a 64year old Chinese gentleman who is a heavy drinker, still actively drinking, and chronic smoker of >40pack year history. He has a past medical history significant for Hypertension, Hyperlipidemia,

More information

Diabetes: Inpatient Glucose control

Diabetes: Inpatient Glucose control Diabetes: Inpatient Glucose control Leanne Current, PharmD, BCPS This activity is funded through the Medicaid section 1115(a) Demonstration Texas Healthcare Transformation and Quality Improvement Program

More information

Disclaimer. Chapter 3 Disorder of Water, Electrolyte and Acid-base Professor A. S. Alhomida. Disorder of Water and Electrolyte

Disclaimer. Chapter 3 Disorder of Water, Electrolyte and Acid-base Professor A. S. Alhomida. Disorder of Water and Electrolyte Disclaimer King Saud University College of Science Department of Biochemistry The texts, tables, figures and images contained in this course presentation (BCH 376) are not my own, they can be found on:

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

My Transplant Log. Patient Education. After a kidney/pancreas transplant. Vital Signs

My Transplant Log. Patient Education. After a kidney/pancreas transplant. Vital Signs Patient Education Page 20-1 My Transplant Log After a kidney/pancreas transplant This section of the Guide to Your Kidney/Pancreas Transplant explains the tests you will have after your transplant. It

More information

Effects of Dietary Zinc and Endotoxin Challenge on Immune Function in Weanling Pigs

Effects of Dietary Zinc and Endotoxin Challenge on Immune Function in Weanling Pigs 2000 Animal Science Research Report Pages 154-159 Effects of Dietary Zinc and Endotoxin Challenge on Immune Function in Weanling Pigs S. Mandali, M.Rincker, S.D. Carter, A.B. Arquitt, E. Droke, B.J.Stoecker

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Study No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable:

Study No.: Title: Rationale: Phase: Study Period: Study Design: Centres: Indication: Treatment: Objectives: Primary Outcome/Efficacy Variable: The study listed may include approved and non-approved uses, formulations or treatment regimens. The results reported in any single study may not reflect the overall results obtained on studies of a product.

More information