Over-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury
|
|
|
- Elijah Wells
- 5 years ago
- Views:
Transcription
1 Over-Activation of Hypoxia-Inducible Transcription Factor 1 alpha (HIF)-1α by Chronic Hypoxia Mediates Chronic Ischemic Renal Injury Romesh Dhaduk Department of Pharmocology and Toxicology Virginia Commonwealth University Short-term Educator Program for Underrepresented Persons (STEP-UP) Mentors: Dr. Pin-Lan Li and Dr. Ningjun Li
2 Background Once the renal damage reaches a certain threshold, the progression of chronic renal disease is consistent and irreversible. Ultimately leads to fibrosis. Mechanisms are not yet known. According to the United States Renal Data System: Total Medicare spending in nearly $355 billion End Stage Renal Disease (ESRD) cost $23 billion. Need efficient therapeutic strategies to reverse or prevent the progress of chronic renal injury.
3 Background Hypoxia-inducible transcription factor 1 alpha (HIF-1α). Transcription factor. Extremely prevalent in the kidney. Hypoxia detected in all kinds of chronic renal diseases. HIF-1α is up-regulated in different chronic renal diseases. Activation of HIF-1α stimulates the fibrotic factors.
4 Collagen I/III level (normalized intensity) ANG II + Ang II + Ang II + A Scrambled Scrambled Scrambled Scrambled HIF1alpha- sirna ANG II + + Naïve Control sirna sirna sirna AngII HIF-1a sirna AngII sirna HIF1- -actin B Ang II + Ang II + Scrambled Scrambled HIF1alpha- Naïve sirna sirna sirna Collegan I/II I TIMP -1 C * - actin * 0.0 Naïve Scrambled sirna Ang II + scrambled sirna Ang II + HIF1alphasiRNA
5 Background Chronic hypoxia is possibly responsible for the overactivation of HIF-1α in chronic kidney diseases. HIF-1α may be a pathogenic factor that mediates chronic renal injury. At present, no direct evidence showing the contributing role of HIF-1α in this process. Therefore, in the present study we use 2 kidneys 1-clip rat as a chronic renal ischemia model to test our hypothesis, which is whether HIF-1α is increased in clipped kidneys and whether HIF-1α shrna blocks renal injury.
6 Hypothesis Hypoxia HIF-1α Fibrogenic factors Extra Cellular Matrix
7 Animal Model Making a clip on the left renal artery Plasmid transfection by intra renal artery injection
8 mrna level Bioluminescent Signal After Transfection of Luciferase Plasmids as Reporter genes. A Color Bar Min = Max = B Click # CAR Wed, Sep 02, :22:54 Em filter=open Bin:HS (16), FOV19.9, f1, 1m Camera: IS0648N4048, Spectral Instruments TE 2.0 Luciferin + O 2, ATP Oxyluciferin + Light 1.6 (Substrate) Luciferase 1.2 (Reporter Gene) Series: NJ-luciferase Experiment: 3/27/2009 Label: blue-2 Comment: body photo Analysis Comment: Weeker-back-5 bkg sub flat-fielded cosmic (days)
9 Mean Artery Blood Pressure (mmhg) Blood Pressure Changes ACEI Ctrl LE HE Day after Surgery
10 HIF1a Level in Cortex HIF-1α Expression in Each Group A HIF-1 B Ctrl L LE HE Actin Ctrl=Normal Animal+ Luciferase, L=Clipped Animal+Luciferase, LE=Clip+ACEI+Luciferase, HE=Clip+ACEI+HIF-1 shrna Ctrl L LE HE
11 Glomerular Damage Index (GDI) Glomerular Damage in Each Group A Ctlr L B 4 3 LE HE Ctrl (N=4) L(n=3) LE(n=7) HE(n=7)
12 Collagen Staining Area Ratio (%) Effect of Silencing HIF-1α on Collagen Distribution A 25 B LE HE 5 0 Ctrl(n=4) L(n=3) LE (n=7) HE (n=7)
13 Effect of Silencing HIF-1α on CD5, B Cell Marker 100X 200X Clip+ACEI+Luciferase Clip+ACEI+HIF-1α shrna Clip+ACEI+Luciferase Clip+ACEI+HIF-1α shrna Cortex Medulla
14 Conculsion Clip over-activates hypoxia-inducible transtription factor 1 alpha (HIF-1α) expression by chronic hypoxia. Over-activation of HIF-1α contributes to chronic ischemic renal injury. Inflammation is involved in this renal injury. Silencing HIF-1α can protect chronic ischemic renal injury.
15 Future Directions Use disease models such as diabetic nephropathy, hypertensive nephropathy and see whether silencing HIF- 1α can protect against chronic ischemic renal injury. HIF prolyl hydroxylase (PHD): Oxygen sensor that regulate HIF-1a levels in response to changes of oxygen concentrations In normoxia, targets HIF-1α for destruction. To determine whether PHD will also be involved in CKD via regulation of HIF-1alpha.
16 Acknowledgements Dr. Pin-Lan Li and Dr. Ningjun Li; Dr. Zhengchao Wang and Dr. Qing Zhu; Lori P. Payne; All other staff in the lab; This work is supported by NIH and STEP-UP.
Role of Acid Sphingomyelinase Knockout Mice in Protection Against Hyperhomocystenimia Induced Glomerular Injury
Role of Acid Sphingomyelinase Knockout Mice in Protection Against Hyperhomocystenimia Induced Glomerular Injury Sophie S. Yuth Department of Pharmacology and Toxicology Medical College of Virginia Virginia
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway
AWARD NUMBER: W81XWH-12-1-0560 TITLE: Overcoming Resistance to Inhibitors of the Akt Protein Kinase by Modulation of the Pim Kinase Pathway PRINCIPAL INVESTIGATOR: Andrew S. Kraft, MD CONTRACTING ORGANIZATION:
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
Cardiovascular Protection and the RAS
Cardiovascular Protection and the RAS Katalin Kauser, MD, PhD, DSc Senior Associate Director, Boehringer Ingelheim Pharmaceutical Inc. Micardis Product Pipeline Scientific Support Ridgefield, CT, USA Cardiovascular
HIF-inducible mir-191 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment.
HIF-inducible mir-9 promotes migration in breast cancer through complex regulation of TGFβ-signaling in hypoxic microenvironment. Neha Nagpal, Hafiz M Ahmad, Shibu Chameettachal3, Durai Sundar, Sourabh
Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master. Mix, Roche Applied Science) using specific oligonucleotides.
1 SUPPLEMENTAL MATERIAL SUPPLEMENT METHODS Real Time PCR. Gene expression was analyzed by real time PCR (SYBR GREEN PCR Master Mix, Roche Applied Science) using specific oligonucleotides. Rat ST2L forward
SUPPLEMENTARY DATA. Supplementary Table 1. Characteristics of Subjects.
Supplementary Table 1. Characteristics of Subjects. a includes one patient who had an aqueous sample taken from the same eye twice b includes one patients who had an aqueous sample taken from the same
ASN s Legislative Priorities for 2010
ASN s Legislative Priorities for 2010 3 Address Profound Health Care Disparities Congress should fund more research to address inequities in treatment of Americans with kidney disease. Only 7% of US physicians
Intra-renal Oxygenation. in Human Subjects
MRI-based Mapping of Intra-renal Oxygenation BOLD in Human Subjects OEF Xiang He, PhD Department of Radiology Background Cortex Brain CBF ~ 1.0 ml/min/g Brain PO 2 ~ 25-35 mm Hg Medullary hypoxia is an
Silencing of hypoxia-inducible factor-1 gene attenuates chronic ischemic renal injury in two-kidney, one-clip rats
m J Physiol Renal Physiol 36: F1236 F1242, 214. First published March 12, 214; doi:1.1152/ajprenal.673.213. Silencing of hypoxia-inducible factor-1 gene attenuates chronic ischemic renal injury in two-kidney,
Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia!
Mechanisms of Gene Regulation and Signal! Transduction in Hypoxia! Lorenz Poellinger! Dept. of Cell and Molecular Biology! Karolinska Institutet, Stockholm, Sweden! Normoxia - O 2 availability is in balance
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Prof. Andrzej Wiecek Department of Nephrology, Endocrinology and Metabolic Diseases Medical University of Silesia Katowice, Poland.
What could be the role of renal denervation in chronic kidney disease? Andrzej Wiecek, Katowice, Poland Chairs: Peter J. Blankestijn, Utrecht, The Netherlands Jonathan Moss, Glasgow, UK Prof. Andrzej Wiecek
The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes
The role of oxygen insufficiency in the onset and development of the vascular complications of diabetes Rachel M Knott School of Pharmacy & Life Sciences Robert Gordon University, Aberdeen AB10 7GJ, UK
Supplementary Information
Supplementary Information NEPRILYSIN IS A MEDIATOR OF ALTERNATIVE RENIN- ANGIOTENSIN- SYSTEM ACTIVATION IN THE MURINE AND HUMAN KIDNEY Oliver Domenig 1#, Arndt Manzel 2#, Nadja Grobe 3, Eva Koenigshausen
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of
Aberrant Promoter CpG Methylation is a Mechanism for Lack of Hypoxic Induction of PHD3 in a Diverse Set of Malignant Cells Abstract The prolyl-hydroxylase domain family of enzymes (PHD1-3) plays an important
As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the
3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing
Histone modifications in kidney disease
Histone modifications in kidney disease Masaomi Nangaku Division of Nephrology and Endocrinology The University of Tokyo Graduate School of Medicine Japan Mimura, Tanaka, & Nangaku. Semin Nephrol 2013
Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi
Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells
Research article Autocrine production of IL-11 mediates tumorigenicity in hypoxic cancer cells Barbara Onnis, 1 Nicole Fer, 2 Annamaria Rapisarda, 2 Victor S. Perez, 1 and Giovanni Melillo 2 1 Developmental
RENAL ARTERY STENOSIS. Grand Rounds 10/11/2011
RENAL ARTERY STENOSIS Grand Rounds 10/11/2011 ARAS Prevalence- 0.5% overall population, 5.5% in ckd pts No correlation between ischemic nephropathy and severity of stenosis Increased risk of vascular events-
The National Kidney Foundation (NKF) is pleased to submit testimony regarding the impact of
STATEMENT OF THE NATIONAL KIDNEY FOUNDATION 30 EAST 33 RD STREET NEW YORK, NY 10016 SUBMITTED TO THE HOUSE COMMITTEE ON APPROPRIATIONS; SUBCOMMITTEE ON LABOR, HHS, EDUCATION, AND RELATED AGENCIES IN SUPPORT
Endothelial HIF-2 mediates protection and recovery from ischemic kidney injury
Endothelial HIF-2 mediates protection and recovery from ischemic kidney injury Pinelopi P. Kapitsinou,, Timothy A. Sutton, Volker H. Haase J Clin Invest. 2014;124(6):2396-2409. https://doi.org/10.1172/jci69073.
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
An oxygen-regulated switch in the protein synthesis machinery
An oxygen-regulated switch in the protein synthesis machinery 1 Inhibition of translation during acute hypoxia is mediated by eif2α phosphorilation mouse embryo fibroblasts (MEFs) 1 Watson et al., BIOLOGIA
Supplementary Information
Supplementary Information Figure S1. Int6 gene silencing efficiency. (A) Western Blot analysis of Int6 expression at different times after sirna transfection. Int6 expression is strongly silenced in Int6
The mirna-184 drives renal fibrosis by targeting HIF1AN in vitro and in vivo
https://doi.org/10.1007/s11255-018-2025-4 NEPHROLOGY - ORIGINAL PAPER The mirna-184 drives renal fibrosis by targeting HIF1AN in vitro and in vivo Bin Chen 1 Received: 18 December 2017 / Accepted: 3 November
Summer 2015 Research Opportunity
Summer 2015 Research Opportunity Conduct research during the summer of 2015 (June 1-August 6) under the direction of a Vanderbilt scientist (stipend provided, approximately $1,800/month) Laboratory-based,
A Broad Clinical Pipeline of Innovative Diabetes / Renal & Oncology Programs. European Business Development Conference Düsseldorf 24 Sept 2013
A Broad Clinical Pipeline of Innovative Diabetes / Renal & Oncology Programs European Business Development Conference Düsseldorf 24 Sept 2013 Key facts about NOXXON Developing a new class of proprietary
Prolyl Hydroxylase Inhibitors
April 27-28, 2015 Prolyl Hydroxylase Inhibitors K.-U. Eckardt Nephrology and Hypertension University of Erlangen-Nürnberg - University Clinic Erlangen - Community Hospital Nuremberg Prolyl Hydroxylase
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Chapter 2. Investigation into mir-346 Regulation of the nachr α5 Subunit
15 Chapter 2 Investigation into mir-346 Regulation of the nachr α5 Subunit MicroRNA s (mirnas) are small (< 25 base pairs), single stranded, non-coding RNAs that regulate gene expression at the post transcriptional
Surgical Pathology Report
Louisiana State University Health Sciences Center Department of Pathology Shreveport, Louisiana Accession #: Collected: Received: Reported: 6/1/2012 09:18 6/2/2012 09:02 6/2/2012 Patient Name: Med. Rec.
General introduction of nephrology. Xiaoqiang Ding M.D., Ph.D. Department of nephrology Zhongshan Hospital, Fudan University
General introduction of nephrology Xiaoqiang Ding M.D., Ph.D. Department of nephrology Zhongshan Hospital, Fudan University Terminology Kidney,renal Nephrology Scope of nephrology Kidney diseases and
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
Special Lecture 11/08/2013. Hypertension Dr. HN Mayrovitz
Special Lecture 11/08/2013 Hypertension Dr. HN Mayrovitz Arterial Blood Pressure (ABP) Major Factors Summarized Sympathetic Hormones Arteriole MAP ~ Q x TPR + f (V / C) SV x HR Renal SBP Hypertension =
Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress
3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative
Coding Hints 2 nd Edition
Coding Hints 2 nd Edition Medicare s guidelines state, Code all documented conditions which co-exist at the time of the visit that require or affect patient care or treatment. Beyond the Basics Incomplete
Research in IBD at University of Colorado Denver
Research in IBD at University of Colorado Denver Blair Fennimore, MD Assistant Professor of Medicine Division of Gastroenterology and Hepatology UCH Crohn s and Colitis Center Mucosal Inflammation Program
Life After CORAL: What Did CORAL Prove? David Paul Slovut, MD, PhD Co-director TAVR, Dir of Advanced Intervention
Life After CORAL: What Did CORAL Prove? David Paul Slovut, MD, PhD Co-director TAVR, Dir of Advanced Intervention No Relationships to Disclose The Need for Modern Renal Trials Increased rate of RAS diagnosis
Supplementary Material
Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles
Dynamic Interaction of Stress Granule, DDX3X and IKK-α Mediates Multiple Functions in
Dynamic Interaction of Stress Granule, and Mediates Multiple Functions in Hepatitis C Virus Infection Véronique Pène, Qisheng Li#, Catherine Sodroski, Ching-Sheng Hsu, T. Jake Liang# Liver Diseases Branch,
[General Pathology] Introduction to Pathology
![[General Pathology] Introduction to Pathology](/thumbs/73/69585662.jpg "[General Pathology] Introduction to Pathology")
Introduction to Pathology Pathology: Literally translated, pathology is the study (logos) of disease (pathos, suffering). It involves the investigation of the causes of disease and the associated changes
Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were
Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were compared in SS rats fed 1% salt diet (black circles) and WKY
Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice
Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice Vikramaditya Dumpa, MD Lori C Nielsen, MS Huamei Wang, MD Vasanth HS Kumar, MD Supported by AAP Marshall Klaus Perinatal Research Grant
Histopathology: Hypertension and diabetes in the kidney These presentations are to help you identify basic histopathological features.
Histopathology: Hypertension and diabetes in the kidney These presentations are to help you identify basic histopathological features. They do not contain the additional factual information that you need
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Silencing of the Activated Protein-1 Transcription Factor JunD Exacerbates Ischemia/Reperfusion-induced Cerebral Injury
Silencing of the Activated Protein-1 Transcription Factor JunD Exacerbates Ischemia/Reperfusion-induced Cerebral Injury Martin F. Reiner, Candela Diaz-Cañestro, Alexander Akhmedov, Heidi Amstalden, Sylvie
Overexpression of HIF Prolyl-Hydoxylase-2 transgene in the renal medulla induced a salt sensitive hypertension
J. Cell. Mol. Med. Vol 16, No 11, 212 pp. 271-277 Overexpression of HIF Prolyl-Hydoxylase-2 transgene in the renal medulla induced a salt sensitive hypertension Qing Zhu, Miao Liu, Wei-Qing Han, Pin-Lan
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
Role of Inflammation in Pulmonary Hypertension
Role of Inflammation in Pulmonary Hypertension K. R. Stenmark University of Colorado Denver, USA Prominent Fibroproliferative Changes are Observed in the Lung Vasculature of Infants With Pulmonary Arterial
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
The use of pathology surrogate markers in Fabry Disease. Beth L. Thurberg MD PhD Vice President of Pathology Genzyme
Disclaimer: Presentation slides from the Rare Disease Workshop Series are posted by the EveryLife Foundation for Rare Diseases for educational purposes only. They are for use by drug development professionals
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
basic research OPEN Minnesota, USA and 4 Department of Biochemistry and Molecular Biology, Mayo Clinic, Rochester, Minnesota, USA
http://www.kidney-international.org & 213 International Society of Nephrology basic research OPEN see commentary on page 234 Adventitial transduction of lentivirus-shrna-vegf-a in arteriovenous fistula
SLOWING PROGRESSION OF KIDNEY DISEASE. Mark Rosenberg MD University of Minnesota
SLOWING PROGRESSION OF KIDNEY DISEASE Mark Rosenberg MD University of Minnesota OUTLINE 1. Epidemiology of progression 2. Therapy to slow progression a. Blood Pressure control b. Renin-angiotensin-aldosterone
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
Niki Prakoura. Calreticulin upregulation in renal fibrosis
Calreticulin upregulation in renal fibrosis Niki Prakoura Section of Histology, Center of Basic Research, Biomedical Research Foundation of the Academy of Athens, Athens, Greece EuroKUP meeting, Madrid,
HRZZ project: Genotype-Phenotype correlation in Alport's syndrome and Thin Glomerular Basement Membrane Nephropathy. Patohistological Aspects
HRZZ project: Genotype-Phenotype correlation in Alport's syndrome and Thin Glomerular Basement Membrane Nephropathy Patohistological Aspects Petar Šenjug, MD 1 Professor Danica Galešić Ljubanović, MD,
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
HDAC Inhibition for Prevention of Fibrosis Following Sepsisinduced
HDAC Inhibition for Prevention of Fibrosis Following Sepsisinduced AKI John A. Kellum, MD, MCCM Professor of Critical Care Medicine, Medicine, Bioengineering and Clinical & Translational Science Vice Chair
MRI qbold Based Evaluation. Renal Oxidative Metabolism. Department of Radiology and Hernando Gomez, MD Critical Care Medicine
MRI qbold Based Evaluation of Renal Oxidative Metabolism Xiang He, PhD Department of Radiology and Hernando Gomez, MD Critical Care Medicine Background High oxygen-demand and lower medullary blood flow
Risk Factors and Management of Acute Renal Injury in Cardiac Surgery
Risk Factors and Management of Acute Renal Injury in Cardiac Surgery Robert S Kramer, MD, FACS Clinical Associate Professor of Surgery Tufts University School of Medicine Maine Medical Center, Portland
Chapter 6: Medicare Expenditures for CKD
Chapter 6: Medicare Expenditures for CKD Introduction Determining the economic impact of chronic kidney disease (CKD) on the health care system is challenging on several levels. There is, for instance,
Soluble Lutein (Lutemax2020 ) Prevents Retinal Damage in Streptozotocin (STZ)- induced Diabetic Rats
Soluble Lutein (Lutemax2020 ) Prevents Retinal Damage in Streptozotocin (STZ)- induced Diabetic Rats Vijaya Juturu, Ph.D., F.A.C.N. OmniActive Health Technologies, Inc. Morristown, NJ Acknowledgements
Management of New-Onset Proteinuria in the Ambulatory Care Setting. Akinlolu Ojo, MD, PhD, MBA
Management of New-Onset Proteinuria in the Ambulatory Care Setting Akinlolu Ojo, MD, PhD, MBA Urine dipstick results Negative Trace between 15 and 30 mg/dl 1+ between 30 and 100 mg/dl 2+ between 100 and
Kidney Lab. Name: By the end of this lab, you should:
Kidney Lab Name: Kidneys do a grand job removing the toxic waste products of metabolism. This process is called excretion. Our kidneys produce urine which contains urea, excess salts and excess water.
Prognosis in CKD Can we do anything about it? Rodney D Gilbert
Prognosis in CKD Can we do anything about it? Rodney D Gilbert A diagnosis of end stage renal failure implies what degree of loss of life expectancy? A. 10% B. 20% C. 30% D. 40% E. 50% F. 60% 38% 22% 16%
Ordering Physician. Collected REVISED REPORT. Performed. IgG IF, Renal MCR. Lambda IF, Renal MCR. C1q IF, Renal. MCR Albumin IF, Renal MCR
RenalPath Level IV Wet Ts IgA I Renal IgM I Renal Kappa I Renal Renal Bx Electron Microscopy IgG I Renal Lambda I Renal C1q I Renal C3 I Renal Albumin I Renal ibrinogen I Renal Mayo Clinic Dept. of Lab
신장환자의혈압조절 나기영. Factors involved in the regulation of blood pressure
신장환자의혈압조절 K/DOQI Clinical practice guidelines on Hypertension and Antihypertensive agents in CKD 나기영 Factors involved in the regulation of blood pressure Renal function curve MAP (mmhg) Central role of
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
2014 Evidence-Based HTN Guideline: Preliminary Data from AMGA s Anceta Collaborative
2014 Evidence-Based HTN Guideline: Preliminary Data from AMGA s Anceta Collaborative February 2014 Patient Population Measure spec for MU/PD generally follows NQF 0018 (used for HEDIS, PQRS, and MU) 1.6
Dr. Mehmet Kanbay Department of Medicine Division of Nephrology Istanbul Medeniyet University School of Medicine Istanbul, Turkey.
The uric acid dilemma: causal risk factor for hypertension and CKD or mere bystander? Mehmet Kanbay, Istanbul, Turkey Chairs: Anton H. van den Meiracker, Rotterdam, The Netherlands Claudia R.C. Van Roeyen,
NEDD9 is Upregulated by Hypoxia in Human Pulmonary Artery Endothelial Cells Selectively and Modulates Platelet-Endothelial Adhesion
George Alba, MD Pulmonary & Critical Care Medicine Massachusetts General Hospital November 10 th, 2017 NEDD9 is Upregulated by Hypoxia in Human Pulmonary Artery Endothelial Cells Selectively and Modulates
Correspondence to: Jun-nian Zheng, * These authors contributed equally to this paper.
Decreased expression of CHIP leads to increased angiogenesis via VEGF-VEGFR2 pathway and poor prognosis in human renal cell carcinoma Chao Sun 1, 2, 4, *, Hai-long Li 1, 2, *, Hai-rong Chen 6, *, Mei-lin
Doppler ultrasound, see Ultrasonography. Magnetic resonance imaging (MRI), kidney oxygenation assessment 75
Subject Index Acidemia, cardiorenal syndrome type 3 146 Acute Dialysis Quality Initiative (ADQI) acute kidney injury biomarkers, see Acute kidney injury; specific biomarkers cardiorenal syndrome, see specific
Klotho: renal and extra-renal effects
Klotho: renal and extra-renal effects Juan F. Navarro-González, MD, PhD, FASN Nephrology Service and Research Division University Hospital Nuestra Señora de Candalaria Santa Cruz de Tenerife. Spain Klotho:
Mechanisms of hepatic fibrogenesis in chronic liver disease
Mechanisms of hepatic fibrogenesis in chronic liver disease JPEMS 2014, Physiopathology Module Corentin Bessy (Nantes) _ Gabrielle Cepella (Amsterdam) _ Charly Gaisne (Angers) _ Gwladys Guilloineau (Angers)
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
renoprotection therapy goals 208, 209
Subject Index Aldosterone, plasminogen activator inhibitor-1 induction 163, 164, 168 Aminopeptidases angiotensin II processing 64 66, 214 diabetic expression 214, 215 Angiotensin I intrarenal compartmentalization
USRDS UNITED STATES RENAL DATA SYSTEM
USRDS UNITED STATES RENAL DATA SYSTEM Chapter 2: Identification and Care of Patients With CKD Over half of patients from the Medicare 5 percent sample have either a diagnosis of chronic kidney disease
Diabetes, Obesity and Heavy Proteinuria
Diabetes, Obesity and Heavy Proteinuria Clinical Case 41 yo Black woman with heavy proteinuria History 2014: noted to have proteinuria on routine lab testing (1.1g/g). 1+ edema. Blood pressure has been
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplemental Materials Molecular Biology of the Cell
Supplemental Materials Molecular Biology of the Cell Garcia-Alvarez et al. Supplementary Figure Legends Figure S1.Expression and RNAi-mediated silencing of STIM1 in hippocampal neurons (DIV, days in vitro).
STATEMENT OF THE NATIONAL KIDNEY FOUNDATION SUBMITTED TO THE HOUSE COMMITTEE ON APPROPRIATIONS;
STATEMENT OF THE NATIONAL KIDNEY FOUNDATION 30 EAST 33 RD STREET NEW YORK, NY 10016 SUBMITTED TO THE HOUSE COMMITTEE ON APPROPRIATIONS; SUBCOMMITTEE ON LABOR, HHS, EDUCATION, AND RELATED AGENCIES March
Implication of CD38 Gene in Podocyte Epithelial-to-Mesenchymal. Transition and Glomerular Sclerosis
1 Implication of CD38 Gene in Podocyte Epithelial-to-Mesenchymal Transition and Glomerular Sclerosis Krishna M. Boini, Min Xia, Jing Xiong, Caixia Li, Lori P. Payne, Pin-Lan Li * Department of Pharmacology
Glomerular diseases mostly presenting with Nephritic syndrome
Glomerular diseases mostly presenting with Nephritic syndrome 1 The Nephritic Syndrome Pathogenesis: proliferation of the cells in glomeruli & leukocytic infiltrate Injured capillary walls escape of RBCs
Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
Faculty/Presenter Disclosure
CSI for CKD Unravelling the myths surrounding chronic kidney disease Practical Evidence for Informed Practice Oct 21 2016 Dr. Scott Klarenbach University of Alberta Slide 1: Option B (Presenter with NO
ATHLETES & PRESCRIBING PHYSICIANS PLEASE READ
ATHLETES & PRESCRIBING PHYSICIANS PLEASE READ USADA can grant a Therapeutic Use Exemption (TUE) in compliance with the World Anti- Doping Agency International Standard for TUEs. The TUE application process
Supplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling
Developmental Cell Supplemental Information Phosphoinositides Regulate Ciliary Protein Trafficking to Modulate Hedgehog Signaling Francesc R. Garcia-Gonzalo, Siew Cheng Phua, Elle C. Roberson, Galo Garcia
Feinberg School of Medicine Chicago IL Division of Nephrology and Hypertension
Feinberg School of Medicine Chicago IL Division of Nephrology and Hypertension Daniel Batlle MD Earle, del Greco Levin Professor of Medicine Division of Nephrology and Hypertension Northwestern University
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Reducing proteinuria
Date written: May 2005 Final submission: October 2005 Author: Adrian Gillin Reducing proteinuria GUIDELINES a. The beneficial effect of treatment regimens that include angiotensinconverting enzyme inhibitors