EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information

Size: px
Start display at page:

Download "EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information"

Transcription

1 EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information NAME DIAGNOSIS PROTOCOL OF EVALUATION for Chronic Lymphatic Leukemia (CLL) GENERAL INFORMATION (ALL information required!!) /0210_ CLL INFORMED CONCENT (signature) STAGE Rai-Binet Received _02/02/2010_ (mm/dd/yyyy) SEX M F Date of birth 04/01/1962 (mm/dd/yyyy) Unknown Ethnicity Caucasian (White) Date of First Diagnosis 01/2010_ (mm/yyyy) Age at beginning of disease 47 (years) Duration of the Disease From beginning of disease to date of CRF completion: _1_(months) Date of blood drawing: 02/02/2010 (mm/dd/yyyy) Test was performed on the same day Y N Date of BM drawing: (mm/dd/yyyy) Test was performed on the same day Y N WBC count (10 9 /L) < 10 Peripheral blood CD 19+ count 60 <60 HIV 1/2 & Hepatitis B/C tests Negative Positive SAMPLE IS NOT ACCEPTED Previous treatment Yes (page.2) No Clinical information CLINICAL DATA Lymphocytosis Yes No Lymphadenopathy Hepatosplenomegaly Yes No Yes No Specify_neck, subclavia, inguinalis, axillaries Organ(s) involvement Yes No Specify Other: Page # 1 of 5

2 Current Concomitant diseases Diagnosis Date (month/ year) Physical examination Endotoxicosis Yes No Activity: Malnutrition (10 per year) Yes No Fever (month, a/b resistance) Yes No Other 0 the usual activity 1 activity is decreased 2 <50 of daytime in bed 3 >50 of daytime in bed 4 recumbent patient, it cannot attend itself _1 Score THERAPY No previous Therapy No information available Date of Diagnosis (mm/dd/yyyy) 01/2010 Medication Dose Date Therapy Effect of the treatment Positive Negative None Resistance to the therapy No Yes Complications of the therapy No Yes specify Page # 2 of 5

3 CLINICAL TESTS * If normal values (Normal Range) of your laboratory differ from listed bottom, please write normal values in brackets after data of the test (parameter). 1. Clinical blood test Machine Manual Value Normal Range Units Hemoglobin (HGB) g/l Red Blood Cell Count (RBC) *12/L Platelets *9/L White Blood Cell Count *9/L 2. Biochemistry Value Normal Range Units Potassium (К+) Mmol/L Calcium (Са+) Mmol/L AST (АСТ) U/L ALT (АлАТ) (< 0.64) U/L (Mmol/L) Bilirubin 17.9 Up to 20 µmol/l Creatinine Mmol/L ESR mm/h Uric Acid 140 M: F: Mmol/L Machine WBC differential Manual Glucose Mmol/L Total protein g/l Albumin g/l Blasts 0 Neutrophils (сегм) Band cells (пал/яд) 0 Lymphoblasts 0 Prolymphocytes 0 Lymphocytes Monocytes Eosinophils (Эо) Basophils (Б) Plasma cells 0 0 Smear cells Globulin g/dl a1 Globulin 1-3 g/l a2 Globulin 6-10 g/l β Globulin 7-11 g/l IgG IgA IgM Lactatedehydro genase (LDH) Alkaline phosphatase (ALP) β2- Microglobulin (β2m) ( ) ( ) ( ) 6, µg/ml Page # 3 of 5

4 3. Urine test Date (mm/dd/yyyy) 02/03/2010_ Value Normal Range Units Specific gravity Protein - none g/l Leukocytes RBC Epithelial Cylinders - none Bacteria - none Salt - none Other: 4. Caryotype: Date (mm/dd/yyyy) / / _ 5. Bone Marrow aspirate differential Cells Normal range Units Undifferentiated blast cells 0.4 ( ) Myeloblasts <5 ( ) Promyelocytes (Progranulocytes) ( ) Myelocytes ( ) Metamyelocytes ( ) Band cells 4.6 ( ) Neutrophils 13.8 ( ) Total neutrophil lineage cells 30.4 ( ) Mature eosinophilic myelocytes (0-0.2) Eosinophilic metamyelocytes <1 ( ) Eosinophils ( ) Total eosinophil lineage cells 2.2 ( ) Mature basophilic myelocytes <5 (0-0.2) Basopilic metamyelocytes <1 Basophils (0-0.3) Total basophil lineage cells 0.2 (0-0.5) Lymphoblasts (0-0.2) Prolymphocytes (0-0.2) Lymphocytes 3-20 ( ) Total lymph. lineage cells 49.8 ( ) Monoblasts (0-0.2) Monocytes 0.8 <5 ( ) Plasmoblasts (0-0.2) Proplasmocytes ( ) Plasma cells <1 ( ) Total plasma lineage cells 0.4 Erythroid cells ( ) Basophilic normoblasts ( ) Polychr. normoblasts ( ) Oxyphil normoblasts ( ) Promegaloblasts Basophilic megaloblasts Polychr. megaloblasts Oxyphil megaloblasts Total erythr. lineage cells (normoblasts) Ratio of myeloid to erythroid cells (M/E ratio) ( ) :1 4:1 Megakaryocytes <5 Mast cells Stromal (RES) cells ( ) Page # 4 of 5

5 Bone Marrow aspirate differential: 6. Immunophenotyping Blood Analysis : FACS IFA Immunofixation Date (mm/dd/yyyy) / / _ Bone marrow aspirate Analysis: FACS IFA Immunofixation Date (mm/dd/yyyy): 01/19/2010 _ Antigen Expression Antigens Coexpression Antigen Expression Antigens Coexpression () () () () CD45 CD5/ CD19 CD19 CD5/ CD38 CD3 CD19/ CD38 CD5 CD20/ CD23 CD38 CD10/ CD19 CD10 CD22/ CD43 CD23 CD20/ CD43 CD20 FMC7/ CD20 CD43 CD20/ CD25 FMC7 CD20/ CD22 CD25 / CD 19 CD22 / CD19 CD4/ CD8 CD4/ CD3 CD4 CD8/ CD3 CD8 сy CD3/Ki-67 cy CD3 cy CD79a/Ki67 CD79a in CD5/CD20 Ki-67 cy k/cy l CD45 CD5/ CD19 CD19 CD5/ CD38 CD3 CD19/ CD38 CD5 CD20/ CD23 CD38 CD10/ CD19 CD10 CD22/ CD43 CD23 CD20/ CD43 CD20 FMC7/ CD20 CD43 CD20/ CD25 FMC7 CD20/ CD22 CD25 / CD 19 CD22 / CD19 CD4/ CD8 CD4/ CD3 CD4 CD8/ CD3 CD8 сy CD3/Ki-67 cy CD3 cy CD79a/Ki67 CD79a in CD5/CD20 Ki-67 cy k/cy l Pan-expression CD20+CD5+CD23+ Signature (PI) Date Page # 5 of 5

Ordering Physician CLIENT,CLIENT. Collected REVISED REPORT

Ordering Physician CLIENT,CLIENT. Collected REVISED REPORT HPWET Hematopathology Consultation, MML Embed Client Hematopathology Consult REVISED INAL DIAGNOSIS Interpretation Peripheral blood, bone marrow aspirate and biopsies, bilateral iliac crests: 1. Normocellular

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

REGISTRATION FORM 1 / 2

REGISTRATION FORM 1 / 2 IDENTIFICATION AND BASELINE DATA REGISTRATION FORM 1 / 2 M Patient s initials: Sequential case N : SEX : F Date of birth: Place of birth I I Centre I I Address I I Telephone number I I Actual profession

More information

HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM

HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM HISTOLOGY VIRTUAL LABORATORY BLOOD AND LYMPHATICS SYSTEM Login: http://histopath.westernu.edu Histology Atlas AND Virtual Histology links. I. HEMATOLOGY - PERIPHERAL BLOOD Purpose: To be able to identify

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Notes for the 2 nd histology lab

Notes for the 2 nd histology lab Notes for the 2 nd histology lab Note : Please refer to the slides and see the morphological characteristics of each cell, as the practical exam will be in the form of figures. SLIDE #2 Erythropoiesis

More information

B. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle

B. PANITUMUMAB DOSE LEVEL 0 No dose reduction 1 Level -1 2 Level Other, specify in comments for this cycle Radiation Therapy Oncology Group Phase II Study Pre-operative Chemo- Radiation + Panitumumab for Potentially Operable Lung Cancer Concurrent Summary Form AMENDED DATA YES INSTRUCTIONS: Submit all pages

More information

ERROR CORRECTION FORM

ERROR CORRECTION FORM Juvenile Idiopathic Arthritis Pre-HSCT Data Sequence Number: Registry Use Only Date of HSCT for which this form is being completed: HSCT type: autologous allogeneic, allogeneic, syngeneic unrelated related

More information

BLOOD PHYSIOLOGY. White Blood Cells (WBC) Dr Nervana Mostafa

BLOOD PHYSIOLOGY. White Blood Cells (WBC) Dr Nervana Mostafa BLOOD PHYSIOLOGY White Blood Cells (WBC) Dr Nervana Mostafa 1 Lecture content. 1 Eosinophils and Basophilophils formation, maturation and function. 2. 3. 4. 5 Monocytes and macrophage formation, maturation

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

HOVON 141 CLL. Version 3, 25JUL2018. Table Required investigations at entry, during treatment and during follow up.

HOVON 141 CLL. Version 3, 25JUL2018. Table Required investigations at entry, during treatment and during follow up. Table 10.2.1 Required investigations at entry, during treatment and during follow up At entry 1 each induction cycle cycle 2 Cycle 3 day 8 and 15 Cycle 4 day1 and 6 cycle 9 day 15 of cycle 15 9 cycle 15:

More information

FBC interpretation. Dr. Gergely Varga

FBC interpretation. Dr. Gergely Varga FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24

More information

Morfologia normale e patologica

Morfologia normale e patologica Morfologia normale e patologica Gina Zini Centro di Ricerca ReCAMH Dpt. Ematologia Università Cattolica S. Cuore - Roma EMATOLOGIA DI LABORATORIO: percorsi diagnostici e obiettivi clinici. Milano 11-12

More information

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM

CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM CLINICAL USE OF CELLULAR SUBPOPULATION ANALYSIS IN BM CANCER RESEARCH CENTRE, UNIVERSITY AND UNIVERSITY HOSPITAL OF SALAMANCA (SPAIN)( Sao Paulo, 18th of April, 2009 IDENTIFICATION OF HPC (I) 1.- In vivo

More information

Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and

Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and Group of malignant disorders of the hematopoietic tissues characteristically associated with increased numbers of white cells in the bone marrow and / or peripheral blood Classified based on cell type

More information

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016

XN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016 XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

CIBMTR Center Number: CIBMTR Recipient ID: RETIRED. Today s Date: Date of HSCT for which this form is being completed:

CIBMTR Center Number: CIBMTR Recipient ID: RETIRED. Today s Date: Date of HSCT for which this form is being completed: Juvenile Idiopathic Arthritis Pre-HSCT Data Sequence Number: Date Received: Registry Use Only Today s Date: Date of HSCT for which this form is being completed: HSCT type: autologous allogeneic, allogeneic,

More information

Hematology 101. Rachid Baz, M.D. 5/16/2014

Hematology 101. Rachid Baz, M.D. 5/16/2014 Hematology 101 Rachid Baz, M.D. 5/16/2014 Florida 101 Epidemiology Estimated prevalence 8,000 individuals in U.S (compare with 80,000 MM patients) Annual age adjusted incidence 3-8/million-year 1 More

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

MORPHOLOGY OF BONE MARROW ASPIRATES. Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman

MORPHOLOGY OF BONE MARROW ASPIRATES. Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman MORPHOLOGY OF BONE MARROW ASPIRATES Dr.Prasanna N Kumar Head Department of Pathology, Oman Medical College, Oman BONE MARROW ASPIRATION Sites Sternum Anterior or posterior iliac spines Aspiration from

More information

2007 Workshop of Society for Hematopathology & European Association for Hematopathology Indianapolis, IN, USA Case # 228

2007 Workshop of Society for Hematopathology & European Association for Hematopathology Indianapolis, IN, USA Case # 228 2007 Workshop of Society for Hematopathology & European Association for Hematopathology Indianapolis, IN, USA Case # 228 Vishnu V. B Reddy, MD University of Alabama at Birmingham Birmingham, AL USA 11/03/07

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Biology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood

Biology 218 Human Anatomy. Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Adapted form Martini Human Anatomy 7th ed. Chapter 20 The Cardiovascular System: Blood Introduction The cardiovascular system functions as a system to transport numerous substances throughout the body

More information

بسم هللا الرحمن الرحيم

بسم هللا الرحمن الرحيم بسم هللا الرحمن الرحيم WBCs disorders *Slide 2: - we will focus on the disorders that are related to the # of WBCs - in children the # of lymphocyte is more than it in adults,sometimes more than neutrophils

More information

WBCs Disorders 1. Dr. Nabila Hamdi MD, PhD

WBCs Disorders 1. Dr. Nabila Hamdi MD, PhD WBCs Disorders 1 Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features

More information

Blood Cell Identification Graded

Blood Cell Identification Graded BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory

More information

HYPERCALCEMIC GOLDEN RETRIEVER

HYPERCALCEMIC GOLDEN RETRIEVER Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier

More information

Leukocytosis - Some Learning Points

Leukocytosis - Some Learning Points Leukocytosis - Some Learning Points Koh Liang Piu Department of Hematology-Oncology National University Cancer Institute National University Health System Objectives of this talk: 1. To provide some useful

More information

Case #1. 65 yo man with no prior history presented with leukocytosis and circulating blasts: Bone marrow biopsy was performed

Case #1. 65 yo man with no prior history presented with leukocytosis and circulating blasts: Bone marrow biopsy was performed Case #1 65 yo man with no prior history presented with leukocytosis and circulating blasts: WBC 187.4K/uL ; Hgb 10.0gm/dL; Platelet 68K/uL Neutrophil % 25.0% Lymphocyte % 38.0% Monocyte % 12.0% Metamyelocyte

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

2013 AAIM Pathology Workshop

2013 AAIM Pathology Workshop 2013 AAIM Pathology Workshop John Schmieg, M.D., Ph.D. None Disclosures 1 Pathology Workshop Objectives Define the general philosophy of reviewing pathology reports Review the various components of Bone

More information

Flow Cytometry. Leukemia and Myelodysplastic Syndromes. Bone Marrow Aspirate and Biopsy

Flow Cytometry. Leukemia and Myelodysplastic Syndromes. Bone Marrow Aspirate and Biopsy Diagnostic Evaluation of Blood Disorders Leukemia and Myelodysplastic Syndromes Lenise Taylor, MN, RN, AOCNS, BMTCN BMT/Immunotherapy CNS Seattle Cancer Care Alliance/UWMC ltaylor@seattlecca.org History

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study

Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study Original Research Article Bone marrow aspiration as the initial diagnostic tool in the diagnosis of leukemia - A case study Priyanka Poonam 1*, N.K. Bariar 2 1 Tutor, Department of Pathology, Patna Medical

More information

Blood = Fluid connective tissue. Formed elements in plasma.

Blood = Fluid connective tissue. Formed elements in plasma. Blood = Fluid connective tissue Formed elements in plasma. Blood Physical Characteristics Color Viscosity Volume Temperature Blood ph ph = log (1/[H+]) 7 >7

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

PAML interface maintenance bulletin 8/12/2013 ATTN: INTERFACE DATA MANAGER

PAML interface maintenance bulletin 8/12/2013 ATTN: INTERFACE DATA MANAGER PAML interface maintenance bulletin 8/12/2013 ATTN: INTERFACE DATA MANAGER 410 Please use in conjunction with PAML Test Change Alert 410 to update your database system as appropriate GA workpar decimals

More information

By Dr. Mohamed Saad Daoud

By Dr. Mohamed Saad Daoud By Dr. Mohamed Saad Daoud Part I Introduction Types of White Blood Cells Genesis of the White Blood Cells Life Span of the White Blood Cells Dr. Mohamed Saad Daoud 2 Leucocytes Introduction: Infectious

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Blood Cells Med Terms Quiz

Blood Cells Med Terms Quiz Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Objectives. Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing

Objectives. Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing Challenging Case Studies in Laboratory Diagnosis: A Focus on WBC and Hepatic Testing Margaret A. Fitzgerald, DNP, FNP-BC, NP-C, FAANP, CSP President, Fitzgerald Health Education Associates, Inc. North

More information

Hemopoiesis and Blood

Hemopoiesis and Blood Hemopoiesis and Blood Blood Cells o o o Erythrocytes Leukocytes Thrombocytes Function o Transport nutrients and wastes throughout the bloodstream, fight foreign antigens and blood coagulation. Location

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Myeloproliferative Disorders - D Savage - 9 Jan 2002

Myeloproliferative Disorders - D Savage - 9 Jan 2002 Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2

More information

Hematopathology Case Study

Hematopathology Case Study Hematopathology Case Study AMP Outreach Course 2009 AMP Annual Meeting John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine November 19, 2009 HISTORY Case History An

More information

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Chronic Myelomonocytic Leukemia with molecular abnormalities SH

Chronic Myelomonocytic Leukemia with molecular abnormalities SH Chronic Myelomonocytic Leukemia with molecular abnormalities SH2017-0351 Madhu P. Menon MD,PhD, Juan Gomez MD, Kedar V. Inamdar MD,PhD and Kristin Karner MD Madhu P Menon, MD, PhD Henry Ford Hospital Patient

More information

BIOCHEMISTRY of BLOOD

BIOCHEMISTRY of BLOOD BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of

More information

Hematopathology Case Study

Hematopathology Case Study www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Hematology Revision. By Dr.AboRashad . Mob

Hematology Revision. By Dr.AboRashad  . Mob 1 1- Hb A2 is consisting of: a) 3 ά chains and 2 γ chains b) 2 ά chains and 2 β chains c) 2 ά chains and 2 δ chains** d) 2 ά chains and 3 δ chains e) 3 ά chains and 2 δ chains 2- The main (most) Hb found

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION

VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES COPYRIGHTED MATERIAL SECOND EDITION VETERINARY HEMATOLOGY ATLAS OF COMMON DOMESTIC AND NON-DOMESTIC SPECIES SECOND EDITION COPYRIGHTED MATERIAL CHAPTER ONE HEMATOPOIESIS GENERAL FEATURES All blood cells have a finite life span, but in normal

More information

Pathology. #11 Acute Leukemias. Farah Banyhany. Dr. Sohaib Al- Khatib 23/2/16

Pathology. #11 Acute Leukemias. Farah Banyhany. Dr. Sohaib Al- Khatib 23/2/16 35 Pathology #11 Acute Leukemias Farah Banyhany Dr. Sohaib Al- Khatib 23/2/16 1 Salam First of all, this tafreegh is NOT as long as you may think. If you just focus while studying this, everything will

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD

Hematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Juvenile Myelomonocytic Leukemia (JMML)

Juvenile Myelomonocytic Leukemia (JMML) Juvenile Myelomonocytic Leukemia (JMML) JMML: Definition Monoclonal hematopoietic disorder of childhood characterized by proliferation of the granulocytic and monocytic lineages Erythroid and megakaryocytic

More information

Chapter 21 Outline. General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements

Chapter 21 Outline. General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements Chapter 21 Outline General Composition and Functions of Blood Blood Plasma Formed Elements in the Blood Hemopoiesis: Production of Formed Elements Introduction Blood serves many functions. Some examples

More information

Flow cytometry leukocyte differential : a critical appraisal

Flow cytometry leukocyte differential : a critical appraisal Flow cytometry leukocyte differential : a critical appraisal Francis Lacombe Flow cytometry department University Hospital of Bordeaux, Pessac, France francis.lacombe@chu-bordeaux.fr 2008 HORIBA ABX, All

More information

Flow Cytometry. Bone Marrow Aspirate and Biopsy. Leukemia and Myelodysplastic Syndromes

Flow Cytometry. Bone Marrow Aspirate and Biopsy. Leukemia and Myelodysplastic Syndromes Diagnostic Evaluation of Blood Disorders Leukemia and Myelodysplastic Syndromes Elise Frans, MN, RN, CWON Oncology CNS University of Washington Medical Center delterzo@uw.edu 1 History & Physical Labs:

More information

The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System

The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage

More information

Collected: , PM Sent: , PM Received: , PM Preliminary: , PM. Notification Status: COMPREHENSIVE DIAGNOSIS

Collected: , PM Sent: , PM Received: , PM Preliminary: , PM. Notification Status: COMPREHENSIVE DIAGNOSIS PATIENT Name:HIPAA, Compliant DOB: 03-25-1945 (60 yr) ID#: xxx-xx-0000 Sex: M Tel: xxx-xxx-xxxx SPECIMEN Your No:WS05-xxxx Case No:C05-00xxx Req. No:Txxxxx Collected: 06-08-05, PM Sent: 06-09-05, PM Received:

More information

Extramedullary precursor T-lymphoblastic transformation of CML at presentation

Extramedullary precursor T-lymphoblastic transformation of CML at presentation Extramedullary precursor T-lymphoblastic transformation of CML at presentation Neerja Vajpayee, Constance Stein, Bernard Poeisz & Robert E. Hutchison Clinical History 30 year old man presented to the emergency

More information

Chapter 06 Lecture Outline. See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes.

Chapter 06 Lecture Outline. See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes. Chapter 06 Lecture Outline See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes. Copyright 2016 McGraw-Hill Education. 2012 Pearson Permission Education,

More information

WBCs Disorders. Dr. Nabila Hamdi MD, PhD

WBCs Disorders. Dr. Nabila Hamdi MD, PhD WBCs Disorders Dr. Nabila Hamdi MD, PhD ILOs Compare and contrast ALL, AML, CLL, CML in terms of age distribution, cytogenetics, morphology, immunophenotyping, laboratory diagnosis clinical features and

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

HEMATOLOGIC MORPHOLOGY- AECOM HEMATOLOGY COURSE

HEMATOLOGIC MORPHOLOGY- AECOM HEMATOLOGY COURSE Log Out Help current login :lcytryn@montefiore.org HEMATOLOGIC MORPHOLOGY- AECOM HEMATOLOGY COURSE Lawrence Cytryn, M.D. - Course Director 1998 Edward Burns, M.D. Images used by permission within AECOM

More information

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the

More information

Participants Identification No. % Evaluation. Mitotic figure Educational Erythrocyte precursor, abnormal/

Participants Identification No. % Evaluation. Mitotic figure Educational Erythrocyte precursor, abnormal/ Cell Identification BMD-09 Participants Identification No. % Evaluation Mitotic figure 233 96.7 Educational Erythrocyte precursor, abnormal/ 4 1.7 Educational dysplastic nuclear features Erythrocyte precursor

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

FLOW CYTOMETRIC ANALYSIS OF NORMAL BONE MARROW

FLOW CYTOMETRIC ANALYSIS OF NORMAL BONE MARROW XI International Conference Hematopoiesis Immunology Budapest, June 6-7, 2014 FLO CYTOMETRIC ANALYSIS OF NORMAL BONE MARRO Bruno Brando and Arianna Gatti Hematology Laboratory and Transfusion Center Legnano

More information

Cycle 1-6 (28 Days) Days 15&16 1&2 8. (±2 Days) (±2 Days) (±7 Days) (+7 days) X X X X X X X

Cycle 1-6 (28 Days) Days 15&16 1&2 8. (±2 Days) (±2 Days) (±7 Days) (+7 days) X X X X X X X Table 5 Schedule of Assessments A Cycles A-D and Cycles 1-6 (AZD4573 Monotherapy) Assessment Screen a Intra-subject Dose Escalation/ramp -up (Cycles a-d Cycle=14 days) z Days 1, 2, 15 & 16 Visits 1&2 8

More information

CLL13 trial of the GCLLSG/ The GAIA Trial Page 23 of 113 IV. Baseline assessments at screening (for all patients)

CLL13 trial of the GCLLSG/ The GAIA Trial Page 23 of 113 IV. Baseline assessments at screening (for all patients) CLL13 trial of the GCLLSG/ The GAIA Trial Page 23 of 113 IV. Baseline assessments at screening (for all patients) Informed consent Inclusion-/Exclusion Criteria CIRS Score /Medical history ECOG /Disease-related

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550

More information

Leukemia and Myelodysplastic Syndromes

Leukemia and Myelodysplastic Syndromes Leukemia and Myelodysplastic Syndromes Lenise Taylor, RN, MN, AOCNS Heme Malignancies/BMT CNS Seattle Cancer Care Alliance/UWMC Lymphoid 1 Myeloid 2 Presenting Signs and Symptoms Diagnostic Evaluation

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

Leukemia and Myelodysplastic Syndromes

Leukemia and Myelodysplastic Syndromes Leukemia and Myelodysplastic Syndromes Lenise Taylor, RN, MN, AOCNS, BMTCN Oncology CNS Seattle Cancer Care Alliance/UWMC ltaylor@seattlecca.org Lymphoid 1 Myeloid 2 Diagnostic Evaluation of Blood Disorders

More information

SWOG ONCOLOGY RESEARCH PROFESSIONAL (ORP) MANUAL LEUKEMIA FORMS CHAPTER 16A REVISED: DECEMBER 2017

SWOG ONCOLOGY RESEARCH PROFESSIONAL (ORP) MANUAL LEUKEMIA FORMS CHAPTER 16A REVISED: DECEMBER 2017 LEUKEMIA FORMS The guidelines and figures below are specific to Leukemia studies. The information in this manual does NOT represent a complete set of required forms for any leukemia study. Please refer

More information

Hematology Unit Lab 2 Review Material

Hematology Unit Lab 2 Review Material Objectives Hematology Unit Lab 2 Review Material - 2018 Laboratory Instructors: 1. Assist students during lab session Students: 1. Review the introductory material 2. Study the case histories provided

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

screening procedures Disease resistant to full-dose imatinib ( 600 mg/day) or intolerant to any dose of imatinib

screening procedures Disease resistant to full-dose imatinib ( 600 mg/day) or intolerant to any dose of imatinib Table S1. Study inclusion and exclusion criteria Inclusion criteria Aged 18 years Signed and dated informed consent form prior to protocol-specific screening procedures Cytogenetic- or PCR-based diagnosis

More information

Bone Marrow Pathology. Part 1. R.S. Riley, M.D., Ph.D.

Bone Marrow Pathology. Part 1. R.S. Riley, M.D., Ph.D. Bone Marrow Pathology Part 1 R.S. Riley, M.D., Ph.D. Bone Marrow Pathology Bone marrow basics Red cell diseases White cell diseases Other diseases Bone Marrow Pathology Bone marrow basics Hematopoiesis

More information

BLOOD. Dr. Vedat Evren

BLOOD. Dr. Vedat Evren BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body

More information

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter

A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL

More information

H.6.G.2 Non-MAC Studies

H.6.G.2 Non-MAC Studies Page 63 H.6.G.2 Non-MAC Studies H.6.G.2.A Non-MAC Studies at the 600 mg dose A 600 mg dose of azithromycin was given in two non-mac studies (354/354A and 167). Please note: Study 354/354A enrolled a mixture

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Multiple Myeloma 101: Understanding Your Labs

Multiple Myeloma 101: Understanding Your Labs Multiple Myeloma 101: Understanding Your Labs Tim Wassenaar MD MS Hematologist, Director of Clinical Trials UW Cancer Center at ProHealth Care None Disclosures Outline Define hematopoiesis WBCs, RBCs,

More information

Leukocyte Disorders. Dr Alauldeen Mudhafar Zubair

Leukocyte Disorders. Dr Alauldeen Mudhafar Zubair Leukocyte Disorders Dr Alauldeen Mudhafar Zubair Composition of blood Specialized connective tissue Blood cells (formed elements) suspended in plasma Blood volume: 5-6 liters (approx 1.5 gal) in males

More information