Effect of 12 Weeks of Strenuous Physical Training on Hematological Changes

Size: px
Start display at page:

Download "Effect of 12 Weeks of Strenuous Physical Training on Hematological Changes"

Transcription

1 MILITARY MEDICINE, 170, 7:590, 2005 Effect of 12 Weeks of Strenuous Physical Training on Hematological Changes Guarantor: LTC Satoshi Fujitsuka, MC GSDF Contributors: LTC Yuji Koike, MC GSDF* ; CPT Atsushi Isozaki, MC GSDF*; CPT Yozo Nomura, MC GSDF*; LTC Satoshi Fujitsuka, MC GSDF* It is well known that sports and physical exercise affect the hemoglobin (Hb) concentrations; however, the factors affecting the hematological changes after intense exercise are still not fully elucidated. In the present study, we examined the hematological and biochemical parameters of nine young male soldiers participating in a 12-week ranger training program. The platelet counts before the training showed a strong inverse correlation with the Hb concentrations after the training (r , p 0.01). Furthermore, the Hb concentrations of the subjects whose platelet counts were more than / L decreased significantly after the training (p 0.05). Our findings suggest that an association exists between high platelet counts even within the normal range before strenuous physical training and the risk of a subsequent decrease in the Hb concentrations. Introduction he impact of various sports and type of exercise on the T physiology of humans has been well discussed. It is well known that biochemical parameters such as creatine kinase (CK), lactate dehydrogenase (LD), and aspartate aminotransferase (AST) increase after intensive exercise. 1,2 These findings suggest that intensive exercise causes skeletal but not myocardial muscle damage. 3 In addition, hepatic damage 4 and hyponatremia 2 to some extent have also been reported to be caused by physical exercise. Furthermore, strenuous exercise is reported to affect immune functions, 5 including the immunoglobulin production ability 6 or T cell function. 7,8 Consistent with these findings, athletes or soldiers who participate in rigorous physical training sometimes tend to easily come down with viral infections, such as the common cold and herpes simplex infection. 8 Hematological changes such as decreases in the hemoglobin (Hb) concentrations and red blood cell (RBC) counts are often found to result from participation in impact sports, 9,10 intensive physical exercise, 11 and strenuous military training. 12 Recently, long-term sports anemia in Special Forces trainees was also reported. 13 These changes are suggested to be mainly caused by an iron deficiency, and a negative iron balance can thus be caused by intense physical exercise, 14 especially in women. 15 In addition, an increased gastrointestinal blood loss, 15 hematuria, 16 and intravascular hemolysis 17,18 are known to be caused by intensive exercise. In the present study, we examined the effects of a 12-week *Department of Pediatrics, Self-Defense Forces Central Hospital, Ikejiri, Setagaya, Tokyo, , Japan. Surgeon of the 4th Division, Ground Self-Defense Force, 5-12 Yamatomachi, Kasuga, , Japan. This manuscript was received for review in November The revised manuscript was accepted for publication in June Reprint & Copyright by Association of Military Surgeons of U.S., ranger training program, including 7 weeks of basic training and 5 weeks of field training on the hematological and biochemical changes in young soldiers, and also evaluated the relationship between the hematological parameters as well as the biochemical parameters in the subjects before and after undergoing this strenuous training program. Methods Subjects Nine subjects were selected who were healthy, well-trained male soldiers in the Japan Ground-Self Defense Force with an average age of years (range, years). Although six of the nine of the subjects had been smokers, all quit smoking during the training program. They did not take any medications or supplements. Their body weight was measured with a digital scale before and after the ranger training; however, no significant changes were observed before and after the training ( kg before vs kg after). Ranger Training The subjects participated in 7 weeks of basic ranger training followed by a subsequent 5 weeks of field training. The basic training mainly consisted of an enhancement of physical fitness, running and road marches with and without carrying loads. The field training consisted of continuous training in field areas for 1 to 4 days nine times during this program as Kosano et al. 3 described previously. For instance, the trainees moved approximately 50 km through a secluded place among the mountains, carrying 30 to 40 kg of equipment. Sleep was limited to about 3 hours and meals to approximately 600 kcal/day each. All subjects were examined by a physician at least three times (before, during, and after the ranger training course). Peripheral Blood Samples and Analysis Peripheral blood samples were obtained from the subjects before, during (at the completion of basic training and before the field training), and after the training. All samples were obtained at 7 a.m. before breakfast from the cubital vein. Informed consent was obtained from all subjects. The white blood cell (WBC) counts, RBC counts, Hb concentrations, mean corpuscular volume (MCV), and platelet counts in the blood samples were analyzed by an automated hematology analyzer (SE-9000, Sysmex, Kobe, Japan). To analyze the biochemical parameters, including AST, LD, CK, blood urea nitrogen (BUN), total protein (TP), albumin (Alb), total cholesterol (TC) and triglyceride (TG), the blood samples were allowed to clot at room temperature for 30 to 40 minutes and were centrifuged. Next the parameters in the sera were analyzed by a clinical chemistry analyzer (AU-800, Olympus, Tokyo, Japan). There was no evidence of hemolysis in any of the samples. 590

2 Effect of Physical Training on Hematological Changes Statistical Analysis A statistical analysis was performed using the StatView program (version 4.5) for Windows (Abacus Concepts, Berkeley, California). All data are expressed as the mean SD. The Mann- Whitney U test was used to compare any intergroup differences and the Wilcoxon s signed rank test was used to compare any differences between paired parameters. Spearman s rank correlation was used to examine the relationship between various parameters and the p value was examined by Fisher s Z exchange. Differences were considered to be significant when p Results Changes in the Hematological Parameters before and after the Training Program The Hb concentrations and RBC counts decreased g/dl to g/dl ( 12.2%) and / L to / L ( 11.6%), respectively, after the training program (p 0.01, Fig. 1). On the other hand, the platelet counts and MCV increased / L to / L and fl to fl, respectively, after the training program (p 0.01, Fig. 1). The WBC counts did not change significantly (6,044 1,699/ L before vs. 7,000 2,070/ L after). Changes in the Biochemical Parameters before and after the Training Program The levels of AST, LD, BUN, and TC increased after the training (p 0.01, Figs. 2 and 3). Although we did not analyze CK in the blood samples before the training, the CK levels also increased after the training (p 0.05, Fig. 2). The levels of TP and Alb decreased (p 0.01, Fig. 3); however, the TG levels did not change after the training (Fig. 3). 591 Factors before the Training Program Associated with the Subsequent Decrease in the Hb Concentrations or RBC Counts We examined the factors before the training in association with a decrease in either the Hb concentrations or RBC counts. Interestingly, among the parameters examined before the training, only the platelet counts showed a strong inverse correlation with the Hb concentrations during and after the training (r and 0.829, respectively, p 0.01 Fig. 4, A and B). Although the platelet counts before the training did not correlate with the RBC counts during the training (Fig. 4C), the platelet counts before the training also correlated with the RBC counts after the training (r 0.719, p 0.01, Fig. 4D). Effect of the Decrease in the Hb Concentrations on the Platelet Counts In addition to the above findings, to clarify the effect of the decrease in the Hb concentrations on the platelet counts before, during, and after the training, we divided the subjects into two groups according to their Hb concentrations after the training. One group consisted of three subjects with Hb concentrations of 14.0 g/dl after the training (Hi Hbs) and the other group consisted of six subjects with Hb concentrations 14.0 g/dl after the training (Lo Hbs). Accordingly, although the platelet counts in Hi Hbs did not change any more, the platelet counts in Lo Hbs increased significantly after the training (p 0.05, Fig. 5A). Furthermore, there were significant differences in the platelet counts between Hi Hbs and Lo Hbs, even before the training (p 0.05, Fig. 5A). However, no differences were observed between the groups regarding the Hb concentrations or RBC counts before the training (data not shown). Fig. 1. Hematological changes before, during, and after ranger training. Values are the mean SD from nine subjects. Hb, the normal range is g/dl; RBC, the normal range is / L; MCV, the normal range is fl; and Plt, the normal range is / L., p 0.01;, p 0.05.

3 592 Effect of Physical Training on Hematological Changes Fig. 2. Biochemical changes before, during, and after ranger training (1). Values are the mean SD from nine subjects. AST, the normal range is IU/L; LD, the normal range is IU/L; CK, the normal range is IU/L; and BUN, the normal range is 8 20 mg/dl., p 0.01;, p Fig. 3. Biochemical changes before, during, and after ranger training (2). Values are the mean SD from nine subjects. TP, the normal range is g/dl; Alb, the normal range is g/dl; TC, the normal range is mg/dl; and TG, the normal range is mg/dl., p 0.01;, p The Platelet Counts before the Training and the Decrease in the Hb Concentrations To further clarify the relationship between the platelet counts before the training and the subsequent decrease in the Hb concentrations, we also divided the subjects into two groups according to the platelet counts before the training. One group consisted of four subjects with platelet counts of / L before the training (Hi Plts) and the other group consisted of five subjects with the platelet counts / L before the training (Lo Plts). The Hb concentrations of the Hi Plts decreased significantly after the training (p 0.05, Fig. 5B), and significant differences were observed in the Hb concentrations during and after the training between the Hi Plts and Lo Plts (p 0.05, Fig. 5B). Fig. 4. Relationships between the platelet counts before ranger training and the hematological parameters during and after such training. The platelet counts inversely correlated strongly with the Hb concentrations during training (A), after training (B), and the RBC counts after training (D) but not during training (C). The data are based on the findings from nine subjects. Hb, the normal range is g/dl; and RBC, the normal range is / L. Discussion Either anemia or a decrease in the Hb concentrations is often observed in healthy individuals after various intensities of sports and physical exercise. 11,15 It is speculated that a negative iron balance is the main cause of hematological changes; however, the factors related to the pathophysiology before participating in physical exercise have not yet been fully elucidated. As far as we know, the present study is the first to demonstrate an association between the platelet counts before participating in a prolonged strenuous training program and the risk of a decrease in the Hb concentrations due to such exercise. One of the important causes of anemia or a decrease in the Hb concentrations due to physical exercise is iron deficiency. The

4 Effect of Physical Training on Hematological Changes 593 Fig. 5. Effects of both the decrease of Hb concentrations on the platelet counts and the high platelet counts before ranger training on the Hb concentrations. The platelet counts in the group (n 6) with the Hb concentrations 14.0 g/dl after training increased significantly (A). On the other hand, the Hb concentrations in the group (n 4) with platelet counts of / L before training decreased significantly (B). Values are the mean SD. Hb, the normal range is g/dl; and Plt, the normal range is / L., p cause of the iron deficiency is considered to be that exercise itself often leads to a negative iron balance. 15 Heme iron is an important dietary source of iron because it is more effectively absorbed than non-heme iron. 19 Therefore, it is well known that vegetarians, especially female athletes are at a relatively greater risk for iron deficiency attributable to physical exercise. 14 In addition to the iron deficiency, intravascular hemolysis 17 during exercise with intensive footstriking, 18 increased the gastrointestinal blood loss, 15 and hematuria 17 can occur during or after strenuous exercise and thus can also play important roles in a decrease in the Hb concentrations. In general, the elevation of AST, CK, and LD after intense physical training indicates skeletal muscle damage. 1,3 The elevation of LD is caused by hemolysis 20 as well. We did not examine the isoenzyme levels of LD in the subjects; the levels of LD after the training in Lo Hbs tend to be higher than those in Hi Hbs ( IU/L vs IU/L). This may be partly caused by the intravascular hemolysis during the training. 20 Although we did not estimate the ferokinetics of the subjects, the MCV did not decrease after the 12- week training program even in Lo Hbs. We speculate that in addition to the progression of iron deficiency, intravascular hemolysis is also considered to play an important role in the decrease in the Hb concentrations during and after prolonged strenuous exercise. Another effect of long-term strenuous exercise on hematological changes is an increase in the platelet counts. 10,11,21 One of the causes of the increased platelet counts after exercise is speculated to be a fresh release of platelets from the spleen, bone marrow, and lungs. 21 We herein showed that the platelet counts increased in Lo Hbs but not in Hi Hbs during and after the ranger training. Anemia is known to cause reactive thrombocytosis and increased levels of erythropoietin attributable to anemia may possibly stimulate the thrombopoiesis of bone marrow. 22,23 Interestingly, the platelet counts in patients with iron deficiency anemia whose platelet counts are / L as well as / L were reported to decrease after iron replacement therapy. 22 Therefore, our findings suggest that reactive thrombocytosis (although within the normal range) associated with the decline of the Hb concentrations is one of the major causes of the increase in the platelet counts after prolonged strenuous exercise. A circadian rhythm of the platelet counts has been reported in healthy individuals 24 and thus platelet counts are considered to be fundamentally stable in healthy individuals if obtained at the same time of day. Griesshammer et al. 25 reported that an elevated platelet count of / L on routine examination was considered to have diagnostic, prognostic, and therapeutic implications regarding tissue damage, infection, malignancy, and chronic inflammation; however, there have so far been few reports concerning platelet counts within the normal range in association with a pathophysiology of diseases. Thaulow et al. 26 demonstrated that the annual coronary heart disease and total mortality increased with increasing platelet counts within the normal range in healthy middle-aged men who were followed up for 13.5 years. They concluded that the platelet counts were a strong and independent predictor of coronary heart disease mortality. 26 We found platelet counts of / L, even when within the normal range, before the training, to be correlated with a subsequent decrease of Hb concentrations after the training. We speculate that high platelet counts before the training also represent reactive thrombocytosis within the normal range before the training. This phenomenon may have been caused by a subclinical iron deficiency or hemolysis (e.g., due to occult vascular damage) without any overt anemia in Hi Plts before participating in the training. This is a possible explanation as to why there was no significant difference in Hb concentrations before the training between Hi Plts and Lo Plts. Furthermore, along with progression of the pathophysiology, as described above, due to the strenuous exercise, it seems that the decrease in the Hb concentrations became more obvious in the Hi Plts than in the Lo Plts. In conclusion, our findings suggest that an association exists between platelet counts of / L before strenuous physical training and the risk of a subsequent decrease in the Hb concentrations. Kehat et al. 13 recommend a complete anemia workup when below normal hematological indices are found when participating in prolonged strenuous training. Although further studies are needed to establish the association because our study population was small, we also propose that serial hematological monitoring may thus be desirable for those with high platelet counts before such training, even if they are still within the normal range. References 1. Miles MP, Naukam RJ, Hackney AC, Clarkson PM: Blood leukocyte and glutamine fluctuations after eccentric exercise. Int J Sports Med 1999; 20: Warburton DE, Welsh RC, Haykowsky MJ, Taylor DA, Humen DP: Biochemical

5 594 Effect of Physical Training on Hematological Changes changes as a result of prolonged strenuous exercise. Br J Sports Med 2002; 36: Kosano H, Kinoshita T, Nagata N, Takatani O, Isobe M, Yazaki Y: Change in concentrations of myogenic components of serum during 93 h of strenuous physical exercise. Clin Chem 1986; 32: Fallon KE, Sivyer G, Sivyer K, Dare A: The acute phase response and exercise: court and field sports. Br J Sports Med 2001; 35: Fitzgerald L: Exercise and the immune system. Immunol Today 1988; 9: Boyum A, Wiik P, Gustavsson E, et al: The effect of strenuous exercise, calorie deficiency and sleep deprivation on white blood cells, plasma immunoglobulins and cytokines. Scand J Immunol 1996; 43: Kramer TR, Moore RJ, Shippee RL, et al: Effects of food restriction in military training on T-lymphocyte responses. Int J Sports Med 1997; 18(Suppl 1): S Imai T, Seki S, Dobashi H, Ohkawa T, Habu Y, Hiraide H: Effect of weight loss on T-cell receptor-mediated T-cell function in elite athletes. Med Sci Sports Exerc 2002; 34: Brigham DE, Beard JL, Krimmel R, Kenny WL: Changes in iron status during competitive season in female collegiate swimmers. Nutrition 1993; 9: Davidson RJ, Robertson JD, Galea G, Maughan RJ: Hematological changes associated with marathon running. Int J Sports Med 1987; 8: El-Sayed MS: Effects of exercise on blood coagulation, fibrinolysis and platelet aggregation. Sports Med 1996; 22: Radomski MW, Sabiston BH, Isoard P: Development of sports anemia in physically fit men after daily sustained submaximal exercise. Aviat Space Environ Med 1980; 51: Kehat I, Shupak A, Goldenberg I, Shoshani O: Long-term hematological effects in Special Forces trainees. Milit Med 2003; 168: Magazanik A, Weinstein Y, Dlin RA, Derin M, Schwartzman S, Allalouf D: Iron deficiency caused by 7 weeks of intensive physical exercise. Eur J Appl Physiol Occup Physiol 1988; 57: Beard J, Tobin B: Iron status and exercise. Am J Clin Nutr 2000; 72: Siegel AJ, Hennekens CH, Solomon HS, Van Boeckel BV: Exercise-related hematuria: findings in a group of marathon runners. JAMA 1979; 241: Deitrick RW: Intravascular haemolysis in the recreational runner. Br J Sports Med 1991; 25: Dressendorfer RH, Wade CE, Frederick EC: Effect of shoe cushioning on the development of reticulocytosis in distance runners. Am J Sports Med 1992; 20: Carpenter CE, Mahoney AW: Contributions of heme and nonheme iron to human nutrition. Crit Rev Food Sci Nutr 1992; 31: Burns ER, Kale A, Murthy VV: Diagnosis of the hemolytic state using serum levels of erythrocyte adenylate kinase. Am J Hematol 2000; 64: El-Sayed MS, Sale C, Jones PG, Chester M: Blood hemostasis in exercise and training. Med Sci Sports Exerc 2000; 32: Akan H, Guven N, Aydogdu I, Arat M, Beksac M, Dalva K: Thrombopoietic cytokines in patients with iron deficiency anemia with or without thrombocytosis. Acta Haematol 2000; 103: Ishibashi T, Kaziol JA, Burstein SA: Human recombinant erythropoietin promotes differentiation of murine megakaryocytes in vitro. J Clin Invest 1987; 79: Bremner WF, Sothern RB, Kanabrocki EL, et al: Relation between circadian patterns in levels of circulating lipoprotein(a), fibrinogen, platelets, and related lipid variables in men. Am Heart J 2000; 139: Griesshammer M, Bangerter M, Sauer T, Wennauer R, Bergmann L, Heimpel H: Aetiology and clinical significance of thrombocytosis: analysis of 732 patients with an elevated platelet count. J Intern Med 1999; 245: Thaulow E, Erikssen J, Sandvik L, Stormorken H, Cohn PF: Blood platelet count and function are related to total and cardiovascular death in apparently healthy men. Circulation 1991; 84:

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Red blood cell variables in highly trained pubescent athletes: a comparative analysis

Red blood cell variables in highly trained pubescent athletes: a comparative analysis 200 Department of Physiology, Faculty of Medicine, Higher Medical Institute, 15-a, V Aprilov Blvd, 4000 Plovdiv, Bulgaria N Boyadjiev Department of Clinical Laboratory, Faculty of Medicine, Higher Medical

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1

Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary

More information

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine

Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Exp. Anim. 57(2), 139 143, 2008 Note Clinical Pathology Data from Cynomolgus Monkeys from China in which Diarrhea Was Observed during Quarantine Yan-Wei LIU 1, 2), Syusaku SUZUKI 1), Masatoshi KASHIMA

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Chapter 19. Openstax: Chapter 18. Blood

Chapter 19. Openstax: Chapter 18. Blood Chapter 19 Blood Openstax: Chapter 18 Chapter 19 Learning Outcomes After completing Chapter 19, you will be able to: 1. Describe the components and major functions of blood and list the physical characteristics

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

The Effects of Physical Exercise on Soluble Transferrin Receptor and other Indicators of Iron Status in Female Taekwondoist

The Effects of Physical Exercise on Soluble Transferrin Receptor and other Indicators of Iron Status in Female Taekwondoist ISSN 1750-9823 (print) International Journal of Sports Science and Engineering Vol. 01 (2007) No. 03, pp. 189-194 The Effects of Physical Exercise on Soluble Transferrin Receptor and other Indicators of

More information

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.

Collect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge. Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,

More information

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters

The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological Parameters International Archives of Medical Research Volume 9, No. 1, pp.15-23 2017. ORIGINAL RESEARCH The Effects of Competition Performance in Elite Male Football Players on Selected Biochemical and Hematological

More information

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS

Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

BLOOD. Dr. Vedat Evren

BLOOD. Dr. Vedat Evren BLOOD Dr. Vedat Evren Blood Liquid suspension of formed elements Blood = Blood cells + plasma Plasma = Coagulation factors + serum Cells = Erythrocytes + Leukocytes + Thrombocytes 8 % of the total body

More information

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore

HAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia

More information

Multiphasic Blood Analysis

Multiphasic Blood Analysis Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary

More information

Changes in Blood Biomarkers Across a Competitive Season in Collegiate Athletes Residing at a Moderate Altitude: a Retrospective Analysis

Changes in Blood Biomarkers Across a Competitive Season in Collegiate Athletes Residing at a Moderate Altitude: a Retrospective Analysis University of Colorado, Boulder CU Scholar Integrative Physiology Graduate Theses & Dissertations Integrative Physiology Spring 1-1-2017 Changes in Blood Biomarkers Across a Competitive Season in Collegiate

More information

The Cardiovascular System: Blood

The Cardiovascular System: Blood C h a p t e r 11 The Cardiovascular System: Blood PowerPoint Lecture Slides prepared by Jason LaPres Lone Star College - North Harris Introduction to the Cardiovascular System A circulating transport system

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

BIOCHEMISTRY of BLOOD

BIOCHEMISTRY of BLOOD BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women

E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women 442 Nippon Shokuhin Kagaku Kogaku Kaishi Vol. /., No.+*,..,..0 (,**1) 18 E#ect of Iron Solubilized by Lactoferrin on Iron Status in Adult Women Mutsumi Motouri, Ran Emilie Yoshise, Hiroaki Matsuyama, Tomohiro

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Diagnostic Approach to Patients with Anemia

Diagnostic Approach to Patients with Anemia J KMA Special Issue Diagnostic Approach to Patients with Anemia Seonyang Park, MD Department of Internal Medicine, Seoul National University College of Medicine E mail : seonpark@snu.ac.kr J Korean Med

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Chapter 06 Lecture Outline. See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes.

Chapter 06 Lecture Outline. See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes. Chapter 06 Lecture Outline See separate PowerPoint slides for all figures and tables preinserted into PowerPoint without notes. Copyright 2016 McGraw-Hill Education. 2012 Pearson Permission Education,

More information

CTAD as a universal anticoagulant

CTAD as a universal anticoagulant Automated Methods & Management in Chemistry Vol. 25, No. 1 (January February 2003) pp. 17 20 CTAD as a universal anticoagulant M. Yokota, N. Tatsumi*, I. Tsuda, T. Nishioka and T. Takubo Department of

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

Gamma-Glutamyl Transpeptidase and Other Liver Function Tests in Myocardial Infarction and Heart Failure

Gamma-Glutamyl Transpeptidase and Other Liver Function Tests in Myocardial Infarction and Heart Failure Gamma-Glutamyl Transpeptidase and Other Liver Function Tests in Myocardial Infarction and Heart Failure M. G. BETRO, M.B., CH.B., F.R.C.P.A., R. C. S. OON, B.SC, AND J. B. EDWARDS, PH.D. Division of Clinical

More information

During the past two decades,

During the past two decades, Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers

Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90

More information

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800)

CLIA APPROVED PROFICIENCY TESTING PROGRAMS ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts (800) ACCUTEST, INC. P.O. Box 999 Westford, Massachusetts 01886 (800) 665-2575 MICROBIOLOGY Bacteriology Aerobic Culture and Identification Antibiotic Susceptibility Testing Direct Antigen Detection Gram Stain

More information

Reactive thrombocytosis in children

Reactive thrombocytosis in children The Turkish Journal of Pediatrics 2013; 55: 411-416 Original Reactive thrombocytosis in children Celal Özcan 1, Tülin Revide Şaylı 2, Vildan Koşan-Çulha 2 2 Division of Pediatric Hematology, 1 Department

More information

Omar Alnairat. Tamer Barakat. Bahaa Abdelrahim. Dr.Nafez

Omar Alnairat. Tamer Barakat. Bahaa Abdelrahim. Dr.Nafez 1 Omar Alnairat Tamer Barakat Bahaa Abdelrahim Dr.Nafez It s the chemistry inside living cells. What is biochemistry? Biochemistry consists of the structure and function of macromolecules (in the previous

More information

C18 The Circulatory System / MC3. What is the difference between the cardiovascular. What are the formed elements? Include subcategories:

C18 The Circulatory System / MC3. What is the difference between the cardiovascular. What are the formed elements? Include subcategories: C18 The Circulatory System / MC3 What is the difference between the cardiovascular and circulatory system? What are the formed elements? Include subcategories: What are the three primary functions of the

More information

Customer Information Literature List Platelets

Customer Information Literature List Platelets Customer Information Literature List Platelets Date: August 2015 Subject: Literature List Platelets Issued by: Scientific Customer Services Number: 150803 Note: Whether references are given in British

More information

Approach to a pale child

Approach to a pale child Approach to a pale child Dr. Dafalla Ahmed Babiker Jazan university objectives Definition of anemia Classification and causes Important points in history and physical examination Investigations. Definition

More information

Resistance Exercise Increases the Capacity of Heme Biosynthesis More Than Aerobic Exercise in Rats

Resistance Exercise Increases the Capacity of Heme Biosynthesis More Than Aerobic Exercise in Rats J. Clin. Biochem. Nutr., 29, 19-27, 2000 Resistance Exercise Increases the Capacity of Heme Biosynthesis More Than Aerobic Exercise in Rats Tatsuhiro MATSUO,1,* Hiroo SUZUKI,1 and Masashige SUZUKI2 Faculty

More information

Use of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia

Use of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia Use of the XE-21 in a Patient with Cold Auto-immune Hemolytic Anemia Gudrun STAMMINGER and Lothar BEIER Klinikum Chemnitz ggmbh, Institut für Laboratoriumsmedizin, Flemmingstraße 2, Chemnitz, Germany.

More information

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone

Sample received from: Botali International Enterprise Co., Ltd Tianjin Port Free Trade Zone Nutrition and Foods Safety Agency of the Centre for Disease Prevention and Control, People s Republic of China Xi Yuan Hospital of China Academy of Traditional Chinese Medicine Testing Report Sample processing

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

OVERTRAINING IN EXTREME ENDURANCE SPORTS

OVERTRAINING IN EXTREME ENDURANCE SPORTS OVERTRAINING IN EXTREME ENDURANCE SPORTS Iñigo San Millán, PhD Assistant Professor of Family Medicine and Sports Medicine Depts. Director, Exercise Physiology and Human Performance Laboratory Anschutz

More information

Nutrition and immune system in exercise: a 2017 consensus statement

Nutrition and immune system in exercise: a 2017 consensus statement NIHR Southampton Biomedical Research Centre in nutrition Nutrition and immune system in exercise: a 2017 consensus statement Philip Calder Professor of Nutritional Immunology University of Southampton

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

Chapter 11. Lecture and Animation Outline

Chapter 11. Lecture and Animation Outline Chapter 11 Lecture and Animation Outline To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off. Please Note: Once you have

More information

Brief Communication: Association of Serum Insulin-Like Growth Factor-I and Erythropoiesis in Relation to Body Iron Status

Brief Communication: Association of Serum Insulin-Like Growth Factor-I and Erythropoiesis in Relation to Body Iron Status 324 Annals of Clinical & Laboratory Science, vol. 34, no. 3, 2004 Brief Communication: Association of Serum Insulin-Like Growth Factor-I and Erythropoiesis in Relation to Body Iron Status Jong Weon Choi

More information

Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit

Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit Blood Lecture Outline : Fluid Connective Tissue Part I of the Cardiovascular Unit General Characteristics: Extracellular matrix ph Volume Functions of the blood: 1. Transport 2. Regulation 3. Protection

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Clinical enzymology. University of Babylon College of pharmacy Second semester - biochemistry 3 rd class By Dr. Abdulhussien M. K.

Clinical enzymology. University of Babylon College of pharmacy Second semester - biochemistry 3 rd class By Dr. Abdulhussien M. K. Clinical enzymology University of Babylon College of pharmacy Second semester - biochemistry 3 rd class 2014 2015 By Dr. Abdulhussien M. K. Aljebory Enzyme activity Enzyme assays usually depend on the

More information

Frequency of ABO Blood Group and Decreased Level of Hemoglobin in Lung Cancer Patients

Frequency of ABO Blood Group and Decreased Level of Hemoglobin in Lung Cancer Patients Year: 2014; Volume: 1; Issue: 1 Article ID: CR14 02; Pages: 1-6 Advances in Cancer Research & Therapy Research Article Frequency of ABO Blood Group and Decreased Level of Hemoglobin in Lung Cancer Patients

More information

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly

More information

BIOL 2458 CHAPTER 19 Part 1 SI 1. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found?

BIOL 2458 CHAPTER 19 Part 1 SI 1. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found? BIOL 2458 CHAPTER 19 Part 1 SI 1 1. Extracellular fluid makes up of the body fluids. List the types of extracellular fluids. 2. Intracellular fluid makes up of the body fluids. Where is it found? 3. In

More information

Agenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions

Agenda. Components of blood. Blood is Fluid Connective Tissue. Blood: General functions Agenda Chapter 19: Blood Major functions Major Components Structure of RBCs and WBCs ABO Blood Types, and Rh Factor Lab 34.1 and Blood Typing Blood: General functions Transport of dissolved gases, nutrients,

More information

Brief Communication: Sensitivity, Specificity, and Predictive Value of Serum Soluble Transferrin Receptor at Different Stages of Iron Deficiency

Brief Communication: Sensitivity, Specificity, and Predictive Value of Serum Soluble Transferrin Receptor at Different Stages of Iron Deficiency Available online at www.annclinlabsci.org Annals of Clinical & Laboratory Science, vol. 35, no. 4, 2005 435 Brief Communication: Sensitivity, Specificity, and Predictive Value of Serum Soluble Transferrin

More information

Chapter 13 The Blood

Chapter 13 The Blood Chapter 13 The Blood Copyright 2015 Wolters Kluwer Health Lippincott Williams & Wilkins Overview Key Terms agglutination erythrocyte lymphocyte albumin fibrin megakaryocyte anemia hematocrit monocyte antigen

More information

Evidence-Based Hematological Solutions

Evidence-Based Hematological Solutions Evidence-Based Hematological Solutions Beyond the Routine CBC Objectives Describe novel hematology parameters and their derivation. Investigate the evidence for their clinical utility. Discuss how new

More information

Blood Lecture Test Questions Set 2 Summer 2012

Blood Lecture Test Questions Set 2 Summer 2012 Blood Lecture Test Questions Set 2 Summer 2012 1. Leukocytes are attracted to a site of injury or disease by: a. diapedesis b. chemotaxis c. leukocytosis d. heparin e. leukomotosis 2. Leukocytes leave

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Laboratory diagnosis of plasma proteins and plasma enzymes

Laboratory diagnosis of plasma proteins and plasma enzymes Laboratory diagnosis of plasma proteins and plasma enzymes Functions of plasma proteins Function: transport humoral immunity enzymes protease inhibitors maintenance of oncotic pressure buffering Example:

More information

PHLEBOTOMIST. person trained to draw blood from a patient for clinical or medical testing, transfusions, donations, or research.

PHLEBOTOMIST. person trained to draw blood from a patient for clinical or medical testing, transfusions, donations, or research. BLOOD PHLEBOTOMIST person trained to draw blood from a patient for clinical or medical testing, transfusions, donations, or research. Blood transports substances and maintains homeostasis in the body Hematophobia

More information

Blood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume.

Blood. Plasma. The liquid part of blood is called plasma. 1. Pale yellow fluid; forms more than half the blood volume. 11 Blood FOCUS: Blood consists of plasma and formed elements. The plasma is 91% water with dissolved or suspended molecules, including albumin, globulins, and fibrinogen. The formed elements include erythrocytes,

More information

Blood Dr. Ali Ebneshahidi

Blood Dr. Ali Ebneshahidi Blood Dr. Ali Ebneshahidi 1. Transport of substances Functions of Blood O2: blood transports oxygen from the lungs to tissue cells, so that cellular respiration is possible. Co2: blood transports carbon

More information

Hematology. The Study of blood

Hematology. The Study of blood Hematology The Study of blood Average adult = 8-10 pints of blood Composition: PLASMA liquid portion of blood without cellular components Serum plasma after a blood clot is formed Cellular elements are

More information

M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS. Phil Collins. Flea. Robin Williams.

M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS. Phil Collins. Flea. Robin Williams. M. G. Robertson Biology Professor Delta College BLOOD - THE ELIXIR OF LIFE ROBERTSON DOPPELGANGERS Phil Collins Flea Steve Jobs Sting Robin Williams BLOOD COMPONENTS 8% by weight; 4-6 liters by volume

More information

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube

Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Evaluation of VACUETTE CAT Serum Fast Separator Blood Collection Tube for Routine Chemistry Analytes in Comparison to VACUTAINER RST Tube Background: Greiner-Bio-One, Austria has been selling plastic evacuated

More information

ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO

ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CENTRO MARIO DI NEGRI RICERCHE INSTITUTE CLINICHE FOR PHARMACOLOGICAL PER LE MALATTIE RESEARCH RARE CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES

More information

BLOOD & CIRCULATORY SYSTEM. Prepared by Mr.Yeung

BLOOD & CIRCULATORY SYSTEM. Prepared by Mr.Yeung BLOOD & CIRCULATORY SYSTEM Prepared by Mr.Yeung CIRCULATORY SYSTEM Overview Every cell in a living organism must have direct access to its nutrient supply Single celled organisms rely on simple diffusion

More information

Chapter 19(1) An Introduction to the Circulatory System and Blood

Chapter 19(1) An Introduction to the Circulatory System and Blood Chapter 19(1) An Introduction to the Circulatory System and Blood Circulatory System circulatory system = heart, blood vessels and blood cardiovascular system = heart and blood vessels hematology = the

More information

temperature 38 o C (100.4 o F) The temperature of blood is slightly higher than the normal body temperature of 37 o C (98.6 o F).

temperature 38 o C (100.4 o F) The temperature of blood is slightly higher than the normal body temperature of 37 o C (98.6 o F). 1 Chapter 1 Blood Definition -Blood is a type of connective tissue that consists of cells surrounded by a fluid extracellular matrix. -Blood, blood vessels, and the heart collectively form the cardiovascular

More information

aortic thromboembolism : ATE ATE ATE LOGIQ P ATE ECLOS ATE computed tomography fibrin/fibrinogen degradation products : FDP

aortic thromboembolism : ATE ATE ATE LOGIQ P ATE ECLOS ATE computed tomography fibrin/fibrinogen degradation products : FDP h h CT ATE.... Dh AST CK ALT Dh ATE Dh ATE Dh aortic thromboembolism : ATE ATE ATE ATE ATE computed tomography : CT ATE Dh fibrin/fibrinogen degradation products : FDP Dh FDP LOGIQ P GE CT ECLOS.... CT

More information

Variability of Erythropoietin Response to Sleeping at Simulated Altitude: A Cycling Case Study

Variability of Erythropoietin Response to Sleeping at Simulated Altitude: A Cycling Case Study CASE STUDIES International Journal of Sports Physiology and Performance, 2007;2:327-331 2007 Human Kinetics, Inc. Variability of Erythropoietin Response to Sleeping at Simulated Altitude: A Cycling Case

More information

Year 2003 Paper two: Questions supplied by Tricia

Year 2003 Paper two: Questions supplied by Tricia QUESTION 65 A 36-year-old man presents in a post-ictal state after an observed generalised seizure. Full blood investigation shows: haemoglobin 0 g/l [128-175] mean corpuscular volume (MCV) 106 fl [80-7]

More information

Chapter 14. Blood. Blood Volume. Blood Composition. Blood

Chapter 14. Blood. Blood Volume. Blood Composition. Blood Blood connective tissue transports vital substances maintains stability of interstitial fluid distributes heat Chapter 14 Blood Blood Cells form mostly in red bone marrow red blood cells white blood cells

More information

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ

Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist

Hematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White

More information

Rob Johnson, MD, FACSM, CAQ Professor, Department of Family Medicine and Community Health, University of Minnesota Team Physician, University of

Rob Johnson, MD, FACSM, CAQ Professor, Department of Family Medicine and Community Health, University of Minnesota Team Physician, University of Rob Johnson, MD, FACSM, CAQ Professor, Department of Family Medicine and Community Health, University of Minnesota Team Physician, University of Minnesota Athletics Director Emeritus, Sports Medicine Fellowship

More information

B ecause rugby in Japan is played in autumn and winter,

B ecause rugby in Japan is played in autumn and winter, 186 ORIGINAL ARTICLE Effects of exercise on the physical condition of college rugby players during summer training camp T Mashiko, T Umeda, S Nakaji, K Sugawara... See end of article for authors affiliations...

More information

LAB TIME/DATE. 1. most numerous leukocyte. 3. also called an erythrocyte; anucleate formed element. 6. ancestral cell of platelets

LAB TIME/DATE. 1. most numerous leukocyte. 3. also called an erythrocyte; anucleate formed element. 6. ancestral cell of platelets ighapmlre29apg245_250 5/12/04 2:46 PM Page 245 impos03 302:bjighapmL:ighapmLrevshts:layouts: NAME Blood LAB TIME/DATE REVIEW SHEET exercise 29A Composition of Blood 1. What is the blood volume of an average-size

More information

Kathryn Jones 8/11/2015

Kathryn Jones 8/11/2015 1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry

More information

Haematology and Transfusion

Haematology and Transfusion Haematology and Transfusion Prof Dr Wolfram Engelhardt Anaesthesiology and Intensive Care Medicine Offenburg Hospital, Germany dr.w.engelhardt@gmail.com James Blundell 1828 Lancet 1828; 11:321 Erythrocytes

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia

M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia 50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and

More information

New Zealand Blackcurrant: A New Ergogenic Aid in Sport?

New Zealand Blackcurrant: A New Ergogenic Aid in Sport? New Zealand Blackcurrant: A New Ergogenic Aid in Sport? Mark Willems Professor in Exercise Physiology United Kingdom Blackcurrant The Stress Hero Sponsored by Vilnius - June 10-12, 2015 Take home prediction

More information

A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation

A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Showa Univ J Med Sci 26 2, 169 173, June 2014 Case Report A Case of Pneumatosis Cystoides Intestinalis Mimicking Intestinal Perforation Takahiro UMEMOTO 1, Yoshikuni HARADA 1, Makiko SAKATA 1, Gaku KIGAWA

More information

HEMATOPOIESIS. HEMATOLOGY Introduction. Study of blood & its components Window of rest of body. Introduction

HEMATOPOIESIS. HEMATOLOGY Introduction. Study of blood & its components Window of rest of body. Introduction HEMATOLOGY/ HEMATOPOIESIS Introduction HEMATOLOGY Introduction Study of blood & its components Window of rest of body 1 BLOOD Raison d etre Delivery of nutrients Oxygen Food Vitamins Removal of wastes

More information

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Acute haemolysis and appearance of PNH-like clones in patients with vitamin B12 deficiency and iron deficiency after iron dextran administration

Acute haemolysis and appearance of PNH-like clones in patients with vitamin B12 deficiency and iron deficiency after iron dextran administration Acute haemolysis and appearance of PNH-like clones in patients with vitamin B12 deficiency and iron deficiency after iron dextran administration Chun-Liang Lin 1, Chin-Chan Lin 1,Wen-Jyi Lo 2,Yu-Chien

More information

Standard Melatonin Intake and Circadian Rhythms of Elite Athletes after a Transmeridian Flight

Standard Melatonin Intake and Circadian Rhythms of Elite Athletes after a Transmeridian Flight M Nomura, S Kida, J Yamashita The Journal et al. of International Medical Research Endovascular 2000; 28: Embolization 182 186 of Unruptured Vertebral Dissection Standard Melatonin Intake and Circadian

More information

Chapter 19 Blood Lecture Outline

Chapter 19 Blood Lecture Outline Chapter 19 Blood Lecture Outline Cardiovascular system Circulatory system Blood 1. distribution 2. regulation 3. protection Characteristics: ph 7.4 38 C 4-6 L Composition: Plasma Formed elements Erythrocytes

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Approach to the child with anemia. Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital

Approach to the child with anemia. Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital Approach to the child with anemia Nittaya Wisanuyothin,MD. Pediatrics Department, Maharat Nakhonratchasima Hospital Definition of anemia Hb< 2 SD or P2.5 below the mean for a healthy of the same gender

More information

Haematology and Transfusion

Haematology and Transfusion Haematology and Transfusion dr.w.engelhardt@gmail.com Wolfram Engelhardt Offenburg, Germany James Blundell 1828 Diameter 6-8 µm Erythrocytes Women: Men: 4-5 x 10 6 /µl 5-6 x 10 6 /µl live 100-120 days

More information

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert.

PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. PFIZER INC. These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert. GENERIC DRUG NAME / COMPOUND NUMBER: Tofacitinib / CP-690,550

More information