Familial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II)

Size: px
Start display at page:

Download "Familial PAH. Genetics and pulmonary arterial hypertension. PAH and mutations in the bone morphogenetic protein type II receptor (BMPR-II)"

Transcription

1 athology of vascular lesions in idiopathic pulmonary arterial hypertension Genetics and pulmonary arterial hypertension Concentric intimal lesion Nick Morrell British Heart Foundation rofessor of Cardiopulmonary Medicine University of Cambridge School of Clinical Medicine Addenbrooke s and apworth Hospitals Cambridge, UK lexiform lesion CD31 CD31 α-sma α-sma Atkinson et al. Circulation. 22;15: Familial AH Autosomal dominant Reduced gene penetrance Sex bias F>M AH and mutations in the bone morphogenetic protein type II receptor (BMR-II) Heterozygous germline mutations in BMR2,, encoding a TGF-β receptor, cause familial AH mutations detected in ~7% of families (The International H Consortium, Nat. Genetics 2; Deng et al. Am J. Hum. Genetics 2) Unaffected Obligate carrier Affected UK family 4 Association of sporadic AH with BMR2 mutations 15-26% of sporadics have mutations in BMR-II parental transmission and de novo mutation documented (Thomson et al. J. Med. Genet. 2 Newman et al. N. Engl. J. Med. 21) Clinical outcomes of pulmonary arterial hypertension in carriers of BMR2 mutation. Sztrymf et al. Am J Respir Crit Care Med. 28;177: Austin et al. Respiratory Research 29, 1:87

2 BM signaling Bone and cartilage formation BM ligand Clathrin coated pits Cell membrane BMR-II LIMK1 Tctex-1 BMR1A/B/ALK-1 Smad1/5/8 MAK Angiogenesis and vascular differentiation Bone morphogenetic proteins Embryonic mesoderm formation HC HC Smad4 neurogenesis ~2 family members form kda dimers cysteine knot structure Dorso- Ventral patterning Gene expression regulation Transcription Organogenesis kidney lung Tissue specific nature of BM signalling BMR-II Cell-specific responses to BMs depend on the expression profile of BM receptors and ligands Familial pulmonary arterial hypertension BM6 BM2 BM4 BM6 BM4 BM2 BM9/1 GDF5 BMR-IA (ALK3) BMR-IB (ALK6) Juvenile gastrointestinal polyposis Hereditary brachydactyly BMR -II ALK3 BMR -II ALK6 BMR -II ALK1 Upton et al. Mol harmacol. 28;73: David et al Blood. 27;19: BMR-II wild type Ligand binding and cysteine kinase domain mutations Non-cysteine kinase domain mutations Cytoplasmic tail domain mutations Chemical chaperones improve cell surface localization of ER-retained mutant BMR-II wtbmr-ii- 5 myc C118W- 5 myc Smads p38 MAK Smads Smads Control 4-phenylbutyrate Normal vascular homeostasis Rudarakanchana et al. Hum Mol Genet. 22;11:1517- Abnormal vascular cell function Sobolewski et al. Hum Mol Genet ;17(2):318-9

3 otential for therapeutic rescue of missfolded BMR-II proteins in familial AH? Familial and idiopathic AH are associated with reduced pulmonary vascular expression of BMR-II Normal lung Exon 3 frameshift mutation BMR-II positive tissue area (%) 5 # # + CD31 positive tissue area (%) 5 Normal SH H H BMR2 mutation Normal SH H H BMR2 mutation BMR-II CD31 Atkinson et al. Circulation. 22;15: Ubiquitin ligases e.g. Smurf1/2 Viral ubiquitin ligases BMR-II BMR-I Reduced expression of BMR-II and phospho-smad1/5 in monocrotaline-induced induced AH BMR-II transcription Smads 1/5 Failure of antiproliferative effects in vascular smooth muscle Cytokines e.g. TNF-α HHV-8 8 infection HIV-1 1 infection Autoimmune inflammation Durrington et al. J Biol Chem. 21;285(48): Long L, Crosby A, et al Circulation 29;119: Adenoviral delivery of BMR-II in the hypoxic rat model of pulmonary hypertension Detection of BMR-II II-myc in rat lung following adenoviral gene delivery Reynolds, A. M. et al. Am J hysiol 27; 292: L1182-L Reynolds, A. M. et al. Am J hysiol 27; 292: L1182-L

4 Adenoviral BMRII-myc attenuates hypoxic pulmonary hypertension in the rat ulmonary artery smooth muscle cells from HAH patients exhibit reduced Smad1 mediated growth suppression ASMC(Donor1) ASMC(R491W) p-smad1 t-smad1 p-p38 t-p38 p-p44/42 t-p44/ BM Luciferase activity (% of control) BM4 + + Control ASMCs Mutant ASMCs 1 Donor IAH Mutant AH 3H-thymidine incorporation (% of.1%fbs) 1 5 Reynolds, A. M. et al. Am J hysiol 27; 292: L1182-L %FBS BM-4 (ng/ml) Yang et al Circ Res ;96: Smad1 mediates the growth inhibitory effects Of BM-4 4 in proximal ASMCs Inhibitors of DNA binding (Id) genes control cell fate and differentiation Flag-Smad1 Control BM4 Flag-Smad1+DN Smad1+DN-Smad1 control BM4 A B C D E F G H Transfected proximal ASMC 3 H-Thymidine incorporation (% of.1%fbs) DN-Smad1.1%FBS 1 5 BM4 (ng/ml) Control Vector.1%FBS 1 5 BM4 (ng/ml) Yang et al Circ Res ;96: BM signaling pathway BMR-II BMR-I Mutation in BMR-II reduces transcription of Id genes in response to BMs Smads 1/5 Cell specific changes in gene transcription Id gene expression Vascular cell phenotype migration and proliferation Yang et al. Circ Res ; 96: Yang et al. Circ Res 28;12: Yang et al. Circ Res 28;12:

5 Reduced Id1 gene expression in lesions of heritable AH Id gene knockdown leads to loss of the growth inhibitory effects of BMs in ASMCs Yang et al. Circ Res 28;12: Lentiviral-mediated overexpression of Id1 suppresses serum-induced proliferation of human ASMCs Con Lentivector Lenti- Lentiviral transfection efficiency Id1 rostanoid GCR DGF RTK BMR-II BMR-I Id1 -actin Vector Lenti-GF cam ERK1/2 counts (x1,) Cell specific changes in gene transcription Vascular cell phenotype migration and proliferation Smads 1/5 Id gene expression Yang et al. Circ Res 28;12: Treprostinil inhibits progression of pulmonary hypertension and vascular remodeling in monocrotaline model of H Treprostinil restores psmad1/5 signaling and Id1 gene expression in monocrotaline model of H A B E C D F Con MCT/Saline MCT/Trep H&E EVG

6 otential role of BMR2 mutations in pulmonary arterial hypertension Mutant BMR-II Abnormal vascular development? Unstable vasculature 2nd hit Inflammation Critical reduction in BM signaling Abnormal TGF-β signaling Thanks to: Kings College London Richard Trembath University of Glasgow Mandy MacLean Andrew Baker Imperial College Martin Wilkins Harvard University Ken Bloch University of Giessen Ralph Schermuly

ACTRIIA-Fc rebalances BMP and activin/tgf-β signaling to attenuate experimental pulmonary hypertension

ACTRIIA-Fc rebalances BMP and activin/tgf-β signaling to attenuate experimental pulmonary hypertension ACTRIIAFc rebalances BM and activin/tgfβ signaling to attenuate experimental pulmonary hypertension LaiMing Yung, h.d 1 ; R. Scott earsall, h.d 2 ; Geoffrey Bocobo, B.S. 1 ; Dianne S. Sako 2 ; Teresa Dinter,

More information

Elastase Mediated Pulmonary Vascular Disease. Elastase

Elastase Mediated Pulmonary Vascular Disease. Elastase PPH Newborn Autoimmune Heart defect Lung abnormality Pathology of Pulmonary Arterial Hypertension () Endothelial and Smooth Muscle Dysfunction Liver disease portal hyper. Pulmonary Hypertension Infectious:

More information

Tumor suppressor genes D R. S H O S S E I N I - A S L

Tumor suppressor genes D R. S H O S S E I N I - A S L Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

MUTATION IN BONE MORPHOGENETIC PROTEIN RECEPTOR II GENE AS A CAUSE OF PULMONARY HYPERTENSION

MUTATION IN BONE MORPHOGENETIC PROTEIN RECEPTOR II GENE AS A CAUSE OF PULMONARY HYPERTENSION MUTATION IN BONE MORPHOGENETIC PROTEIN RECEPTOR II GENE AS A CAUSE OF PULMONARY HYPERTENSION MUTATION IN THE GENE FOR BONE MORPHOGENETIC PROTEIN RECEPTOR II AS A CAUSE OF PRIMARY PULMONARY HYPERTENSION

More information

Multistep nature of cancer development. Cancer genes

Multistep nature of cancer development. Cancer genes Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic

More information

BIOL2005 WORKSHEET 2008

BIOL2005 WORKSHEET 2008 BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation? Control of Cell Proliferation by Peptide Growth Factors Autocrine Growth Factor Production Causes Malignant Transformation? Transforming Activities From Condition Media from a Tumor Cell Line Condition

More information

Development of Carcinoma Pathways

Development of Carcinoma Pathways The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,

More information

Potential Role for the Bone Morphogenetic Antagonist Gremlin in Pulmonary Hypertension

Potential Role for the Bone Morphogenetic Antagonist Gremlin in Pulmonary Hypertension Potential Role for the Bone Morphogenetic Antagonist Gremlin in Pulmonary Hypertension Dr Sean Gaine National Pulmonary Hypertension Unit Mater Misericordiae University Hospital University College Dublin

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Principles of cell signaling Lecture 4

Principles of cell signaling Lecture 4 Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway

More information

supplementary information

supplementary information DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

A class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation.

A class of genes that normally suppress cell proliferation. p53 and Rb..ect. suppressor gene products can release cells. hyperproliferation. Tumor Suppressor Genes A class of genes that normally suppress cell proliferation. p53 and Rb..ect Mutations that inactivate the tumor suppressor gene products can release cells from growth suppression

More information

Muscular Dystrophy. Biol 405 Molecular Medicine

Muscular Dystrophy. Biol 405 Molecular Medicine Muscular Dystrophy Biol 405 Molecular Medicine Duchenne muscular dystrophy Duchenne muscular dystrophy is a neuromuscular disease that occurs in ~ 1/3,500 male births. The disease causes developmental

More information

Pulmonary hypertension; does gender matter?

Pulmonary hypertension; does gender matter? Pulmonary hypertension; does gender matter? Nazzareno Galiè Istituto di Cardiologia Università di Bologna nazzareno.galie@unibo.it Galiè N et al. European Heart Journal (2009) 30, 2493 2537 Pulmonary Hypertension

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Song et al. identified FBXW7 as a new positive regulator for RIG-Itriggered type I IFN signaling pathway. The authors observed

More information

Chapter. Diffusion capacity and BMPR2 mutations in pulmonary arterial hypertension

Chapter. Diffusion capacity and BMPR2 mutations in pulmonary arterial hypertension Chapter 7 Diffusion capacity and BMPR2 mutations in pulmonary arterial hypertension P. Trip B. Girerd H.J. Bogaard F.S. de Man A. Boonstra G. Garcia M. Humbert D. Montani A. Vonk Noordegraaf Eur Respir

More information

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Supplementary information inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins Takuya Tada, Yanzhao Zhang, Takayoshi Koyama, Minoru Tobiume, Yasuko Tsunetsugu-Yokota, Shoji

More information

Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous

Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors

More information

Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA.

Research article. Department of Pharmacology and Toxicology, Medical College of Georgia, Georgia Health Sciences University, Augusta, Georgia, USA. Research article Calpain mediates pulmonary vascular remodeling in rodent models of pulmonary hypertension, and its inhibition attenuates pathologic features of disease Wanli Ma, 1 Weihong Han, 1 Peter

More information

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007

HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Primary Pulmonary Hypertension Is Associated With Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor

Primary Pulmonary Hypertension Is Associated With Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor Primary Pulmonary Hypertension Is Associated With Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor Carl Atkinson, BSc; Susan Stewart, FRCPath; Paul D. Upton, PhD; Rajiv

More information

Update On Current Concepts And Treatment Of Pulmonary Hypertension

Update On Current Concepts And Treatment Of Pulmonary Hypertension Ottawa Hospital Research Institute Institute de recherche de l Hopital d Ottawa Update On Current Concepts And Treatment Of Pulmonary Hypertension ACC Rockies March 11-14, 2012 Dr. Duncan J. Stewart, CEO

More information

supplementary information

supplementary information DOI: 10.1038/ncb2153 Figure S1 Ectopic expression of HAUSP up-regulates REST protein. (a) Immunoblotting showed that ectopic expression of HAUSP increased REST protein levels in ENStemA NPCs. (b) Immunofluorescent

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Angiogenesis in Human Development. Vascular Development

Angiogenesis in Human Development. Vascular Development Angiogenesis in Human Development Jan Kitajewski ICRC 217B, ph 851-4688, email: jkk9 BACKGROUND READING: Vascular Development Signaling Vascular Morphogenesis and Maintenance Douglas Hanahan. Science 277:

More information

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- 1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated

More information

Src-INACTIVE / Src-INACTIVE

Src-INACTIVE / Src-INACTIVE Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each

More information

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease) CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions

More information

Hormones and Cancer Research Unit Department of Medicine, McGill University Dr. Jean-Jacques Lebrun

Hormones and Cancer Research Unit Department of Medicine, McGill University  Dr. Jean-Jacques Lebrun Hormones and Cancer Research Unit Department of Medicine, McGill University www.hcru.mcgill.ca Dr. Jean-Jacques Lebrun TGF /Smad signaling pathways CELLULAR AND MOLECULAR BIOLOGY Institut de recherches

More information

Immune surveillance hypothesis (Macfarlane Burnet, 1950s)

Immune surveillance hypothesis (Macfarlane Burnet, 1950s) TUMOR-IMMUNITÄT A.K. Abbas, A.H. Lichtman, S. Pillai (6th edition, 2007) Cellular and Molecular Immunology Saunders Elsevier Chapter 17, immunity to tumors Immune surveillance hypothesis (Macfarlane Burnet,

More information

1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles:

1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples. Major Principles: Carcinogenesis 1. Basic principles 2. 6 hallmark features 3. Abnormal cell proliferation: mechanisms 4. Carcinogens: examples Carcinogenesis Major Principles: 1. Nonlethal genetic damage is central to

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.

More information

Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human

Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human Supplementary Figure 1. TNFα reduces BMPR-II protein and mrna expression via NF-кB/RELA. (a and b) Representative immunoblots of BMPR-II in human dpasmcs (a) and PAECs (b) treated with IL-1β (1 ng ml -1

More information

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of

More information

Phospholipase C γ Prof. Graham Carpenter

Phospholipase C γ Prof. Graham Carpenter Graham Carpenter, h.d. rofessor of Biochemistry Cornelia Crooke Department of Biochemistry Vanderbilt University School of Medicine, Nashville, TN 1 Receptor Tyrosine Kinases GF Extracellular M Intracellular

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Problem Set 5 KEY

Problem Set 5 KEY 2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Antibodies for Unfolded Protein Response

Antibodies for Unfolded Protein Response Novus-lu-2945 Antibodies for Unfolded rotein Response Unfolded roteins ER lumen GR78 IRE-1 GR78 ERK Cytosol GR78 TRAF2 ASK1 JNK Activator Intron RIDD elf2α Degraded mrna XB1 mrna Translation XB1-S (p50)

More information

Pulmonary arterial hypertension (PAH) is a. Targeted gene delivery of BMPR2 attenuates pulmonary hypertension

Pulmonary arterial hypertension (PAH) is a. Targeted gene delivery of BMPR2 attenuates pulmonary hypertension Eur Respir J 212; 39: 329 343 DOI: 1.1183/931936.18731 CopyrightßERS 212 Targeted gene delivery of BMPR2 attenuates pulmonary hypertension A.M. Reynolds,#, M.D. Holmes,#,", S.M. Danilov +,1 and P.N. Reynolds,#,"

More information

Cancer genetics

Cancer genetics Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 Name: Key 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function

More information

CHEST Translating Basic Research Into Clinical Practice

CHEST Translating Basic Research Into Clinical Practice --- -- -- - - CHEST Translating Basic Research Into Clinical Practice Molecular Mechanisms of Pulmonary Arterial Hypertension* Role of Mutations in the Bone Morphogenetic Protein Type II Receptor Rachel

More information

Cell Cell Communication

Cell Cell Communication IBS 8102 Cell, Molecular, and Developmental Biology Cell Cell Communication January 29, 2008 Communicate What? Why do cells communicate? To govern or modify each other for the benefit of the organism differentiate

More information

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION

CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.

More information

TARGETS OF CYCLIN D1-CDK

TARGETS OF CYCLIN D1-CDK TARGETS OF CYCLIN D1-CDK FIRST TARGET OF THE COMPLEX CYCLIN D-KINASI: prb, IS THE PRODUCT OF THE GENE CONFERRING SUSCEPTIBILITY TO RETINOBLASTOMA - ABSENT OR MUTATED IN SEVERAL HUMAN CANCERS - TRANSCRIPTIONL

More information

Molecular biology :- Cancer genetics lecture 11

Molecular biology :- Cancer genetics lecture 11 Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to

More information

Familial and Hereditary Colon Cancer

Familial and Hereditary Colon Cancer Familial and Hereditary Colon Cancer Aasma Shaukat, MD, MPH, FACG, FASGE, FACP GI Section Chief, Minneapolis VAMC Associate Professor, Division of Gastroenterology, Department of Medicine, University of

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

Problem Set 8 Key 1 of 8

Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1 of 8 7.06 2003 Problem Set 8 Key 1. As a bright MD/PhD, you are interested in questions about the control of cell number in the body. Recently, you've seen three patients

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Microglia, Inflammation, and FTD

Microglia, Inflammation, and FTD FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Inner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling

Inner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling 4th International Melorheostosis Association Conference Inner Nuclear Membrane Protein MAN1 and Regulation of R-Smad Signaling Howard J. Worman Columbia University New York, NY The Nuclear Envelope By

More information

NALP12, a gene responsible for periodic fever syndromes. Isabelle Jéru INSERM U.654, Paris, FRANCE

NALP12, a gene responsible for periodic fever syndromes. Isabelle Jéru INSERM U.654, Paris, FRANCE NALP12, a gene responsible for periodic fever syndromes Isabelle Jéru INSERM U.654, Paris, FRANCE Hereditary periodic fever syndromes (HPFs) Phenotype 6 clinical entities Fever episodes Abdominal pain

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies

More information

Tyrosine Kinase Inhibitors

Tyrosine Kinase Inhibitors European Society of Cardiology ESC CONGRESS 2011 aris, August 27-31, 2011 New Approaches to the Treatment of ulmonary Hypertension: Tyrosine Kinase Inhibitors Stephan Rosenkranz Klinik III für Innere Medizin

More information

Pulmonary vascular remodelling: causes, mechanisms and consequences

Pulmonary vascular remodelling: causes, mechanisms and consequences Pulmonary vascular remodelling: causes, mechanisms and consequences Ralph Schermuly Department of Pulmonary Pharmacotherapy University of Giessen and Marburg Lung Center email: ralph.schermuly@ugmlc.de

More information

Cover Page. The handle holds various files of this Leiden University dissertation.

Cover Page. The handle   holds various files of this Leiden University dissertation. Cover Page The handle http://hdl.handle.net/1887/22278 holds various files of this Leiden University dissertation. Author: Cunha Carvalho de Miranda, Noel Filipe da Title: Mismatch repair and MUTYH deficient

More information

Familial and Hereditary Colon Cancer

Familial and Hereditary Colon Cancer Familial and Hereditary Colon Cancer Aasma Shaukat, MD, MPH, FACG, FASGE, FACP GI Section Chief, Minneapolis VAMC Associate Professor, Division of Gastroenterology, Department of Medicine, University of

More information

Melorheostosis Current Understanding and Recent Developments

Melorheostosis Current Understanding and Recent Developments Melorheostosis Current Understanding and Recent Developments Robert E. Fleming, M.D. Associate Professor of Pediatrics and Biochemistry & Molecular Biology Saint Louis University School of Medicine Clinical

More information

Prediction of invasiveness of hepatic tumor cells

Prediction of invasiveness of hepatic tumor cells Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator

More information

Cancer. October is National Breast Cancer Awareness Month

Cancer. October is National Breast Cancer Awareness Month Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is

Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is Supplementary Figure 1: Uncropped western blots for Figure 1B. Uncropped blots shown in Figure 1B, showing that NOTCH intracellular domain (NICD) is increased with exposure of HUVEC to 1h FSS, and that

More information

Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development

Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Functional Genomics : PTPRF-Mediated Contact Inhibition in HCC development Sen-Yung Hsieh, MD, PhD Liver Research Unit Chang Gung Memorial Hospital Taoyuan, Taiwan Aims To identify genes controlling tumor

More information

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D

G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters

More information

Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome

Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome Identification of a novel duplication mutation in the VHL gene in a large Chinese family with Von Hippel-Lindau (VHL) syndrome L.H. Cao 1, B.H. Kuang 2, C. Chen 1, C. Hu 2, Z. Sun 1, H. Chen 2, S.S. Wang

More information

T cell maturation. T-cell Maturation. What allows T cell maturation?

T cell maturation. T-cell Maturation. What allows T cell maturation? T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry

More information

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science

More information

Tyrosine kinases. Cell surface receptors ligand binding. Producer cell RNA. Target cell

Tyrosine kinases.   Cell surface receptors ligand binding. Producer cell RNA. Target cell Tyrosine kinases http://msbl.helsinki.fi/tkseminar roducer cell Signaling molecules Receptor binding Signal transduction Target cell Activation of Gene expression RNA Biological responses proliferation,

More information

The Phagocytic Synapse in Distinguishing Particulate and Soluble Stimuli David M. Underhill

The Phagocytic Synapse in Distinguishing Particulate and Soluble Stimuli David M. Underhill The hagocytic Synapse in Distinguishing articulate and Soluble Stimuli The hagocytic Synapse in Distinguishing articulate and Soluble Stimuli How does a cell know the difference between an inflammatory

More information

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm) Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939

More information

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department

Genetics of Cancer Lecture 32 Cancer II. Prof. Bevin Engelward, MIT Biological Engineering Department Genetics of Cancer Lecture 32 Cancer II rof. Bevin Engelward, MIT Biological Engineering Department Why Cancer Matters New Cancer Cases in 1997 Cancer Deaths in 1997 Genetics of Cancer: Today: What types

More information

T cell-mediated immunity

T cell-mediated immunity T cell-mediated immunity Overview For microbes within phagosomes in phagocytes.cd4+ T lymphocytes (TH1) Activate phagocyte by cytokines studies on Listeria monocytogenes For microbes infecting and replicating

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

oncogenes-and- tumour-suppressor-genes)

oncogenes-and- tumour-suppressor-genes) Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation

Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis

More information

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress

Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies. Traditional Hypothesis Stress 3/1/212 Role of Inflammatory and Progenitor Cells in Pulmonary Vascular Remodeling: Potential Role for Targeted Therapies K.R. Stenmark University of Colorado Denver, CO 845 Prominent Fibroproliferative

More information

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim.

Supplemental Data. TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Supplemental Data TGF-β-mediated mir-181a expression promotes breast cancer metastasis by targeting Bim. Molly A. Taylor 1, Khalid Sossey-Alaoui 2, Cheryl L. Thompson 3, David Danielpour 4, and William

More information

609G: Concepts of Cancer Genetics and Treatments (3 credits)

609G: Concepts of Cancer Genetics and Treatments (3 credits) Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Non-Mendelian inheritance

Non-Mendelian inheritance Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University

More information

Hypercholesterolemia: So much cholesterol, so many causes

Hypercholesterolemia: So much cholesterol, so many causes Hypercholesterolemia: So much cholesterol, so many causes Student group names kept anonymous Department of Biology, Lake Forest College, Lake Forest, IL 60045, USA Hypercholesterolemia is a disease characterized

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Identification and characterization of genes responsive to apoptosis: Application of DNA chip technology and mrna differential display

Identification and characterization of genes responsive to apoptosis: Application of DNA chip technology and mrna differential display Histol Histopathol (2000) 15: 1271-1 284 http://www.ehu.es/histol-histopathol Histology and H istopat hology Cellular and Molecular Biology Invited Revie W Identification and characterization of genes

More information

UvA-DARE (Digital Academic Repository) Marfan syndrome: Getting to the root of the problem Franken, Romy. Link to publication

UvA-DARE (Digital Academic Repository) Marfan syndrome: Getting to the root of the problem Franken, Romy. Link to publication UvA-DARE (Digital Academic Repository) Marfan syndrome: Getting to the root of the problem Franken, Romy Link to publication Citation for published version (APA): Franken, R. (2016). Marfan syndrome: Getting

More information

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research

Signaling. Dr. Sujata Persad Katz Group Centre for Pharmacy & Health research Signaling Dr. Sujata Persad 3-020 Katz Group Centre for Pharmacy & Health research E-mail:sujata.persad@ualberta.ca 1 Growth Factor Receptors and Other Signaling Pathways What we will cover today: How

More information