Supplementary Materials for

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Supplementary Materials for"

Transcription

1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting LXR SUMOylation specifically in astrocytes Jee Hoon Lee, Hyunmi Kim, Soo Jung Park, Joo Hong Woo, Eun-hye Joe, Ilo Jou The PDF file includes: Corresponding author. Published 2 ugust 216, Sci. Signal. 9, ra78 (216) DOI: /scisignal.aaf485 Fig. S1. LXRs interact with and induce expression of in a receptordependent manner. Fig. S2. is involved in LXR-mediated signaling pathways in brain astrocytes. Fig. S3. contributes to LXR-mediated anti-inflammatory effects in brain astrocytes. Fig. S4. Interactions between and LXR are critical for LXR-mediated antiinflammatory effects. Fig. S5. SUMOylation mediates the LXR-dependent anti-inflammatory effect. Fig. S6. promotes LXR SUMOylation. Fig. S7. promotes protein stability. Fig. S8. promotes -mediated LXR SUMOylation by inhibiting SIH1 binding to. Table S1. List of sirn oligonucleotides. Legend for data file S1 Other Supplementary Material for this manuscript includes the following: (available at Data file S1 (Microsoft Excel format). Gene expression analysis of brain astrocytes upon knockdown.

2 con (kda) STT1 ccession Protein protein coverage (%) PI (isoelectric point) Number of peak MW (kda) P39948 cyclin D RZ48 ardet-iedl syndrome P97947 Q9QXK nuclear receptor subfamily gro up number 2 (NR2) signal transducer and activator of transcription feno (h) C si- si- - (1 nm) (1 nm) (1 nm) GPDH α-tubulin α-tubulin TNF-α GPDH Figure S1. LXRs interact with and induce expression of in a receptor-dependent manner. () Primary astrocytes were stimulated with for 2 hours in the presence of. Cell lysates were immunoprecipitated with the antibody, loaded onto SDS-PGE, and the resultant gel was stained with rilliant lue G. Proteins in select bands were identified using MLDI-TOF-MS, as noted for STT1 and. The table displays the results of the interacting proteins. () strocytes were treated with or fenofibrate (feno) for the indicated times, and transcript and protein abundance were analyzed by RT-PCR (top) and Western blotting (bottom), respectively. (C) strocytes were transfected with an - or specific sirn duplex or control sirn (). fter 48 hours, cells were stimulated with for 2 or 6 hours in the absence or presence of LXR ligands. transcript and protein levels were examined using RT-PCR and Western blotting, respectively.

3 cytokine activity cytokine binding chemokine activiry chemokine receptor binding interleukin-1 receptor binding tumor necrosis factor receptor binding chemokine receptor activity chemokine binding cytokine glycoprotein disulfide bond inflammatory response GOTERM_MF FT (Gene Ontology) P value <.5(),.1(),.1() count SP_PIR_KEYWORDS (Functional categories) pyrogen macrophage lymphokine secreated lipoprotein P value <.5(),.1(),.1() immune response regulation of cytokine production positive regulation of cytokine production positive regulation of response to stimulus cytokine-mediated signaling pathway regulation of cytokine secretion inflammatory response protein kinase cascade cell migration regulation of intracellular signal transduction cytokine-cytokine receptor type I diabetes mellitus apoptosis chemokine signaling NOD-like receptor signaling Natural killer cell mediated cytotoxicity MPK signaing Jak-STT signaling GOTERM_P FT (Gene Ontology) P value <.5(),.1(),.1() count KEGG_Pathway (Pathway) P value <.5(),.1(),.1() count count Figure S2. is involved in LXR-mediated signaling pathways in brain astrocytes. Functional grouping and signaling pathways of differentially regulated genes in -specific or nonsilencing control sirn-transfected brain astrocytes treated with or without and. ll the genes identified were examined for biological function according to the Gene Ontology Consortium and grouped in the respective functional categories. Pathway analysis of differentially expressed genes was carried out based on the latest data from the Kyoto Encyclopedia of Genes and Genomes (KEGG) database.

4 Relative migration (fold) TNF-α (pg/ml) Merge TNF-α si- C si- ctin E 1 5 si- D IP si- STT1 IgG Input PCR: pstt1 binding site of IRF-1 (-158 ~ -8) astrocyte-conditioned medias (CMs) 2 si- si- 15 F 1 5 Figure S3. contributes to LXR-mediated anti-inflammatory effects in brain astrocytes. ( to D) Primary astrocytes were transfected with -specific (si-) or a control sirn (). Western blot analysis confirmed gene knockdown in cells (). fter transfection, - or -treated astrocytes were stimulated with and prepared for ELIS (), immunocytochemistry (C), or ChIP assay (D). (E and F) Representative images (E) and analysis (F) of a microglia migration transwell assay, in which the bottom well contained conditioned media from astrocytes transfected with si- or. Scale bar, 4 μm. p<.5 (n=3; mean±s.d.).

5 Merge TNF-α TNF-α (pg/ml) mock WT -WT -MT M1 M2 M3 C PTILYTLLSP PSILKKILLEEP GRLRILLM M1 M2 M3 IP D ctin actin input -WT -MT E -WT -MT F IP -WT -MT STT1 IgG Input PCR: pstt1 binding site of IRF-1 (-158 ~ -8) Figure S4. Interactions between and LXR are critical for LXR-mediated anti-inflammatory effects. () Schematic of the protein, showing the sequences and locations of the three putative nuclear receptor binding motifs. rrows show the amino acids changed to alanine in the three mutants, M1-M3. () HEK293T cells were transfected with -tagged wild-type (WT) or mutant [M1-M3; ()]. Subsequently, cell lysates were immunoprecipitated with the indicated antibodies, followed by immunoblot analysis. (C to F) Primary astrocytes were transfected with -tagged wild-type (-WT) or mutant [-MT; as in Fig. 1H, a.k.a. the M1 mutant in ()]. Western blot analysis confirmed overexpression in cells (C). fter transfection, or -treated astrocytes were stimulated with and prepared for ELIS (D), immunocytochemistry (E), or ChIP assay (F). Input indicates control PCR and shows the amount of IRF-1 promoter DN present in each sample before ChIP. p<.5 (n=3; mean ±S.D.). Scale bars, 5 μm.

6 IL-1β (fold) IL-1β (fold) TNF-α (fold) TNF-α (fold) si-sumo1 si-sumo2 -WT -K3R Figure S5. SUMOylation mediates the LXR-dependent anti-inflammatory effect. () qrt-pcr for the indicated mrns in astrocytes transfected with SUMO1- or SUMO2-specific sirn and stimulated with in the presence of individual LXR ligands. () qrt-pcr for the indicated mrns in astrocytes transfected with -tagged wild-type (-WT) or a SUMOylation site-mutant (-K3R) and subsequently treated with in the absence or presence of LXR ligands. p<.5 (n=3; mean ±S.D.).

7 -WT si-hdc4 HDC4 py-stt1 HDC4 SUMO2/3 HDC4 actin IP WCL E1 E2 SUMO2/3 GST-HDC4 His- SUMO2/ M r (K) WT MT SUMO2/3- SUMO2/3- Figure S6. promotes LXR SUMOylation. () Coimmunoprecipitation in astrocytes transfected with -tagged -WT or with HDC4 sirn and treated with in the absence or presence of. () was immunoprecipitated from the cells and an in vitro SUMOylation assay was performed in a reaction with the elements as indicated atop the Western blot.

8 Relative density si- actin fold change1.5 n.s n.s con si- -WT C E1/TP E2 ub E3 GST-SIH1 His- ub -Ub -Ub n.s D si- Myc- E - - Myc-WT DPI Myc- SUMO1 IP: - Myc-D1 - Myc-D2 - Myc-D3 Myc input SUMO1 Myc actin WCL Figure S7. promotes protein stability. () strocytes transfected with si- or were treated and, followed by immunoblotting with anti- antibody (upper panel). and intensities were quantified via scanning densitometry (lower panel). p<.5 (n=3; mean ±S.D.). () Primary astrocytes were transfected with -specific sirn or with -WT for 48 hours. transcript abundance was determined with qrt-pcr. n.s, non-significant. (C) was immunoprecipitated from the cells and an in vitro ubiquitination assay was performed in a reaction with elements as indicated atop the Western blots for ubiquitin (ub) and. n.s, non-specific. (D) Primary astrocytes were transfected with si- or Myc-. t 48 hours after transfection, cells were stimulated with with Protein interactions were measured via immunoprecipitation using the antibody. (E) HEK293T cells overexpressing - and either Myc--WT or one of three Myc- deletion mutants (D1 D3; Fig. 4F) were analyzed using PL to detect interactions between and variants. Scale bars, 1 μm.

9 Figure S8. promotes -mediated SUMOylation by inhibiting SIH1 binding to. () Primary astrocytes were transfected with - or SIH1-specific sirn. t 48 hours after transfection, cells were stimulated with with Protein interactions were measured via immunoprecipitation using the antibody. ( and C) Primary astrocytes were transfected with si- or. SIH transcript and protein amounts were determined using qrt-pcr () and Western blotting (C), respectively. Transcripts Target sequences 5'- UGGGGCGUUCGGG-3' 5'- GGCGUCCGCUUG-3' 5 -CUCGCUCUCCUGU-3 SIH1 5 -CGGUUUGUGUUCGU-3 SIH2 5 -CUGCCCGUUGGUCUCU-3 5'-CUUCGGGUUCGGC-3' HDC4 5'-CCGUGGGCUUCGGUUU-3' SUMO1 5'-GGGGCGUGUUG-3' SUMO2 5'-CGCGGCCCGG-3' Table S1. List of sirn oligonucleotides. The 5-3 sequence of the sirns used in this study, corresponding to the encoded protein (left), are listed. Data file S1. Gene expression analysis of brain astrocytes upon knockdown. Microarray data pertaining to the heatmap in Fig. 1C, provided in an Excel sheet in the online supplemental materials. The data are also available in NCI GEO, accession number GSE fc, fold change between the conditions noted (coded 1-4, legend at top).

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/283/ra57/dc1 Supplementary Materials for JNK3 Couples the Neuronal Stress Response to Inhibition of Secretory Trafficking Guang Yang,* Xun Zhou, Jingyan Zhu,

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in

Figure S1. IRF5 mrna expression is not expressed modulated by steatosis grade in 9-INS-RG-TR- SUPPLEMENTRY MTERILS B IRF mrn expression 1 Control Fatty liver NSH HCV αsm IRF 1 ERG IRF < -33 33- Steatosis (%) < Figure S1. IRF mrn expression is not expressed modulated by steatosis grade

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN!

**! Yuan et al., Supplemental Figure 1, related to Figure 1! EYA2 modulates the transcriptional activity of ERb, but not ERa! -DPN! +DPN! Yuan et al., Supplemental Figure 1, related to Figure 1! EY2 modulates the transcriptional activity of ERb, but not ERa!! B! -DPN! +DPN! * ERb GPDH MCF7 MD-MB-231 Primary BC - KD - KD #1 #2 #3 Relative

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Supplemental Information

Supplemental Information Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin

More information

Figure S1, Beyer et al.

Figure S1, Beyer et al. Figure S1, eyer et al. Pax7 Myogenin si sitrl Hoechst T = 72h 14 1.8.6.4.2 12 1 8 6 4 2 24h 48h 96h diff. sitrl siset1 212 72h diff. b1 td r t Se km MyH Vinculin Myogenin β-ctin Vinculin MW b1 ka td r

More information

crossmark Ca V subunits interact with the voltage-gated calcium channel

crossmark Ca V subunits interact with the voltage-gated calcium channel crossmark THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 291, NO. 39, pp. 20402 20416, September 23, 2016 Author s Choice 2016 by The American Society for Biochemistry and Molecular Biology, Inc. Published in

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry

Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus entry SUPPLEMENTARY INFORMATION Letters https://doi.org/10.1038/s41564-017-0080-8 In the format provided by the authors and unedited. Ephrin receptor A2 is an epithelial cell receptor for Epstein Barr virus

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:

File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description: File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'

More information

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1

Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb /DC1 Supplemental material JCB Cesarini et al., http ://www.jcb.org /cgi /content /full /jcb.201504035 /DC1 THE JOU RNAL OF CELL BIO LOGY Figure S1. Lamin A/C depletion generates two distinct phenotypes in

More information

Chapter 13: Cytokines

Chapter 13: Cytokines Chapter 13: Cytokines Definition: secreted, low-molecular-weight proteins that regulate the nature, intensity and duration of the immune response by exerting a variety of effects on lymphocytes and/or

More information

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination

E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA

Page 39 of 44. 8h LTA & AT h PepG & AT h LTA Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human

More information

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin

William C. Comb, Jessica E. Hutti, Patricia Cogswell, Lewis C. Cantley, and Albert S. Baldwin Molecular Cell, Volume 45 Supplemental Information p85 SH2 Domain Phosphorylation by IKK Promotes Feedback Inhibition of PI3K and Akt in Response to Cellular Starvation William C. Comb, Jessica E. Hutti,

More information

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation

Supplementary information. The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic. Spindle Orientation Supplementary information The Light Intermediate Chain 2 Subpopulation of Dynein Regulates Mitotic Spindle Orientation Running title: Dynein LICs distribute mitotic functions. Sagar Mahale a, d, *, Megha

More information

T Cell Effector Mechanisms I: B cell Help & DTH

T Cell Effector Mechanisms I: B cell Help & DTH T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/6/305/ra106/dc1 Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/418/ra27/dc1 Supplementary Materials for The adhesion molecule PECAM-1 enhances the TGF- mediated inhibition of T cell function Debra K. Newman,* Guoping Fu,

More information

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang

More information

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis

Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis SUPPLEMENTARY MATERIAL Loss of Calreticulin Uncovers a Critical Role for Calcium in Regulating Cellular Lipid Homeostasis Wen-An Wang 1, Wen-Xin Liu 1, Serpen Durnaoglu 2, Sun-Kyung Lee 2, Jihong Lian

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells

Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION

Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,

Adaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214, Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

Supplementary Material

Supplementary Material Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.

More information

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half:

+ + + IP: Anti-Flag. Catalytic domain. Regulatory domain. Myr SH3 SH2 Kinase domain PP2. Flag-HK1. c-src ΔSH3. HK1 N-half: C-half: a d h ΔSH2 Δ(SH3SH2) Myr SH3 SH2 Kinase domain 85 5 249 55 5 csrc ΔSH3 FlagHK HAcSrc HAcSrcΔSH2 HAcSrcΔSH3 HAcSrcΔ(SH3SH2) WB: FlagHK HAcSrc HAcSrcKD HAcSrcY529F WB: HisHK2HK2 Input GSTcSrc GST : : GST

More information

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance

Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance ORIGINAL ARTICLE Loss of Pdk1-Foxo1 Signaling in Myeloid Cells Predisposes to Adipose Tissue Inflammation and Insulin Resistance Yoshinaga Kawano, 1 Jun Nakae, 1 Nobuyuki Watanabe, 2 Shiho Fujisaka, 3

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 info@genetex.com GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 infoasia@genetex.com Date :

More information

Study of different types of ubiquitination

Study of different types of ubiquitination Study of different types of ubiquitination Rudi Beyaert (rudi.beyaert@irc.vib-ugent.be) VIB UGent Center for Inflammation Research Ghent, Belgium VIB Training Novel Proteomics Tools: Identifying PTMs October

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations

Title. VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body. Authors. Affiliations Title VLDL/LDL acts as a drug carrier and regulates the transport and metabolism of drugs in the body Authors Hideaki Yamamoto 1, Tappei Takada 1 *, Yoshihide Yamanashi 1, Masatsune Ogura 2, Yusuke Masuo

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

Supplementary material. Supplementary Figure legends

Supplementary material. Supplementary Figure legends Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)

More information

Supplemental figures

Supplemental figures Supplemental figures Supplemental Figure 1. Impact of immunogenic-llc tumors (LLC-OVA) on peripheral OVA-specific CD8 T cells. Tetramer analysis showing percent OVA-specific CD8 T cells in peripheral blood

More information

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines

Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina

More information

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation?

Control of Cell Proliferation by Peptide Growth Factors. Autocrine Growth Factor Production Causes Malignant Transformation? Control of Cell Proliferation by Peptide Growth Factors Autocrine Growth Factor Production Causes Malignant Transformation? Transforming Activities From Condition Media from a Tumor Cell Line Condition

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Basis of Immunology and

Basis of Immunology and Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie

More information

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION

KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI

Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse

More information

F-actin VWF Vinculin. F-actin. Vinculin VWF

F-actin VWF Vinculin. F-actin. Vinculin VWF a F-actin VWF Vinculin b F-actin VWF Vinculin Supplementary Fig. 1. WPBs in HUVECs are located along stress fibers and at focal adhesions. (a) Immunofluorescence images of f-actin (cyan), VWF (yellow),

More information

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa

Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa SUPPLEMENTARY FIGURES Figure S1. HP1α localizes to centromeres in mitosis and interacts with INCENP. (A&B) HeLa tet-on cells that stably express HP1α-CFP, HP1β-CFP, or HP1γ-CFP were monitored with livecell

More information

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.

RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. ۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,

More information

Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for

Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for TET2 Paul Guilhamon 1, Malihe Eskandarpour 2, Dina Halai 3, Gareth A. Wilson 1, Andrew Feber 1, Andrew E. Teschendorff

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z.

Human recombinat MIF protein (hrmif), MW: Da. m/z. hrmif ( Da) + 4-IPP (282 Da) MWtot ~ Da. m/z. Intensity % Intensity % A Human recombinat MIF protein (hrmif), MW: 12428.31 Da m/z hrmif (12428.31 Da) + 4-IPP (282 Da) MWtot ~ 12715.21 Da m/z B HTC/C3 DAPI phistone-h3 Merge HTC/C3 DAPI phistone-h3

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplemental FIG. 1. Localization of myosin Vb in cultured neurons varies with maturation stage. A and B, localization of myosin Vb in cultured hippocampal neurons. A, in DIV

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression

SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Received 1 Feb 215 Accepted 15 Oct 215 Published 24 Nov 215 DOI: 1.138/ncomms9917 SENP1-mediated NEMO desumoylation in adipocytes limits inflammatory responses and type-1 diabetes progression Lan Shao

More information

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:

T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes: Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,

More information

Received 28 September 2010/Returned for modification 19 October 2010/Accepted 27 April 2011

Received 28 September 2010/Returned for modification 19 October 2010/Accepted 27 April 2011 MOLECULAR AND CELLULAR BIOLOGY, July 2011, p. 2774 2786 Vol. 31, No. 14 0270-7306/11/$12.00 doi:10.1128/mcb.01139-10 Copyright 2011, American Society for Microbiology. All Rights Reserved. A Cytosolic

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather

More information

LPS LPS P6 - + Supplementary Fig. 1.

LPS LPS P6 - + Supplementary Fig. 1. P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

Samali A Figure S1.

Samali A  Figure S1. Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow

Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow Supplementary Fig. 1. The Brown Norway rat has higher coronary flow compared to other rat strains. Publically available data for coronary flow measured ex vivo on Langendorff apparatus under intrinsic

More information

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function

Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

Blocking c-met mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors CORRECTION NOTICE Nat. Med. 22, 194 21 (216) Blocking mediated phosphorylation enhances anti-tumor effects of PARP inhibitors Yi Du, Hirohito Yamaguchi, Yongkun Wei, Jennifer L Hsu, Hung-Ling Wang, Yi-Hsin

More information

Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies

Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies Inhibition of IRAK1/4 sensitizes T cell acute lymphoblastic leukemia to chemotherapies Zhaoyang Li, 1 Kenisha Younger, 2 Ronald Gartenhaus, 2,3 Ann Mary Joseph, 2 Fang Hu, 2 Maria R. Baer, 2,3 Patrick

More information

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB

PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,

More information

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Research article c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Shenghao Jin, Huiwu Zhao, Yan Yi, Yuji Nakata, Anna Kalota, and Alan M.

More information