Prediction of invasiveness of hepatic tumor cells
|
|
|
- Lee Tyrone Henry
- 5 years ago
- Views:
Transcription
1 Prediction of invasiveness of hepatic tumor cells (Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells) (Romo1 : Reactive Oxygen Species Modulator 1) 고려대학교의과대학 유영도, PhD
2 (Various markers involved in hepatocarcinogenesis) A. Singhal et al. / Critical Reviews in Oncology/Hematology 82 (2012)
3 Romo1 1. Introduction : ROS and Diseases 2. Romo1 discovery 3. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 4. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
4 ROS and diseases
5 ROS and Diseases Oxidants>Antioxidants Oxidative damage (DNA, RNA, lipid, protein) (Physiol. Rev. 82:47, 2002)
6 ROS and Diseases An persistent production in ROS has been implicated in the pathogenesis of cancer, diabetes mellitus, atherosclerosis, neurodegenerative diseases, rheumatoid arthritis, ischemia/reperfusion injury, obstructive sleep apnea, and other diseases. (Droge W (2002) Physiol Rev 82(1): 47)
7
8 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
9 Identification of Romo1 To identify the genes related in the chemoresistance In 1998 Tissues of a patient who was sensitive to chemotherapy but became C R resistant after a recurrence DD-PCR identified the 136-bp partial cdna fragment which had been upregulated in the chemoresistant tumor tissue. Lymph node cdna library screening -> 600 bp Romo1
10 Identification of Romo1 q11.22 q11.23 Chr 20 start site Romo kb stop site -GenBank Accession : BC and AK consists of 2 exons
11 Amino acid sequences of the predicted Romo1 protein a hypothetical translation using the Translate program on the EXPASY website ( - encodes a 79 amino acid peptide - The molecular weight of Romo1 to be approximately 8.9 kda and Romo1 to be a transmembrane protein The function of this protein? Romo1 is a novel protein with an unknown function (Reactive oxygen species modulator 1)
12 Romo1 (reactive oxygen species modulator) Stresses => Romo1 => ROS => chronic oxidative stress => senescence, inflammation => Cancer 11 papers were published Chung JS, Park S, Park SH, Park ER, Cha PH, Kim BY, Chung YM, Woo SR, Han CJ, Kim SB, Suh KS, Jang JJ, Lee K, Choi DW, Lee S, Lee GY, Hahm KB, Shin JA, Kim BS, Noh KH, Kim TW, Lee KH, Yoo YD. Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells. Gastroenterology. In Press Lee SB, Kim JJ, Chung JS, Lee M, Lee K, Kim BS, Tansey WP and Yoo YD. Romo1 is a negative feedback regulator of c-myc. J. of Cell S cience, 24: , Lee SB, Kim HJ, Shin J, Kang ST, Kang S, Yoo YD. Bcl-XL prevents serum deprivation-induced oxidative stress mediated by Romo1. Onc ol Rep (5): Kim JJ, Lee SB, Park JK, Yoo YD. TNF-alpha-induced ROS production triggering apoptosis is directly linked to Romo1 and Bcl-X(L). Cell Death Differ (9): Lee SB, Kim JJ, Kim TW, Kim BS, Lee MS, Yoo YD. Serum deprivation-induced reactive oxygen species production is mediated by Romo1. Apoptosis (2): Chung JS, Lee SB, Park SH, Kang ST, Na AR, Chang TS, Kim HJ, Yoo YD. Mitochondrial reactive oxygen species originating from Romo1 exert an important role in normal cell cycle progression by regulating p27(kip1) expression. Free Radical Research, 2009; 43(8): Chung YM, Lee SB, Kim HJ, Park SH, Kim JJ, Chung JS, Yoo YD. Replicative senescence induced by Romo1-derived reactive oxygen spe cies. J Biol Chem ;283(48): Na AR, Chung YM, Lee SB, Park SH, Lee MS, Yoo YD. A critical role for Romo1-derived ROS in cell proliferation. Biochem Biophys Res C ommun ;369(2): Hwang IT, Chung YM, Kim JJ, Chung JS, Kim BS, Kim HJ, Kim JS, Yoo YD. Drug resistance to 5-FU linked to reactive oxygen species mo dulator 1. Biochem Biophys Res Commun ;359(2): Chung YM, Kim JS, Yoo YD. A novel protein, Romo1, induces ROS production in the mitochondria. Biochem Biophys Res Commun ;347(3):
13 Romo1 expression in various mouse tissues (Chung et al., BBRC, 2006)
14 Romo1-GFP GFP Romo1-GFP GFP Cellular localization of Romo1 A Green FL Mitotracker Merge B Green FL Mitotracker Merge C D Romo1-Myc Cy M Cy M Romo1-Myc -actin Cytochrome C COX IV HSP90 (Chung et al., BBRC, 2006)
15 (A) mros of a control cell. (E) Swollen mitochondria contained relatively high mros. Ten minutes after laser irradiation, all the mitochondria swelled (Peng et Ann NY Acad Sci 2004;1011:112-22) The ROS derived by photoirradiation induce mitochondrial swelling.
16 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
17 Stresses Oncogenes Romo1 DNA damage Tumor invasion ROS Chronic Oxidative stress Inflammation Senescence Mulidrug resistance Cancer cell survival
18 Romo1 ROS
19 Romo1-Myc Romo1-Myc Vector Romo1-Myc Romo1-Myc Vector Romo1-induced ROS generation A DAPI Red FL Green FL C DAPI Red FL Green FL Mito DCF-DA Mito DCF-DA B DAPI Red FL Green FL D DAPI Red FL Green FL (Chung et al., BBRC, 2006)
20 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
21 ROS production is increased in cancer cells -Production of large amounts of hydrogen peroxide by human tumor cells. (Szatrowski, T.P. and Nathan, C.F Cancer Res. 51 : 794, 1991) -Controlling tumor growth by modulating endogenous production of reactive oxygen species. (Laurent A et al. Cancer Res. 65: , 2005)
22 Mitosox fluorescence (% of Control sirna) ROS down-regulation by Romo1 sirna transfection A B C R Romo1 Romo1 sirna Control sirna β-actin C DAPI Mito-Sox Merge D DAPI Mito-Sox Merge * 20 0 Control sirna Romo1 sirna * : P<0.05 (Na et al., BBRC, 2008)
23 Control IMR-90 WI-38/VA-13 A549 HeLa Survival (%) Romo1 knockdown-induced growth inhibition in various cell lines A 100 (Na et al., BBRC, 2008) B HeLa A549 RKO WI-38/VA-13 IMR-90 C R C R C R C R C R Time (day) phospho AKT total AKT phospho ERK total ERK β-actin Down-regulation of intracellular ROS levels by Romo1 knockdown and Romo1 knockdown-induced growth inhibition in various cell lines
24 Romo1 Antioxidant capacity Tumor cells ROS Cell death Proliferation ROS level Growth inhibition Growth inhibition Normal cells Romo1 Antioxidant capacity ROS Proliferation Growth inhibition
25 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
26 24 h 12 h 0 h + H2O2 (200 um) 48 h 48 h Romo1 induced DNA damage in H1299 cells (γ-h2ax foci formation ) DAPI γ-h2ax DAPI γ-h2ax (Chung et al., J Biol Chem, 2008)
27 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
28 Replicative Senescence Induced by Romo1-derived Reactive Oxygen Species % of SA-ß-gal % of SA-β gal PDL #32 PDL #67 PDL # RKO Romo1 Control sirna 28S 18S Romo1 sirna * plncx2 H-Ras Romo1 * * plncx2 H-Ras Romo1 (Chung et al., J Biol Chem, 2008)
29 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
30 TNF-a and inflammation Cell death Survival
31 Physiological conditions TNF-a Complex I Complex II NF-kB A20, Mn-SOD FHC, etc Mitochondrial ROS (?) NADPH oxidase Romo1 JNK Survival Death Inflammation and liver regeneration
32 TNF-α-induced ROS production triggering apoptosis is directly linked to Romo1 and Bcl-X L (Kim et al., Cell Death and Differentiation, 2010)
33 Complex II TRAF2 Pro-capase-8 79 TRADD RIP FADD 1 Bcl-xL
34 What is the physiological role of Romo1?
35 Romo1-indued ROS is required for normal cell proliferation Endogenous Romo1 ROS ERK -> p-erk Cell growth (Chung et al., Free Radical Res, 2009)
36 Romo1 is a negative-feedback regulator of c-myc Mitogenic stimulation Romo1 ERK activation Myc Romo1 ROS Skp2 Ubiquitin-mediated degradation (Lee et al., J. of Cell Science, 2011)
37 Romo1 is a molecular bridge between TNF-α signaling and the mitochondria for ROS production that triggers TNF-α-mediated apoptosis (Kim et al., Cell Death and Differentiation, 2010)
38 1. Romo1 discovery 2. Romo1 history - Romo1 and mitochondrial ROS - A critical role for Romo1-derived ROS in cell proliferation - Romo1 and DNA damage - Romo1 and aging - Romo1 and inflammation 3. Role of Romo1-derived ROS in tumor cell invasion : Clinical Implication of Romo1 in Hepatocarcinogenesis
39 Romo1 GAPDH Cancer cell lines Romo1 GAPDH Expression of Romo1 in cancer cell lines (Chung et al., BBRC, 2006)
40 ROS is important in mediating hepatocyte death and tissue injury in the liver pathology Signaling Transduction Mechanisms of ROS and Hepatocarcinogenesis Roles of reactive oxygen species in hepatocarcinogenesis and drug resistance gene expression in liver cancers. Mol Carcinog. 2006
41 A Romo1 β-actin Romo1 β-actin B Normal Pre-cancer Cancer RKO Romo S rrna Romo1 expression in HCC cell lines and tumor tissues
42 Relative expression Romo1 overexpression and poor prognosis in HCC patients A N T N T N T N T N T N T N T N T N T N T N T N T Romo1 18S rrna B N T N T N T N T N T Romo1 18S rrna C p < D Non-tumor (n = 39) Tumor (n = 95) Normal liver tissue (x 400) Romo1-negative Romo1-positive tumor tissue (x 400) tumor tissue (x 400) Levels of Romo1 were increased compared with normal liver tissues in 63 of 95 HCC samples from patients. (Dr Lee, 원자력의학원, 서울대 )
43 Overall survival Disease-free survival E p = p = Romo1 low Romo1 high Months Romo1 low Romo1 high Months Romo1 overexpression and poor prognosis in HCC patients
44
45 Cell density (%) Cell density (%) Matrigel invasion (% of control) MitoSOX Cell density (%) Matrigel invasion (% of control) MitoSOX A R1 R3 Control sirna-fitc Romo1 sirna-fitc C Romo1 ROS R2 Control sirna-fitc R1 R4 R3 80 MitoSOX Control sirna Romo1 sirna *** D Romo1 β-actin Huh-7 Hep3B Huh-7 Control sirna Romo1 sirna 100 Romo1 Invasion R2 R ### *** B Huh-7 Romo1 sirna-fitc 0 Control sirna-fitc Romo1 sirna-fitc R1 R2 R3 R Control sirna Romo1 sirna *** ### Hep3B Control sirna Romo1 sirna *** MitoSOX Control sirna-fitc Romo1 sirna-fitc R1 R2 R3 R4 Control sirna Romo1 sirna *** ### E MCF-7 40 Huh-7 MMP-9 MitoSOX 20 0 R1 R2 R3 R4 Hep3B MMP-9 Decreased ROS levels and tumor invasion by Romo1 knockdown
46 No. of metastatic nodules Decreased ROS levels and tumor invasion by Romo1 knockdown F Control sirna Romo1 sirna *
47 Romo1 sirna Control sirna Fold of invaded cells Cell density (%) DCF-DA fluorescence (% of control) A B 5 min 15 min DMSO TPA DCF-DA Control sirna-fitc DMSO TPA DCF-DA Romo1 sirna-fitc * ## TPA (min) Ci + DMSO Ri + DMSO Ci + TPA Ri + TPA *** ** ### DMSO TPA TPA Romo1 ROS Invasion C MitoSOX MitoSOX 0 No treatment TPA TPA + NAC R1 R2 R3 R4 Control sirna Romo1 sirna ## *** 12.5 ### TPA NAC Blockage of TPA-induced ROS production and invasion by Romo1 knockdown
48 Relative luciferase activity (folds) Relative luciferase activity (folds) Relative luciferase activity (folds) TPA Romo1 Invasion D HepG2 MCF-7 TPA Control sirna NAC Romo1 sirna (nm) Control sirna Romo1 sirna (nm) MMP-9 MMP E *** ## HepG2 Huh-7 MCF-7 Control sirna Romo1 sirna ### # *** ## ### # ### *** ### ### Blockage of TPA-induced ROS production and invasion by Romo1 knockdown
49 Romo1 expression (% of control) DCF-DA fluorescence (% of control) A TPA (min) Romo1 β-actin TPA Romo1 ROS B TPA (min) TPA (min) Romo1 DCF-DA MitoTracker DAPI DAPI Merge Merge *** *** *** *** TPA (min) TPA (min) TPA-stimulated Romo1 expression and tumor invasion
50 Fold of invaded cells Romo1 Invasion C Flag-Romo1 Mock - NAC 5 mm NAC 20 mm Trolox 1 μm Trolox 10 μm D ** ### # ### ## E Mock Flag-Romo1 NAC (5 mm) NAC (20 mm) Trolox (1 μm) Trolox (10 μm) Flag β-actin Mock Flag-Romo1 NAC (5 mm) NAC (20 mm) + Trolox (1 μm) + Trolox (10 μm) TPA-stimulated Romo1 expression and tumor invasion
51 Conclusions - Romo1 is a promising biomarker for HCC diagnosis. - Control of Romo1 also provides a novel approach for the development of anti-cancer drugs that suppress the mitochondrial ROS production rather than eliminate up-regulated intracellular ROS.
52 Lab Members 박사과정정진실이소라이기영전임의 Dr 신정아 ( 강남세브란스 )
53 Collaborators Dr. 이기호 ( 원자력의학원 ) Dr. 김태우 ( 고려대의대 )
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin
NLRX1 β-actin 1 2 3 4 5 6 1 2 3 4 5 6 NLRX1 (667 bp) β-actin (523 bp) Supplementary Figure 1: Expression of NLRX1 in human cell lines. 1: HeLa, 2: HEK293T, 3: MCF-7, 4:Ramos, 5:Jurkat, 6: THP1. The following
RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-
1 a b Supplementary Figure 1. Effects of GSK3b knockdown on poly I:C-induced cytokine production. RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh- GSK3b) were stimulated
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
Supplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells
GASTROENTEROLOGY 2012;143:1084 1094 Overexpression of Romo1 Promotes Production of Reactive Oxygen Species and Invasiveness of Hepatic Tumor Cells JIN SIL CHUNG,* SUNHOO PARK, SEON HO PARK,* EUN RAN PARK,
(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)
Supplementary Figure Legends Figure S1. Tankyrase inhibition suppresses cell proliferation in an axin/β-catenin independent manner. (A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Mitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition
Supplementary Information Mitochondrial impairment triggers cytosolic oxidative stress and cell death following proteasome inhibition Sunita Maharjan, Masahide Oku, Masashi Tsuda, Jun Hoseki 2 & Yasuyoshi
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
Virchow s Hypothesis lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation
Virchow s Hypothesis 1863 lymphorecticular infiltration of cancer reflected the origin of cancer at sites of inflammation Barrett s esophagus/ Esophageal adenocarcinoma PSC / Cholangiocarcinoma Viral hepatitis
SUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure S1: Endogenous interaction between RNF2 and H2AX: Whole cell extracts from 293T were subjected to immunoprecipitation with anti-rnf2 or anti-γ-h2ax antibodies
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
PRESENT
SYSU-CHINA@iGEM PRESENT ipscs SafeGuard Fang Yiming He Dawei Zhao Yuchen Chen Haoqi Sun Mengyi Possibility of Regeneration 3 Promising Prospect in Medical Application 4 (http://www2.estrellamountain.edu/)
Endothelial cell aging
Endothelial cell aging Molekulare Präventivmedizin Molecular preventive medicine Judith (Jojo) Haendeler, PhD Leibniz Institut fuer Umweltmedizinische Forschung (IUF) Molecular Cell & Aging Research atherosclerosis
France Carrier, Ph.D. July 14, Chemopotentiation by Low Dose-Fractionated Radiation Therapy
France Carrier, Ph.D. July 14, 2016 Chemopotentiation by Low Dose-Fractionated Radiation Therapy Chemopotentiation by Low Dose-Fractionated Radiation Therapy Chemopotentiation by LDFRT is a novel treatment
Supplementary information
Supplementary information Exosomes mediate the cell-to-cell transmission of interferon alpha-induced antiviral activity Jianhua Li, Kuancheng Liu, Yang Liu, Yan Xu, Fei Zhang, Huijuan Yang, Jiangxia Liu,
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
NFκB What is it and What s the deal with radicals?
The Virtual Free Radical School NFκB What is it and What s the deal with radicals? Emily Ho, Ph.D Linus Pauling Institute Scientist Department of Nutrition and Food Management Oregon State University 117
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
SUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
Disclosures. Pathogenesis of Autoimmunity Normal immune response: 11/5/2011. Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis
Methotrexate and JUN Pathway Activation in Rheumatoid Arthritis Disclosures N. Olsen and T. Aune are co-founders of ArthroChip LLC. Nancy J. Olsen Penn State MS Hershey Medical Center Thomas M. Aune Vanderbilt
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Intolerance in Heart Failure
Novel Targets to Attack Exercise Intolerance in Heart Failure - Skeletal Muscle - Volker Adams, PhD ESC, Paris 3. Aug. 211 UNIVERSITÄT LEIPZIG H E R Z Z E N T R U M Nothing to disclose Myers et al. NEJM
Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Summary & conclusion
Summary & conclusion Cancer is the prime cause of death in developed countries and the second major cause of death in developing world. The early diagnosis is very crucial for the effective treatment of
Supplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-10-1-1029 TITLE: PRINCIPAL INVESTIGATOR: Mu-Shui Dai, M.D., Ph.D. CONTRACTING ORGANIZATION: Oregon Health Science niversity, Portland, Oregon 97239 REPORT DATE: October 2013 TYPE
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma.
Screening of novel thalidomide analogues with label-free assays and appling in the in vivo model of hepatocellular carcinoma Lajos István Nagy Ph.D thesis summary Supervisor: László Puskás, PhD, DSc Scientific
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
Downregulation of the c-myc target gene, peroxiredoxin III, contributes to Arsenic Trioxide-induced apoptosis in Acute Promyelocytic Leukemia (APL)
Downregulation of the c-myc target gene, peroxiredoxin III, contributes to Arsenic Trioxide-induced apoptosis in Acute Promyelocytic Leukemia (APL) Pablo E. Vivas-Mejía, Ph.D. Research Scientist, University
Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
Relative SOD1 activity. Relative SOD2 activity. Relative SOD activity (Infected:Mock) + CP + DDC
Supplementary Figure 1. SOD1 activity is significantly increased relative to SOD1 levels. SOD1 and SOD2 activities in the infected mork13 cells are shown normalised to their corresponding levels and relative
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α
Negative Regulation of c-myc Oncogenic Activity Through the Tumor Suppressor PP2A-B56α Mahnaz Janghorban, PhD Dr. Rosalie Sears lab 2/8/2015 Zanjan University Content 1. Background (keywords: c-myc, PP2A,
Supporting Information
Supporting Information Palmisano et al. 10.1073/pnas.1202174109 Fig. S1. Expression of different transgenes, driven by either viral or human promoters, is up-regulated by amino acid starvation. (A) Quantification
Introduction to pathology lecture 5/ Cell injury apoptosis. Dr H Awad 2017/18
Introduction to pathology lecture 5/ Cell injury apoptosis Dr H Awad 2017/18 Apoptosis = programmed cell death = cell suicide= individual cell death Apoptosis cell death induced by a tightly regulated
Is there a common mechanism of DILI, do we need to know?
Is there a common mechanism of DILI, do we need to know? Neil Kaplowitz, MD USC Research Center for Liver Disease Los Angeles, California IS THERE A COMMON MECHANISM OF DILI? ANSWER YES & NO Mechanisms
(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
shehab Moh Tarek ... ManarHajeer
3 shehab Moh Tarek... ManarHajeer In the previous lecture we discussed the accumulation of oxygen- derived free radicals as a mechanism of cell injury, we covered their production and their pathologic
Supplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
Cross-regulation of host STATs for the survival of Toxoplasma gondii
JITMM2010&IMC2010, 1-3 December 2010 Cross-regulation of host STATs for the survival of Toxoplasma gondii Ho-Woo Nam 1, Dong-Soo Kim 2, Sung-Jong Hong 3 Department of arasitology, College of Medicine,
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
Supplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
NIH Public Access Author Manuscript Clin Cancer Res. Author manuscript; available in PMC 2015 December 01.
NIH Public Access Author Manuscript Published in final edited form as: Clin Cancer Res. 2014 December 1; 20(23): 5866 5868. doi:10.1158/1078-0432.ccr-14-1543. p38 MAPK in Pancreatic Cancer: Finding a Protective
Rheumatoid arthritis: A heterogeneous disease with a heterogeneous response to treatment
Rheumatoid arthritis: A heterogeneous disease with a heterogeneous response to treatment Pr Pierre Miossec MD PhD Clinical Immunology Unit Hôpital Edouard Herriot Lyon miossec@univ-lyon1.fr Pathogenesis
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation
Role of Alpha-lipoic acid(ala) and statin in vascular smooth muscle cell proliferation In-kyu Lee, M.D., Ph. D. Dept. of Internal Med, Keimyung Univ., School of Med. Taegu, Korea Oxidative Stress and Atherosclerosis
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt
Supplementary Information CYLD Negatively Regulates Transforming Growth Factor-β Signaling via Deubiquitinating Akt Jae Hyang Lim, Hirofumi Jono, Kensei Komatsu, Chang-Hoon Woo, Jiyun Lee, Masanori Miyata,
Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi
Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;
Supporting Information. Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells
Supporting Information Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells Neha Kaushik, 1 Su Jae Lee, 2 Tae Gyu Choi 3, Ku Youn Baik,
Microglia, Inflammation, and FTD
FTD Minicourse April, 2009 Microglia, Inflammation, and FTD Li Gan, Ph.D Gladstone Institute of Neurological Disease University of California, San Francisco Outline Why study inflammation in neurodegeneration?
Hepatitis B virus X gene in the development of hepatocellular carcinoma. Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p.
Title Hepatitis B virus X gene in the development of hepatocellular carcinoma Author(s) Ma, NF; Lau, SH; Hu, L; Dong, SS; Guan, XY Citation Hong Kong Medical Journal, 2011, v. 17 n. 6, suppl. 6, p. 44-47
Alcoholic hepatitis is a drug-induced disorder
Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute
E3 ligase TRIM72 negatively regulates myogenesis by IRS-1 ubiquitination
E3 ligase negatively regulates myogenesis by IRS-1 ubiquitination Young-Gyu Ko College of Life Science and Biotechnology Korea University MyHC immunofluorescence Lipid rafts are plasma membrane compartments
ENHANCED NIR RADIATION-TRIGGERED HYPERTHERMIA BY MITOCHONDRIAL TARGETING
ENHANCED NIR RADIATION-TRIGGERED HYPERTHERMIA BY MITOCHONDRIAL TARGETING J. Am. Chem. Soc., 2015, 137, 3017-3023 Tanja Krainz Current Literature December 19, 2015 What is Hyperthermia? Hyperthermia (also
An Epstein-Barr virus-encoded microrna targets PUMA to promote host cell survival
An Epstein-Barr virus-encoded microrna targets to promote host cell survival The Journal of Experimental Medicine 205(11): 2551-2560, 2008. 1 Elizabeth Yee-Wai Choy, Kam-Leung Siu, Kin-Hang Kok, Raymond
C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein. pigment isolated from Spirulina platensis. This water- soluble protein pigment is
' ^Summary C-Phycocyanin (C-PC) is a n«sjfc&c- waefc-jduble phycobiliprotein pigment isolated from Spirulina platensis. This water- soluble protein pigment is of greater importance because of its various
Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma
Figure S1. The PDE5 inhibitor sildenafil interacts with celecoxib to kill cancer cell lines. (A) Hepatoma cells were treated with celecoxib ( 5.0 M) and/or sildenafil (, 2.0 M). ls were isolated after
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine
Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas
Wang et al. Journal of Hematology & Oncology (2016) 9:90 DOI 10.1186/s13045-016-0323-9 RESEARCH Bmi-1 regulates stem cell-like properties of gastric cancer cells via modulating mirnas Open Access Xiaofeng
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University
Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O
A. List of selected proteins with high SILAC (H/L) ratios identified in mass
Supplementary material Figure S1. Interaction between UBL5 and FANCI A. List of selected proteins with high SILAC (H/L) ratios identified in mass spectrometry (MS)-based analysis of UBL5-interacting proteins,
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
Reactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh
Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%
Grade of steatosis. group Case No. Supplementary Figure 1:
a Supplementary Figure 1: b group Case No Grade of steatosis 15m AL 2746 NN 1 15m AL 2746 BN 1 15m AL 2638 2LN 3 15m AL 2638 2RN 3 12m AL 2640 RN 0 12m AL 2640 BN 1 12m AL 2640 LN 2 12m AL 2635 NN 2 12m
Romo1 is a negative-feedback regulator of Myc
Author Correction Romo1 is a negative-feedback regulator of Myc Seung Baek Lee, Jung Jin Kim, Jin Sil Chung, Myeong-Sok Lee, Kee-Ho Lee, Byung Soo Kim and Young Do Yoo 124, 2512 2011. Published by The
Tissue Factor/PAR2 signaling enhances the malignancy and radiation resistance of lung cancer brain metastases
Tissue Factor/PAR2 signaling enhances the malignancy and radiation resistance of lung cancer brain metastases Dusten Unruh, PhD 8 th Annual Brain Metastases Research and Emerging Therapy Conference Tissue
Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer
RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Epstein-Barr virus driven promoter hypermethylated genes in gastric cancer J Yu *, KF To, QY Liang K e y M e s s a g e s 1. Somatostatin receptor 1
The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
High throughput screening of nanotoxicity based on oxidative stress paradigm
December 11 28 High throughput screening of nanotoxicity based on oxidative stress paradigm Saji George Dr Andre Nel s lab Dept. of Medicine (Division of Nanomedicine) UCLA December 11 28 Growing nanotech
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Peng Zhang 1, Michelle Yueqin Chen 1, Diana Caridha 1, William J. Smith 2 & Peter K. Chiang 1
Peng Zhang 1, Michelle Yueqin Chen 1, Diana Caridha 1, William J. Smith 2 & Peter K. Chiang 1 1 Walter Reed Army Institute of Research, 2 United States Army Medical Research Institute of Chemical Defense
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis. Midbrain Forebrain/ Forebrain/ Hindbrain Spinal cord Hindbrain Hindbrain
A Normal Exencephaly Craniora- Spina bifida Microcephaly chischisis NTD Number of embryos % among NTD Embryos Exencephaly 52 74.3% Craniorachischisis 6 8.6% Spina bifida 5 7.1% Microcephaly 7 1% B Normal
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
High Content Imaging : Meaningful pictures for relevant results in dermocosmetology
High Content Imaging : Meaningful pictures for relevant results in dermocosmetology We deliver High Content screening services with exhaustive, high quality and robust phenotypic data. Nathalie MAUBON,
Nature Immunology doi: /ni.3268
Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,
Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts
Effects of the angiotensin II type-1 receptor antagonist telmisartan on endothelial activation induced by advanced glycation endproducts Serena Del Turco, Teresa Navarra, Giuseppina Basta, Raffaele De
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD
SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances
Supplementary Figure 1
Supplementary Figure 1 Expression of apoptosis-related genes in tumor T reg cells. (a) Identification of FOXP3 T reg cells by FACS. CD45 + cells were gated as enriched lymphoid cell populations with low-granularity.
SUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research
Abhd2 regulates alveolar type Ⅱ apoptosis and airway smooth muscle remodeling: a key target of COPD research Shoude Jin Harbin Medical University, China Background COPD ------ a silent killer Insidious,
Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
University of Windsor Scholarship at UWindsor UWill Discover Undergraduate Conference UWill Discover 2016 Mar 29th, 4:00 PM - 5:00 PM Exploring a Link Between Spy1 and Hepatocellular Carcinoma Progression
Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
Chapter 1: Curcumin is excellent compound for various medicinal usages
Super-Curcumin Story Chapter 1: Curcumin is excellent compound for various medicinal usages Chapter 2: Discovery of Super-Curcumin analog Chapter 3: Anti-tumor activities of Super-Curcumin analog Chapter
Supplementary Information
Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori,
: Ajou University College of Medicine, Suwon, Korea; Ajou University College of Medicine, Graduate
CURRICULUM VITAE NAME Hyun Woo Lee, M.D. EDUCATION 1991.3.-2001.2 : Ajou University College of Medicine, Suwon, Korea; Doctor of Medicine 2004.3-2006.2 Ajou University College of Medicine, Graduate School,