Assembly and Annotation of
|
|
|
- Hope Clarke
- 6 years ago
- Views:
Transcription
1 Assembly and Annotation of Mycobacterium avium subsp. paratuberculosis Typ-III Martin Hölzer RNA Bioinformatics and High Throughput Analysis Friedrich-Schiller-University Jena 14. Februar 2014
2 Schedule Introduction Assembly Improvement Genome Annotation Proteins ncrnas 2 / 14
3 Mycobacterium avium ssp. paratuberculosis, MAP Genome: 4.8 Mbp, GC: 69 % slow growing (several months) MAP are obligate pathogenic agent of paratuberculosis in cattle (and also sheep) clinical similarities between paratuberculosis and inflammatory bowel disease in human 3 MAP types: I, II, III MAP strains highly diverse between types 3 / 14
4 Mycobacterium Genus MAC (Mycobacterium avium complex) MTC (Mycobacterium tuberculosis complex) Species Mycobacterium avium (M.a.) Mycobacterium tuberculosis Subspecies Type Strain MAP bovine Typ II M.a. subsp. paratuberculosis (MAP) Typ III MAP ovine M.a. subsp. hominissius (MAH) Typ I K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con 104 full Host 4 / 14
5 Mycobacterium Genus MAC (Mycobacterium avium complex) MTC (Mycobacterium tuberculosis complex) Species Mycobacterium avium (M.a.) Mycobacterium tuberculosis Subspecies Type Strain MAP bovine Typ II M.a. subsp. paratuberculosis (MAP) Typ III MAP ovine M.a. subsp. hominissius (MAH) Typ I K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con 104 full Host 4 / 14
6 MAC (Mycobacterium avium complex) MAP bovine Mycobacterium Mycobacterium avium (M.a.) M.a. subsp. paratuberculosis (MAP) MTC (Mycobacterium tuberculosis complex) MAP ovine Mycobacterium tuberculosis Typ II Typ III Typ I/III M.a. subsp. hominissius (MAH) K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con 104 full Workflow Illumina Sequencing (2 libraries: pe, mate) Assembly CLC Genomic Workbench SSPACE Gap closing (Sanger) Velvet SPAdes ABySS JR Assembler Species Genus Related Genomes Initial Assembly (14 Scaffs) Clustered Assembly (cd hit est) Strain Type Subspecies Final Assembly (6 Scaffs) Genome comparison (Mauve) Protein Annotation ncrna Annotation Comparison MAP JIII-386 BLAST lift over Merged Annotation BacProt GORAP trnascan SE Infernal Bcheck RNAmmer Annotation MAP K-10' 5 / 14
7 MAP JIII-386 MAP K-10' CLC Genomic Workbench SSPACE Gap closing (Sanger) Initial Assembly (14 Scaffs) Genome comparison (Mauve) Illumina Sequencing (2 libraries: pe, mate) Final Assembly Velvet SPAdes Protein Annotation BLAST lift over Clustered Assembly Merged Annotation (6 Scaffs) BacProt ABySS JR Assembler (cd hit est) Subspecies Species Genus Type Strain Related Genomes Mycobacterium MAC MTC (Mycobacterium avium complex) (Mycobacterium tuberculosis complex) Mycobacterium avium (M.a.) M.a. subsp. paratuberculosis (MAP) Mycobacterium tuberculosis MAP bovine MAP ovine Typ II Typ III Typ I/III M.a. subsp. hominissius (MAH) K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con ncrna Annotation trnascan SE Bcheck GORAP Infernal RNAmmer 104 full MAP genome assembly: Overview Illumina Sequencing (2 Assembly Comparison Annotation Assembly CLC Genomic Workbench SSPACE Gap closing (Sanger) V S Initial Assembly (14 Scaffs) Clu 6 / 14 Final Assembl
8 MAP JIII-386 MAP K-10' CLC Genomic Workbench SSPACE Gap closing (Sanger) Initial Assembly (14 Scaffs) Genome comparison (Mauve) Illumina Sequencing (2 libraries: pe, mate) Final Assembly Velvet SPAdes Protein Annotation BLAST lift over Clustered Assembly Merged Annotation (6 Scaffs) BacProt ABySS JR Assembler (cd hit est) Subspecies Species Genus Type Strain Related Genomes Mycobacterium MAC MTC (Mycobacterium avium complex) (Mycobacterium tuberculosis complex) Mycobacterium avium (M.a.) M.a. subsp. paratuberculosis (MAP) Mycobacterium tuberculosis MAP bovine MAP ovine Typ II Typ III Typ I/III M.a. subsp. hominissius (MAH) K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con ncrna Annotation trnascan SE Bcheck GORAP Infernal RNAmmer 104 full MAP genome assembly: Overview Illumina Sequencing (2 libraries: pe, mate) mic Workbench PACE Assembly osing (Sanger) Comparison Annotation Velvet SPAdes ABySS JR Assembler Genus Species Relate Genom Mycobacteri MAC (Mycobacterium avium complex) (M Mycobacterium avium (M.a.) bly (14 Scaffs) Clustered Assembly (cd hit est) Subspecies Type Strain M.a. subsp. paratuberculosis (MAP) MAP bovine M Typ II Typ III K 10 K 10 MAP4 JII 1961 JIII 38 full full full full 6 scaff 6 / 14 Final Assembly (6 Scaffs)
9 MAP genome assembly: Statistics Assembler # Con. # Con.>1000 bp max Con. N50 CLC ,629 80,173 SSPACE , ,438 Sanger (gap closing) ,505,746 1,245,182 7 / 14
10 MAP genome assembly: Statistics Assembler # Con. # Con.>1000 bp max Con. N50 CLC ,629 80,173 SSPACE , ,438 Sanger (gap closing) ,505,746 1,245,182 ABySS ,951 14,188 Velvet ,963 6,400 SPAdes ,924 23,648 JR-Assembler ,282 14,005 7 / 14
11 MAP genome assembly: Statistics Assembler # Con. # Con.>1000 bp max Con. N50 CLC ,629 80,173 SSPACE , ,438 Sanger (gap closing) ,505,746 1,245,182 ABySS ,951 14,188 Velvet ,963 6,400 SPAdes ,924 23,648 JR-Assembler ,282 14,005 7 / 14
12 MAP genome assembly: Statistics Assembler # Con. # Con.>1000 bp max Con. N50 CLC ,629 80,173 SSPACE , ,438 Sanger (gap closing) ,505,746 1,245,182 ABySS ,951 14,188 Velvet ,963 6,400 SPAdes ,924 23,648 JR-Assembler ,282 14,005 Cluster (cd-hit-est) ,924 23,046 7 / 14
13 MAP genome assembly: Improvement 8 / 14
14 MAP genome assembly: Improvement 9 / 14
15 MAP genome assembly: Improvement Final Assembly Scaffold Length bp S01 1,505,968 S02 1,245,802 S03 869,609 S04 591,024 S05 545,230 S06 92,641 9 / 14
16 MAP JIII-386 MAP K-10' CLC Genomic Workbench SSPACE Gap closing (Sanger) Initial Assembly (14 Scaffs) Genome comparison (Mauve) Illumina Sequencing (2 libraries: pe, mate) Final Assembly Velvet SPAdes Protein Annotation BLAST lift over Clustered Assembly Merged Annotation (6 Scaffs) BacProt ABySS JR Assembler (cd hit est) Subspecies Species Genus Type Strain Related Genomes Mycobacterium MAC MTC (Mycobacterium avium complex) (Mycobacterium tuberculosis complex) Mycobacterium avium (M.a.) M.a. subsp. paratuberculosis (MAP) Mycobacterium tuberculosis MAP bovine MAP ovine Typ II Typ III Typ I/III M.a. subsp. hominissius (MAH) K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con ncrna Annotation trnascan SE Bcheck GORAP Infernal RNAmmer 104 full nitial Assembly (14 Scaffs) Clustered Assembly MAP genome annotation: Proteins (cd hit est) Final Assembly (6 Scaffs) e comparison (Mauve) Protein Annotation ncrna A Assembly BLAST lift over BacProt GO Comparison Annotation trnascan SE Merged Annotation Bcheck 10 / 14
17 MAP genome annotation: Proteins NCBI based / 14
18 MAP genome annotation: Proteins BacProt NCBI based / 14
19 MAP genome annotation: Proteins BacProt overall 3,568 proteins with known function annotated in MAP sheep strain 501 NCBI based 11 / 14
20 MAP genome annotation: Proteins BacProt overall 3,568 proteins with known function annotated in MAP sheep strain NCBI based 501 additionally we extended the NCBI annotations for other MAP strains using BacProt 11 / 14
21 MAP JIII-386 MAP K-10' CLC Genomic Workbench SSPACE Gap closing (Sanger) Initial Assembly (14 Scaffs) Genome comparison (Mauve) Illumina Sequencing (2 libraries: pe, mate) Final Assembly Velvet SPAdes Protein Annotation BLAST lift over Clustered Assembly Merged Annotation (6 Scaffs) BacProt ABySS JR Assembler (cd hit est) Subspecies Species Genus Type Strain Related Genomes MAC MTC (Mycobacterium avium complex) (Mycobacterium tuberculosis complex) MAP bovine Mycobacterium Mycobacterium avium (M.a.) M.a. subsp. paratuberculosis (MAP) MAP ovine Mycobacterium tuberculosis Typ II Typ III Typ I/III M.a. subsp. hominissius (MAH) K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con ncrna Annotation trnascan SE Bcheck GORAP Infernal RNAmmer 104 full Clustered Assembly (cd hit est) MAP genome annotation: ncrnas Type Subspec Strain M.a. subsp. paratuberculosis M.a. subsp. hominissius (MAP) (MAH) MAP bovine MAP ovine 104 full Typ II Typ III Typ I/III K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con Final Assembly (6 Scaffs) Protein Annotation ncrna Annotation BLAST lift over Assembly Comparison BacProt Annotation trnascan SE GORAP Infernal Annotation Merged Annotation Bcheck RNAmmer 12 / 14
22 MAP genome annotation: ncrnas 46 trnas, including 3 Metand 1 SeC-tRNA 13 / 14
23 MAP genome annotation: ncrnas 46 trnas, including 3 Metand 1 SeC-tRNA all other housekeeping ncrnas (rrnas, tmrna, RNase P,...) 13 / 14
24 MAP genome annotation: ncrnas 46 trnas, including 3 Metand 1 SeC-tRNA all other housekeeping ncrnas (rrnas, tmrna, RNase P,...) one third of known riboswitches present in our sheep strain 13 / 14
25 MAP genome annotation: ncrnas 46 trnas, including 3 Metand 1 SeC-tRNA all other housekeeping ncrnas (rrnas, tmrna, RNase P,...) one third of known riboswitches present in our sheep strain other ncrnas ncrna copies 6C 1 Actino-pnp 1 mraw 2 PyrR 1 ASdes 3 ASpks 3 F6 1 G2 1 AS / 14
26 MAP genome annotation: ncrnas 46 trnas, including 3 Metand 1 SeC-tRNA all other housekeeping ncrnas (rrnas, tmrna, RNase P,...) one third of known riboswitches present in our sheep strain other ncrnas ncrna copies 6C 1 Actino-pnp 1 mraw 2 PyrR 1 ASdes 3 ASpks 3 F6 1 G2 1 AS / 14
27 Thank you for your attention! Thanks to JProf. Dr. Manja Marz and all group members! RNA BIOINFORMATICS AND HIGH THROUGHPUT ANALYSIS FRIEDRICH-SCHILLER- UNIVERSITY JENA 14 / 14
28 MAP genome assembly: Improvement Replacements (low complexity regions) Extensions Insertion/Removement of 8 short scaffolds Final Assembly Scaffold Length bp S01 1,505,968 S02 1,245,802 S03 869,609 S04 591,024 S05 545,230 S06 92, / 14
29 MAP JIII-386 MAP K-10' CLC Genomic Workbench SSPACE Gap closing (Sanger) Initial Assembly (14 Scaffs) Genome comparison (Mauve) Illumina Sequencing (2 libraries: pe, mate) Final Assembly Velvet SPAdes Protein Annotation BLAST lift over Clustered Assembly Merged Annotation (6 Scaffs) BacProt ABySS JR Assembler (cd hit est) Subspecies Species Genus Type Strain Related Genomes Mycobacterium MAC MTC (Mycobacterium avium complex) (Mycobacterium tuberculosis complex) Mycobacterium avium (M.a.) M.a. subsp. paratuberculosis (MAP) Mycobacterium tuberculosis MAP bovine MAP ovine Typ II Typ III Typ I/III M.a. subsp. hominissius (MAH) K 10 K 10 MAP4 JII 1961 JIII 386 S397 CLIJ361 full full full full 6 scaff 176 con 1147 con ncrna Annotation trnascan SE Bcheck GORAP Infernal RNAmmer 104 full Final Assem Initial Assembly MAP genome comparison: Overview (14 Scaffs) C Genome comparison (Mauve) Protein Assembly Comparison Annotation Comparison MAP JIII-386 BLAST lift over Merged MAP K-10' 14 / 14
30 Mauve: Genome comparison MAP JIII-386 MAP K-10' Same subsp.: however many genomic rearrangements as aspected 14 / 14
Transcriptome Analysis
Transcriptome Analysis Data Preprocessing Sample Preparation Illumina Sequencing Demultiplexing Raw FastQ Reference Genome (fasta) Reference Annotation (GTF) Reference Genome Analysis Tophat Accepted hits
M. tuberculosis as seen from M. avium.
M. tuberculosis as seen from M. avium Marcel A. Behr marcel.behr@mcgill.ca www.molepi.mcgill.ca Overview Classic view of M. tuberculosis Reductive genomics M. avium work Evidence for horizontal gene transfer
Sebastian Jaenicke. trnascan-se. Improved detection of trna genes in genomic sequences
Sebastian Jaenicke trnascan-se Improved detection of trna genes in genomic sequences trnascan-se Improved detection of trna genes in genomic sequences 1/15 Overview 1. trnas 2. Existing approaches 3. trnascan-se
Non-messenger RNAs. Karin Lagesen
Non-messenger RNAs Karin Lagesen Outline RNA is not DNA Kinds of non-messenger RNAs sirna, mirna trnas, rrnas ncrnas: Finding non-messenger RNA trnascan-se, RNammer RFAM RNA basepairing RNA is not DNA
Small RNA-Seq and profiling
Small RNA-Seq and profiling Y. Hoogstrate 1,2 1 Department of Bioinformatics & Department of Urology ErasmusMC, Rotterdam 2 CTMM Translational Research IT (TraIT) BioSB: 5th RNA-seq data analysis course,
Nature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
Mycobacterium avium in the Postgenomic Era
CLINICAL MICROBIOLOGY REVIEWS, Apr. 2007, p. 205 229 Vol. 20, No. 2 0893-8512/07/$08.00 0 doi:10.1128/cmr.00036-06 Copyright 2007, American Society for Microbiology. All Rights Reserved. Mycobacterium
Phylogenomics. Antonis Rokas Department of Biological Sciences Vanderbilt University.
Phylogenomics Antonis Rokas Department of Biological Sciences Vanderbilt University http://as.vanderbilt.edu/rokaslab High-Throughput DNA Sequencing Technologies 454 / Roche 450 bp 1.5 Gbp / day Illumina
Transmission of M. chimaera and differentiation to species level of M. avium complex. Donald Busalacchi B.S. Microbiologist- WSLH
Transmission of M. chimaera and differentiation to species level of M. avium complex Donald Busalacchi B.S. Microbiologist- WSLH Mycobacterium Chimaera A non-tuberculosis mycobacterium, member of the M.
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?"
How to Standardise and Assemble Raw Data into Sequences: What Does it Mean for a Laboratory to Use Such Technologies?" Dr Joseph Hughes 11th OIE Seminar Saskatoon - 17th June 2015 Cost per raw Megabase
Eukaryotic small RNA Small RNAseq data analysis for mirna identification
Eukaryotic small RNA Small RNAseq data analysis for mirna identification P. Bardou, C. Gaspin, S. Maman, J. Mariette, O. Rué, M. Zytnicki INRA Sigenae Toulouse INRA MIA Toulouse GenoToul Bioinfo INRA MaIAGE
Ambient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
TB Updates for the Physician Rochester, Minnesota June 19, 2009
TB Updates for the Physician Rochester, Minnesota June 19, 2009 Mycobacterial Laboratory Science Update Nancy L. Wengenack, Ph.D. Associate Professor of Laboratory Medicine and Pathology Division of Clinical
Bovine TB: the science-policy challenges
Bovine TB: the science-policy challenges Content England s TB strategy The TB problem Controlling the problem What would success look like? Measuring success 2 England s Bovine TB Strategy Aims to: Achieve
High-throughput transcriptome sequencing
High-throughput transcriptome sequencing Erik Kristiansson (erik.kristiansson@zool.gu.se) Department of Zoology Department of Neuroscience and Physiology University of Gothenburg, Sweden Outline Genome
VIP: an integrated pipeline for metagenomics of virus
VIP: an integrated pipeline for metagenomics of virus identification and discovery Yang Li 1, Hao Wang 2, Kai Nie 1, Chen Zhang 1, Yi Zhang 1, Ji Wang 1, Peihua Niu 1 and Xuejun Ma 1 * 1. Key Laboratory
High Throughput Sequence (HTS) data analysis. Lei Zhou
High Throughput Sequence (HTS) data analysis Lei Zhou (leizhou@ufl.edu) High Throughput Sequence (HTS) data analysis 1. Representation of HTS data. 2. Visualization of HTS data. 3. Discovering genomic
Whole-Genome Plasticity among Mycobacterium avium Subspecies: Insights from Comparative Genomic Hybridizations
JOURNAL OF BACTERIOLOGY, Jan. 2006, p. 711 723 Vol. 188, No. 2 0021-9193/06/$08.00 0 doi:10.1128/jb.188.2.711 723.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Whole-Genome
VirusDetect pipeline - virus detection with small RNA sequencing
VirusDetect pipeline - virus detection with small RNA sequencing CSC webinar 16.1.2018 Eija Korpelainen, Kimmo Mattila, Maria Lehtivaara Big thanks to Jan Kreuze and Jari Valkonen! Outline Small interfering
Johne's Disease Interpretations
Johne's Disease s Johne s Disease Antibody ELISAs Valuable diagnostic information can be gained from quantitative interpretation of the Johne's ELISA. In general, the ELISA value is a measure of the concentration
P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( 鄧致剛 ); g ( 黄栢榕 ) Bioinformatics Center, Chang Gung University.
Small RNA High Throughput Sequencing Analysis I P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( 鄧致剛 ); g ( 黄栢榕 ) Bioinformatics Center, Chang Gung University. Prominent members of the RNA family Classic RNAs mediating
Small RNA Sequencing. Project Workflow. Service Description. Sequencing Service Specification BGISEQ-500 SERVICE OVERVIEW SAMPLE PREPARATION
BGISEQ-500 SERVICE OVERVIEW Small RNA Sequencing Service Description Small RNAs are a type of non-coding RNA (ncrna) molecules that are less than 200nt in length. They are often involved in gene silencing
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES
OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria
DNA Sequence Bioinformatics Analysis with the Galaxy Platform
DNA Sequence Bioinformatics Analysis with the Galaxy Platform University of São Paulo, Brazil 28 July - 1 August 2014 Dave Clements Johns Hopkins University Robson Francisco de Souza University of São
Transcript reconstruction
Transcript reconstruction Summary I Data types, file formats and utilities Annotation: Genomic regions Genes Peaks bedtools Alignment: Map reads BAM/SAM Samtools Aggregation: Summary files Wig (UCSC) TDF
Mycobacterium avium subsp. paratuberculosis
Mycobacterium avium subsp. paratuberculosis Document date: January 2002 1.- INTRODUCTION The Mycobacteriaceae family, although only made up of the genus Mycobacterium, includes numerous species widely
Assembling complete genomes for oral pathogens and methanogens. Mia Sales, Undergraduate Research Assistant
Assembling complete genomes for oral pathogens and methanogens Mia Sales, Undergraduate Research Assistant Jensen Lab Department of Bioengineering and Carl R. Woese Institute for Genomic Biology University
P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Islamic University Faculty of Medicine
Islamic University Faculty of Medicine 2012 2013 2 RNA is a modular structure built from a combination of secondary and tertiary structural motifs. RNA chains fold into unique 3 D structures, which act
Profiling micrornas in lung tissue from pigs infected with Actinobacillus pleuropneumoniae
Podolska et al. BMC Genomics 2012, 13:459 RESEARCH ARTICLE Open Access Profiling micrornas in lung tissue from pigs infected with Actinobacillus pleuropneumoniae Agnieszka Podolska 1,2, Christian Anthon
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Understanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry
Understanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry Timothy J. Johnson A, Lisa K. Nolan B, and Darrell W. Trampel C A University of Minnesota, Department of Veterinary
S. Wesley Long, MD, PhD
Basic Molecular Microbiology: A Practical Case-Based Approach S. Wesley Long, MD, PhD Center for Molecular and Translational Human Infectious Diseases Research Houston Methodist Research Institute September
Arabidopsis thaliana small RNA Sequencing. Report
Arabidopsis thaliana small RNA Sequencing Report September 2015 Project Information Client Name Client Company / Institution Macrogen Order Number Order ID Species Arabidopsis thaliana Reference UCSC hg19
ITS accuracy at GenBank. Conrad Schoch Barbara Robbertse
ITS accuracy at GenBank Conrad Schoch Barbara Robbertse Improving accuracy Barcode tag in GenBank Barcode submission tool Standards RefSeq Targeted Loci Well validated sequences already in GenBank Bacteria
Hao D. H., Ma W. G., Sheng Y. L., Zhang J. B., Jin Y. F., Yang H. Q., Li Z. G., Wang S. S., GONG Ming*
Comparison of transcriptomes and gene expression profiles of two chilling- and drought-tolerant and intolerant Nicotiana tabacum varieties under low temperature and drought stress Hao D. H., Ma W. G.,
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
Mycobacterium tuberculosis
Mycobacterium tuberculosis Mycobacterium tuberculosis Ø aerobic Gram-positive bacillus Ø grow in the cell of host organism Ø the pathogen causes tuberculosis Ø asymptomatic and latent infections Ø can
SUPPLEMENTARY INFORMATION
ARTICLE NUMBER: 16198 DOI: 10.1038/NMICROBIOL.2016.198 Genome reduction in an abundant and ubiquitous soil bacterium, Candidatus Udaeobacter copiosus Tess E Brewer 1, 2, Kim M Handley 3, Paul Carini 1,
California Leafy Greens Research Program April 1, 2014 to March 31, 2015
California Leafy Greens Research Program April 1, 2014 to March 31, 2015 Project Title: Development of management strategies for Bacterial Leaf Spot of Lettuce. Principle investigator: Carolee Bull, USDA/ARS,
Surface antigens of Mycobacterium avium subsp. paratuberculosis (MAP): Implications for Johne's disease (JD) diagnosis and pathogenesis
Surface antigens of Mycobacterium avium subsp. paratuberculosis (MAP): Implications for Johne's disease (JD) diagnosis and pathogenesis Ashutosh Wadhwa, Ph. D. Candidate Center for Wildlife Health, Department
Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures
: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com
Appendix 81. From OPENFLU to OPENFMD. Open Session of the EuFMD: 2012, Jerez de la Frontera, Spain 1. Conclusions and recommendations
From OPENFLU to OPENFMD a resource for automatic and curated nomenclature and tools for the FMD community Filip Claes, Philippe Le Mercier, Dmitry Kuznetsov, Robin Liechti, Anne Gleizes, Ioannis Xenarios,
Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
Sequencing as a Typing Tool
Sequencing as a Typing Tool 6/4/2018 RCPA Workshop Ms Leah Roberts PhD candidate University of Queensland Outline Sequencing in response to outbreaks Sequencing to characterise complex regions Sequencing
De Novo Viral Quasispecies Assembly using Overlap Graphs
De Novo Viral Quasispecies Assembly using Overlap Graphs Alexander Schönhuth joint with Jasmijn Baaijens, Amal Zine El Aabidine, Eric Rivals Milano 18th of November 2016 Viral Quasispecies Assembly: HaploClique
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
Title. CitationGenome Announcements, 4(4): e Issue Date Doc URL. Rights. Type. File Information.
Title Draft Genome Sequences of Legionella pneumophila JR3 Maita, Chinatsu; Matushita, Mizue; Okubo, Torahiko; Author(s) Hiroyuki CitationGenome Announcements, 4(4): e00791-16 Issue Date 2016-08-04 Doc
Data mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
APHL Next Generation Sequencing (NGS) Survey
Next Generation Sequencing 1. How long has your lab had a sequencer? [If lab does not have a sequencer go to 1a1 through 1a3 and then end survey] [If lab does have a sequencer continue to 1a and the rest
Peak-calling for ChIP-seq and ATAC-seq
Peak-calling for ChIP-seq and ATAC-seq Shamith Samarajiwa CRUK Autumn School in Bioinformatics 2017 University of Cambridge Overview Peak-calling: identify enriched (signal) regions in ChIP-seq or ATAC-seq
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
RIP-seq of BmAgo2-associated small RNAs reveal various types of small non-coding RNAs in the silkworm, Bombyx mori
Nie et al. BMC Genomics 2013, 14:661 RESEARCH ARTICLE Open Access RIP-seq of BmAgo2-associated small RNAs reveal various types of small non-coding RNAs in the silkworm, Bombyx mori Zuoming Nie 1, Fang
Identifying mirnas in RNA viruses
1 / 13 Identifying mirnas in RNA viruses Kevin Lamkiewicz Friedrich Schiller Universität Jena 16.02.2017 32nd TBI Winterseminar Bled 2 / 13 mirnas and their function U C A C A G G U C A A G C G U U G G
IDENTIFICATION OF IN SILICO MIRNAS IN FOUR PLANT SPECIES FROM FABACEAE FAMILY
Original scientific paper 10.7251/AGRENG1803122A UDC633:34+582.736.3]:577.2 IDENTIFICATION OF IN SILICO MIRNAS IN FOUR PLANT SPECIES FROM FABACEAE FAMILY Bihter AVSAR 1*, Danial ESMAEILI ALIABADI 2 1 Sabanci
Molecular Detection of Mycobacterium bovis and Other Mycobacteria in Soil
Part 2 Molecular detection techniques and problems of quantification Molecular Detection of Mycobacterium bovis and Other Mycobacteria in Soil Pathogen reservoirs Case study 1: Detection of enteric bacteria.
Ulrike Lambertz 1, Mariana E Oviedo Ovando 2, Elton JR Vasconcelos 3, Peter J Unrau 2, Peter J Myler 3,4 and Neil E Reiner 1*
Lambertz et al. BMC Genomics (2015) 16:151 DOI 10.1186/s12864-015-1260-7 RESEARCH ARTICLE Open Access Small RNAs derived from trnas and rrnas are highly enriched in exosomes from both old and new world
New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations
New York State Health Department's experience with implementing Whole Genome Cluster Analysis for Salmonella outbreak investigations William Wolfgang Wadsworth Center NYSDOH InForm 2013 11/20/13 Current
omiras: MicroRNA regulation of gene expression
omiras: MicroRNA regulation of gene expression Sören Müller, Goethe University of Frankfurt am Main Molecular Bioinformatics Group, Institute of Computer Science Plant Molecular Biology Group, Institute
Serodiagnostics of paratuberculosis Kari R. Lybeck
Serodiagnostics of paratuberculosis Kari R. Lybeck Photo: Birte Graeber Paratuberculosis Paratuberculosis Mycobacterium avium subsp. paratuberculosis (MAP) Chronic, granulomatous enteritis and lymphadenitis
Framework for the evaluation of. and scientific impacts of plant viruses. technologies.
Framework for the evaluation of biosecurity, commercial, regulatory and scientific impacts of plant viruses and viroids identified by NGS technologies. Sebastien Massart, Thierry Candresse, José Gil, Christophe
Review: Genome assembly Reads
Assembly validation Review: Genome assembly Reads Contigs Scaffolds Chromosome Review: Mate pair data Overlap-Layout-Consensus AMOS project: A Modular Open Source assembler Importing data to an AMOS bank
RNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
A study of the biological and financial impact of OJD in affected sheep flocks in NSW
PHD RESEARCH STUDENTS A study of the biological and financial impact of OJD in affected sheep flocks in NSW Mr Russell Bush Research support: Meat and Livestock Australia. Supervisors: Dr JA Toribio, Dr
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
HOST-PARASITE INTERPLAY
HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome
ESCMID Online Lecture by author
Molecular typing as a tool for the control of MDR and XDR organisms. Whole genome sequencing - already here? Martin Llewelyn Reader, Consultant Brighton and Sussex Medical School, UK m.j.llewelyn@bsms.ac.uk
In This Issue. News. Research. Workman, Jeffrey D. Update Highly Pathogenic Avian Influenza
Workman, Jeffrey D. Subject: Ohio Veterinary Newsletter Vol 41 No 14 OHIO STATE UNIVERSITY EXTENSION OHIO VETERINARY NEWSLETTER July 2, 2015 Veterinary Extension Vol 41, No 14 In This Issue News HPAI Update
Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and Worldwide.
Page 1 of 32 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and Worldwide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
NEW YORK STATE DEPARTMENT OF HEALTH CLINICAL LABORATORY EVALUATION PROGRAM
Any standards not addressed here remain in effect. (changes are underlined) Sustaining Standard of Practice 8 (TB S8): Laboratories testing only Smears- Specimen Submission and Result Notification Laboratories
Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine
CLINICAL MICROBIOLOGY REVIEWS, July 2001, p. 489 512 Vol. 14, No. 3 0893-8512/01/$04.00 0 DOI: 10.1128/CMR.14.3.489 512.2001 Copyright 2001, American Society for Microbiology. All Rights Reserved. Mycobacterium
Overview: Chapter 19 Viruses: A Borrowed Life
Overview: Chapter 19 Viruses: A Borrowed Life Viruses called bacteriophages can infect and set in motion a genetic takeover of bacteria, such as Escherichia coli Viruses lead a kind of borrowed life between
Tuberculosis and Johne s Disease
Tuberculosis and Johne s Disease Prof. R. S. Chauhan Joint Director, Indian Veterinary Research Institute Izatnagar 243 122 (India) TUBERCULOSIS Tuberculosis is a chronic bacterial disease of animals caused
Animal Disease Reporting for the month May 2016
Animal Disease Reporting for the month May 2016 Sub-Directorate Epidemiology Directorate Animal Health 05 August 2016 Introduction According to the Animal Diseases Act (Act 35 of 1984) Controlled and Notifiable
ChIP-seq data analysis
ChIP-seq data analysis Harri Lähdesmäki Department of Computer Science Aalto University November 24, 2017 Contents Background ChIP-seq protocol ChIP-seq data analysis Transcriptional regulation Transcriptional
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
Molecular Epidemiology of Tuberculosis. Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis
Molecular Epidemiology of Tuberculosis Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis Overview TB transmission and pathogenesis Genotyping methods Genotyping for clinical management
RNA- seq Introduc1on. Promises and pi7alls
RNA- seq Introduc1on Promises and pi7alls RNA gives informa1on on which genes that are expressed How DNA get transcribed to RNA (and some1mes then translated to proteins) varies between e. g. - Tissues
Characterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula
Characterizing the Respiratory Microbiome of Commercial Broilers on the Delmarva Peninsula Kelly Mulholland 1,2, Calvin Keeler, Jr. 2, Sharon J. Keeler 2 and Monique Robinson 2 1 Center for Bioinformatics
DNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
Clinical utility of NGS for the detection of HIV and HCV resistance
18 th Annual Resistance and Antiviral Therapy Meeting v Professor Janke Schinkel Academic Medical Centre, Amsterdam, The Netherlands Thursday 18 September 2014, Royal College of Physicians, London Clinical
Human Genome Complexity, Viruses & Genetic Variability
Human Genome Complexity, Viruses & Genetic Variability (Learning Objectives) Learn the types of DNA sequences present in the Human Genome other than genes coding for functional proteins. Review what you
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
New Insights on the Structure of the Human Gut Microbiota. Chaysavanh Manichanh, PhD Vall d Hebron Research Institute Barcelona
New Insights on the Structure of the Human Gut Microbiota Chaysavanh Manichanh, PhD Vall d Hebron Research Institute Barcelona Sessio Societat Catalana Malalties Infecciosas i Microbiologia March 20th,
Next-generation sequencing for virus detection: covering all the bases
Visser et al. Virology Journal (2016) 13:85 DOI 10.1186/s12985-016-0539-x SHORT REPORT Open Access Next-generation sequencing for virus detection: covering all the bases Marike Visser 1,2, Rachelle Bester
Genome Scale Comparison of Mycobacterium avium subsp. paratuberculosis with Mycobacterium avium subsp. avium Reveals Potential Diagnostic Sequences
JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2002, p. 1303 1310 Vol. 40, No. 4 0095-1137/02/$04.00 0 DOI: 10.1128/JCM.40.4.1303 1310.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.
Genetic diversity of Mycobacterium avium subspecies paratuberculosis and the influence of strain type on infection and pathogenesis: a review
Stevenson Veterinary Research (2015) 46:64 DOI 10.1186/s13567-015-0203-2 VETERINARY RESEARCH REVIEW Open Access Genetic diversity of Mycobacterium avium subspecies paratuberculosis and the influence of
The transfer RNA genes in Oryza sativa L. ssp. indica
Vol. 45 No. 5 SCIENCE IN CHINA (Series C) October 2002 The transfer RNA genes in Oryza sativa L. ssp. indica WANG Xiyin ( ) 1,2,3*, SHI Xiaoli ( ) 1,2* & HAO Bailin ( ) 2,4 1. College of Life Science,
WGS Works! Shared Mission Different Roles APPLICATIONS SEQUENCING (WGS) Non-regulatory. Regulatory CDC. FDA and USDA. Peter Gerner-Smidt, MD ScD
PUBLIC HEALTH FOOD SAFETY APPLICATIONS FOR WHOLE GENOME SEQUENCING (WGS) Peter Gerner-Smidt, MD ScD Chief, Enteric Diseases Laboratory Branch 4 th Asia-Pacific International Food Safety Conference, Penang,
Viral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
Exploring the Presence of microdnas in Prostate Cancer Cell Lines,
AWARD NUMBER: W81XWH-13-1-0088 TITLE: Exploring the Presence of microdnas in Prostate Cancer Cell Lines, Tissue, and Sera of Prostate Cancer Patients and its Possible Application as Biomarker PRINCIPAL
Use of pyrosequencing in clinical microbiology laboratory
Use of pyrosequencing in clinical microbiology laboratory Student: CHEUNG Yuk Yam, Andy Supervisor: Prof Mamie HUI Joint Graduate Seminar Dec 2014 Department of Microbiology, Faculty of Medicine, The Chinese
Crohn s Disease and MAP Everything Old is New Again. Patrick L. McLean August 16, 2015
Crohn s Disease and MAP Everything Old is New Again Patrick L. McLean August 16, 2015 1 Financial Disclosure Consulting Product Manager for RedHill Biopharma Ltd. (NASDAQ/TASE:RDHL) an Israeli biotech
New Sequencing Technologies for Infectious Diseases
New Sequencing Technologies for Infectious Diseases Dr James Ussher Senior Lecturer, Microbiology and Immunology & Clinical Microbiologist, Southern Community Laboratories Antibiotic resistance: a 21
Johne s Disease, Inflammatory Bowel Disease, and Mycobacterium paratuberculosis
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Papers in Veterinary and Biomedical Science Veterinary and Biomedical Sciences, Department of 10-2004 Johne s Disease, Inflammatory
f(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14