Repression of hspa2 messenger RNA in human testes with abnormal spermatogenesis

Size: px
Start display at page:

Download "Repression of hspa2 messenger RNA in human testes with abnormal spermatogenesis"

Transcription

1 FERTILITY AND STERILITY VOL. 73, NO. 6, JUNE 2000 Copyright 2000 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Repression of hspa2 messenger RNA in human testes with abnormal spermatogenesis Weon-Young Son, M.Sc., a,b Ching-Tack Han, Ph.D., b Suh-Ha Hwang, M.Sc., b Jae-Ho Lee, M.Sc., a Seokjoong Kim, M.D., a,c and Young Chan Kim, M.D. a,d Pundang Je-Saeng General Hospital, Dae-jin Medical Center, Kyungki-do; and Sogang University, Seoul, Korea Received August 18, 1999; revised and accepted December 7, Presented at the 94th Annual Meeting of the American Urological Association, Dallas, Texas, May 1 6, Reprint requests: Weon- Young Son, M.Sc., Center for Reproduction and Genetics, Pundang Je- Saeng General Hospital, Dae-jin Medical Center, Kyungki-do , Korea (FAX: ; sonyoung@dmc.or.kr). a Center for Reproduction and Genetics, Pundang Je-Saeng General Hospital. b Department of Obstetrics and Gynecology, Pundang Je-Saeng General Hospital. c Department of Urology, Pundang Je-Saeng General Hospital. d Department of Life Science, Sogang University /00/$20.00 PII S (00) Objective: To evaluate the messenger RNA (mrna) expression of hspa2 in testes of infertile men with azoospermia. Design: Prospective study. Setting: Center for Reproduction and Genetics, Pundang Je-Saeng General Hospital, Dae-Jin Medical Center, Korea. Patient(s): Azoospermic patients (n 15) undergoing testicular biopsy for pathologic evaluation were selected. Intervention(s): After pathologic evaluation, testicular biopsy specimens were subdivided into three groups: group 1, normal spermatogenesis (n 5); group 2, spermatocyte arrest (n 5); and group 3, Sertoli cell only syndrome (n 5). The levels of hspa2 mrna expression were compared in testes of group 1, group 2, and group 3 with the use of a competitive reverse transcription polymerase chain reaction (RT-PCR) technique. Main Outcome Measure(s): Comparison of hspa2 mrna levels in testes. Result(s): On competitive RT-PCR analyses for hspa2 mrna, significant hspa2 expression was observed in group 1, whereas a very low level of hspa2 was expressed in groups 2 and 3. Conclusion(s): This study demonstrates that hspa2 gene expression is down-regulated in human testes with abnormal spermatogenesis, which in turn suggests that the hspa2 gene might play a specific role during meiosis in human testes. (Fertil Steril 2000;73: by American Society for Reproductive Medicine.) Key Words: Spermatogenic arrest, human testes, hspa2 mrna, Sertoli-cell only syndrome, competitive RT-PCR Spermatogenesis is a unique process of cellular differentiation in which diploid testicular stem cells differentiate into haploid spermatozoa (1, 2). During meiosis and spermiogenesis, male germ cells undergo major morphologic and biochemical changes. These changes are regulated by the stage-specific activation of a large number of genes under temporal and cellspecific regulation (3). Recently, some genes expressed during spermatogenesis have been identified as causes of abnormal spermatogenesis in murine models. About 10% 20% of testicular biopsy specimens obtained from azoospermic men demonstrate spermatogenic arrest, which may be associated with hormonal disturbances and/or chromosomal abnormalities (4 8). Although spermatogenic arrest may occur at any number of stages, an in-depth understanding of its biochemical regulation remains elusive (9, 10). Members of the 70-kd heat shock protein (hsp70) family, which assist in the folding, transport, and assembly of proteins in the cytoplasm, are associated with the development of male germ cells (11). It has been demonstrated that two unique members of the hsp70 family, hsp70-2 and hsc70t, are expressed during murine spermatogenesis (12 15). Dix et al. (16) demonstrated that knockout of the hsp70-2 gene in mice leads to arrest in maturation of the primary spermatocytes at stage 1 of meiosis, whereas the homozygous mutant (hsp70-2 / ) male mice become infertile. These observations indicate that the hsp70-2 gene has a 1138

2 unique function, which is required for murine spermatogenesis. The hspa2 gene is the human homolog of the murine hsp70-2 gene, with 91.7% identity in the nucleotide coding sequence (17). To investigate the biologic significance of the hspa2 gene in human spermatogenesis, we evaluated the mrna expression of the hspa2 gene in the testis biopsy specimens of infertile men with azoospermia. MATERIALS AND METHODS Tissue Preparation Before beginning the study, we obtained approval from the Institutional Review Board of the Pundang Je-Saeng General Hospital. Testicular biopsies were performed in infertile men with azoospermia in a standard clinical fashion. The patients had no other significant pathologies. After biopsy, the testicular tissue was divided into two parts. One part was stored immediately in liquid nitrogen for reverse transcription polymerase chain reaction (RT-PCR). Another portion was fixed in Bouin s solution and later embedded in paraffin, sectioned, and stained with hematoxylin and eosin in a standard fashion. In addition, immunohistochemistry to cyclic adenosine monophosphate (camp)-responsive element modulator was performed in sectioned testis for the evaluation of spermatocyte arrest. After pathologic and immunohistochemical evaluation, the specimens stored in liquid nitrogen were subdivided into three groups on the basis of the results: group 1, normal spermatogenesis (n 5); group 2, spermatocyte arrest (spermatids not present) (n 5); and group 3, Sertoli cell only syndrome (n 5). Immunohistochemistry Immunohistochemical staining was performed with use of an avidin-biotin immunoperoxidase technique (DAKO, Cambridge, UK). Rabbit polyclonal antibodies (Calbiochem, San Diego, CA) against camp-responsive element modulator protein were used as primary antibodies with a dilution of 1:50. After incubation with the primary antibody, the second incubation was with biotinylated polyvalent antibody and the third incubation was with avidin-horseradish peroxidase. The chromogenic reaction was developed by incubation with a solution of substrate-chromogen (AEC ; DAKO). Negative controls were incubated with preimmune serum. All sections were counterstained with hematoxylin and mounted in an aqueous medium. Total RNA Extractions Total RNA was obtained from each testis according to a procedure developed by Gibco BRL (Grand Island, NY). The testicular specimens were placed in a glass tissue grinder in 1 ml of TriZol solution (Gibco BRL) and homogenized until an even suspension was obtained. The homogenate was transferred to a microcentrifuge tube and incubated for 5 minutes. Chloroform was added to the tube, and the samples were centrifuged at 12,000 g for 20 minutes at 4 C. The aqueous phase was transferred to a fresh tube and isopropanol (1 vol) was added. After incubation for 10 minutes, the RNA was pelleted by centrifugation at 12,000 g for 10 minutes at 4 C. The pellet was washed with 75% ethanol and dried briefly. The RNA pellet was resuspended in 20 L of diethyl pyrocarbonate treated sterile water. The contaminated DNA was removed by DNase I (Gibco BRL) digestion. To measure the concentration, we diluted 2 L of the RNA suspension with 600 L of diethyl pyrocarbonate treated sterile water and the optical density at 260 nm was read on the spectrophotometer. The remaining RNA was stored at 85 C for later use. Construction of the Competitor for Competitive RT-PCR The sequences of oligonucleotide primers for hspa2 were determined with a 343-bp fragment from the 3 -untranslated portion of the cdna ( ), which does not show sequence homology with other human hsp70 genes. The synthetic oligonucleotide primers that were used in RT-PCR analysis of hspa2 were: sense, 5 -TTGTTGGAAGTCCTTG GTATA-3 ; and antisense, 5 -CATTTGCATTTATGCATT TGT-3. Template 343-bp cdnas for hspa2 were obtained by RT-PCR amplification of total testis RNA. The RT-PCR amplicons were cloned into pmosblue vector (Amersham, Arlington, IL), and the direction and sequence specificity of inserted cdna were confirmed by sequence analysis. Deletion mutant cdna for hspa2 was constructed as follows. Digestion of RT-PCR amplicons with MseI produced several fragments. MseI-digested cdna fragments were religated without further purification. Ligates were cloned into pmosblue vector, and bacterial clones containing mutant cdna were selected by PCR amplification of plasmid DNAs. The direction and sequence specificity of inserted competitor were confirmed by sequence analyses. A deletion mutant cdna of hspa2 was 200 bp in size. Reverse Transcription Polymerase Chain Reaction Reverse transcription was performed by priming with antisense primers for hspa2 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). GAPDH was used as an endogenous internal control to which other PCR amplification products were normalized. The sequences for GAPDH were as described by Wong et al. (18). Total RNA (5 g) was denatured in the presence of 2 pmol of antisense primers for 10 minutes at 65 C, followed by quick chilling in ice, and 7 L of master mix (10 RT buffer, 1 L dntp mix [2.5 mm each], 50 mm MgCl 2, 200 mm dithiothreitol) was added to the RNA. The RNA mixture was then prewarmed for 5 minutes at 42 C. Reverse transcriptase (AMVe; Promega, Madison, WI) was added and incubated for 50 minutes at 42 C. The temperature was raised to 65 C for 15 minutes to terminate the reaction. FERTILITY & STERILITY 1139

3 For competitive PCR, sequential dilutions of mutant cdnas were added into the RT product before PCR. PCR amplification was performed with 2 L of RT reaction mixture in 50 L of reaction mixture containing 5 L of 10 PCR buffer (supplied by Takara, Tokyo, Japan), 2.5 L of dntp mix (2.5 mm each), and 0.5 U of Ex-Taq polymerase (Takara). In each reaction, 10 pmol of PCR primers was added. The samples were then subjected to amplification on the PCR cycler. PCR was performed under the following conditions: 94 C for 30 seconds, 58 C for 30 seconds, and 72 C for 30 seconds. After the last cycle, incubation at 72 C was extended for 10 minutes. The RT-PCR products were separated by electrophoresis in a 2% agarose gel. The ethidium bromide stained gels were visualized with an ultraviolet light source. The gels were photographed on a gel video imager (Gel Documentation system 1000; Bio-Rad Laboratories, Hercules, CA). The integral values of the peak areas for each band were quantified with the use of ImageMaster VDS software (Pharmacia Biotech, Uppsala, Sweden). RESULTS In normal spermatogenesis, the seminiferous tubules contained spermatogenic cells in mitotic (spermatogonia), meiotic (spermatocytes), and postmeiotic (spermatids) phases of development (Fig. 1A). However, patients with spermatocyte arrest were deficient in postmeiotic spermatids (Fig. 1B), and the seminiferous tubules contained spermatocytes with condensed nuclei. The seminiferous tubules of Sertoli cell only syndrome were completely deficient in meiotic germ cells (Fig. 1C). Spermatocyte arrest was also confirmed by immunohistochemistry to camp-responsive element modulator, which is expressed in round spermatid cells with specificity (19) (Fig. 1). As expected, camp-responsive element modulator was not detected in testes with spermatocyte arrest and Sertoli cell only syndrome (Figs. 1E, F). However, we observed a typical staining pattern in round spermatid cells with normal spermatogenesis (Fig. 1D; arrowheads). The pathologic and immunohistochemical stains in the three groups are shown in Figure 1. For a quantitative comparison of hspa2 mrna between testes with normal spermatogenesis (group 1) and abnormal testes (groups 2 and 3), competitive RT-PCR analysis was performed (Fig. 2). Significant hspa2 mrna expression was observed in all testes of group 1 (Fig. 2B). However, the groups with spermatocyte arrest (group 2) and Sertoli cell only syndrome (group 3) showed a constitutively low level of hspa2 mrna expression (Figs. 2C, D). In contrast, the conspicuous pattern of GAPDH mrna, as the internal control, was uniform among the groups (Fig. 2A). The relative levels of hspa2 mrna expression in testes of all groups used for these studies are shown in Figure 3. DISCUSSION This study demonstrates that hspa2 mrna expression is repressed in human testes with abnormal spermatogenesis. These findings provide a critical clue that the role of hspa2 in human spermatogenesis might be same as the role of hsp70-2 in mouse spermatogenesis. The role of hsp70-2 was proved by the fact that knockout of hsp70-2 in the seminiferous epithelium arrested spermatogenesis. Genetically engineered hsp70-2 deficient mice with a normal phenotype except the seminiferous epithelium were completely devoid of spermatids and spermatozoa (16). Because the hspa2 gene is the human homolog of the murine hsp70-2 gene, we hypothesized that hspa2 gene expression may be disrupted in human testes with abnormal spermatogenesis. To test this hypothesis, we examined the expression of hspa2 mrna in infertile men with azoospermia. The results from spermatocyte maturation arrest in infertile men were consistent with hspa2 mrna deficiency. The spermatocyte arrest was evaluated by histology and immunohistochemistry. We characterized the testes of men with azoospermia due to gonadal failure in terms of the presence of spermatids. In 1998, Lin et al. (19) suggested that camp-responsive element modulator has an important role in spermatid development and is a stage-specific regulator of human spermatogenesis. In that study, although campresponsive element modulator was present in the round spermatid stage of normal or abnormal spermatogenesis (spermatid maturation arrest and hypospermatogenesis), the complete absence of expression of camp-responsive element modulator was confirmed in the specimens from patients with Sertoli cell only syndrome and spermatocyte maturation arrest. Therefore, we used the expression of camp-responsive element modulator as a stage-specific marker of human spermatogenesis. On the basis of this expression and the histologic findings, the samples were classified into three groups and the hspa2 expression was quantified by RT-PCR. In quantitative RT-PCR, there are some important limitations for mrna quantification (18). For example, PCR amplifications do not reside in the exponential phase indefinitely; beyond a defined point in the reaction, the product levels no longer accumulate in proportion to the starting materials. A second problem is the variability in product output from one tube to another. This variability in amplification efficiency is largely uncontrollable and is likely due to a number of unrelated factors. Because of these problems in the RT-PCR reaction, very small differences in the amplification efficiency of patient samples can have profound effects on the analysis of the final product. To compensate for these variations in amplification and reverse transcription efficiencies, we performed the PCR reaction by coamplification of target templates together with 1140 Son et al. Expression of hspa2 mrna in human testes Vol. 73, No. 6, June 2000

4 FIGURE 1 Hematoxylin and eosin stains and immunohistochemistry (magnification, 200). For hematoxylin and eosin stains, (A) shows testis of normal spermatogenesis, group 1; (B) shows testis of spermatocyte arrest, group 2; (C) shows testis of Sertoli cell only syndrome, group 3. For immunohistochemistry of camp-responsive element modulator protein, (D) shows testis of normal spermatogenesis; (E) shows testis of spermatocyte arrest; (F) shows testis of Sertoli cell only syndrome. Positive campresponsive element modulator immunoreactivity is indicated by the arrows. Son. Repression of hspa2 mrna. Fertil Steril FERTILITY & STERILITY 1141

5 FIGURE 2 Competitive RT-PCR analysis for hspa2 transcripts. (A), For internal control, GAPDH was used; lane M molecular-weight markers; lane 1 normal spermatogenesis; lane 2 spermatogenic arrest; lane 3 Sertoli cell only syndrome; lane 4 negative control. For competitive RT-PCR, (B) shows normal spermatogenesis, group 1; (C) shows spermatogenic arrest, group 2; (D) shows Sertoli cell only syndrome, group 3. Son. Repression of hspa2 mrna. Fertil Steril exogenous competitor plasmid. The results from our competitive RT-PCR assays provide relative RNA data, which in many cases are sufficient for studies of mrna expression kinetics and other comparative experiments. The expression of hspa2 mrna in testes with spermatogenic arrest was significantly lower than that in testes with normal spermatogenesis, implying that the hspa2 gene is repressed in testes with spermatocyte arrest (Fig. 3). The 1142 Son et al. Expression of hspa2 mrna in human testes Vol. 73, No. 6, June 2000

6 FIGURE 3 Relative levels of hspa2 mrna expression in testes in the three groups. Group 1 normal spermatogenesis; group 2 spermatogenic arrest; group 3 Sertoli cell only syndrome. studies, implying that hspa2 expression is regulated mostly at the transcriptional level. In conclusion, it is strongly suggested that the hspa2 gene may play a specific role during human spermatogenesis. Repression of the hspa2 gene may be a cause of testicular failure in various types of male infertility. This finding has important implications in the clinical management of infertility in men in the era of rapidly advancing assisted reproductive technology. Further molecular studies at the DNA and protein levels are necessary to elucidate the mechanism of regulation of spermatogenesis by the hspa2 gene. Son. Repression of hspa2 mrna. Fertil Steril very low level of hspa2 mrna expression also was observed in testes with Sertoli cell only syndrome, showing that hspa2 mrna is expressed basically in mitotic cells. It seems that the hspa2 mrna was constitutively expressed in most human tissues (17). The clinical features associated with the histologic diagnosis of human spermatogenesis are extremely variable (20, 21). Biopsy evidence of bilateral testicular epithelium does not indicate total phenomena of spermatogenesis in the testes (21). However, we analyzed hspa2 expression by competitive RT-PCR in same biopsy specimens as for the histologic and immunohistochemical analyses. Therefore, the patterns of spermatogenesis were not variable, at least in the biopsied samples in our study. In general, the regulation of gene expression in cells occurs at three levels: transcription, translation, and posttranslation. Transcriptional regulation is the primary determinant of gene expression in most cells. However, translational regulation probably has a greater role in germ cells than in other cell types (3, 22). The human hspa2 gene has a single open reading frame of 1,917 bp with a predicted molecular weight of 70,030 d (17). The hspa2 gene product was 98.2% identical in amino acid sequence to the mouse hsp70-2 gene product (17). We previously demonstrated that antiserum 2A (23) raised against mouse hsp70-2 protein cross-reacted with human hspa2 protein (24). In that study, we reported that hspa2 protein is highly expressed in germ cells of human testis. However, the hspa2 protein expression in testes with Sertoli cell only syndrome was very low. The hspa2 mrna expression is in agreement with the protein Acknowledgments: The authors thank Ri-Cheng Chian, Ph.D. (Department of Obstetrics and Gynecology, McGill University, Montreal, Quebec, Canada), for critical review of this manuscript. They also thank Edward D. Kim, M.D., Ph.D. (Department of Surgery/Urology, University of Tennessee Medical Center, Knoxville, Tennessee), for his helpful suggestions and discussions. References 1. de Kretser DM, Kerr JB. The cytology of the testis. In: Knobil E, Neill J, editors. The physiology of reproduction. New York: Raven Press, 1988: Eddy EM, O Brien DA, Welch JE. Mammalian sperm development in vivo and in vitro. In: Wassarman PM, editor. Elements of mammalian fertilization. Boca Raton (FL): CRC Press, 1991: Eddy EM. Regulation of gene expression during spermatogenesis. Semin Cell Dev Biol 1998;9: Meyer JM, Roos M, Rumpler Y. Statistical study of a semiquantitative evaluation of testicular biopsies. Arch Androl 1988;10: Cantu JM, Rivas F, Hernandez-Jauregui P, Diaz M, Cortes-Gallegos V, Vaca G, et al. Meiotic arrest at first spermatocyte level: a new inherited infertility disorder. Hum Genet 1981;59: Kretser DM, de Burger HG, Hudson B. The relationship between germinal cells and serum FSH levels in males with infertility. J Clin Endocrinol Metab 1974;38: Giraldo A, Silva E, Martinez I, Campos C, Guzman J. Pericentric inversion of chromosome 1 in three sterile brothers. Hum Genet 1981; 58: Foresta C, Ferlin A, Garolla A, Rossato M, Barbaux S, De Bortoli A. Y-chromosome deletions in idiopathic severe testiculopathies. J Clin Endocrinol Metab 1997;82: Skakkabaek NE, Berthelsen JG, Muller J. Spermatogenesis and the interpretation of the testicular biopsy. In: Waites G, editor. Recent advances in andrology. Serono Symposia Review 1989;20(A): Holstein AF, Eckmann CC. Megalospermatocytes: indicators of disturbed meiosis in man. Andrologia 1986;18: Georgopoulos C, Welch WJ. Role of the major heat shock protein as molecular chaperones. Annu Rev Cell Biol 1993;9: Allen RL, O Brien DA, Eddy EM. A novel hsp70-like protein (P70) is present in mouse spermatogenic cells. Mol Cell Biol 1988;8: Zakeri ZF, Wolgemuth DJ, Hunt CR. Identification and sequence analysis of a new member of the mouse HSP70 gene family and characterization of its unique cellular and developmental pattern of expression in the male germ line. Mol Cell Biol 1988;8: Matsumoto M, Fujimoto H. Cloning of a hsp70-related gene expressed in mouse spermatids. Biochem Biophys Res Commun 1990;166: Maekawa M, O Brien DA, Allen RL, Eddy EM. Heat-shock cognate protein (hsc71) and related proteins in mouse spermatogenic cells. Biol Reprod 1989;40: Dix DJ, Allen JW, Collins BW, Mori C, Nakamura N, Poorman-Allen P, et al. Targeted gene disruption of HSP70-2 results in failed meiosis, germ cell apoptosis, and male infertility. Proc Natl Acad Sci USA 1996;93: Bonnycastile LLC, Yu CE, Hunt CR, Trask BJ, Clancy KP, Weber JL, et al. Cloning, sequencing, and mapping of the human chromosome 14 heat shock protein gene (HSP A2). Genomics 1994;23: Wong H, Anderson WD, Cheng T, Riabowol KT. Monitoring mrna FERTILITY & STERILITY 1143

7 expression by polymerase chain reaction: the primer-dropping method. Anal Biochem 1994;223: Lin WW, Lamb DJ, Lipshultz LI, Kim ED. Absence of cyclic adenosine 3 :5 monophosphate responsive element modulator expression at the spermatocyte arrest stage. Fertil Steril 1998;69: Silber SJ, Nagy A, Devroey P, Tournaye H, Van Steirteghem AC. Distribution of spermatogenesis in the testicles of azoospermic men: the presence or absence of spermatids in the testes of men with germinal failure. Hum Reprod 1997;12: Tournaye H, Verheyen G, Nagy P, Ubaldi F, Goossens A, Silber S, et al. Are there any predictive factors for successful testicular sperm recovery in azoospermic patients? Hum Reprod 1997;12: Kleene KC. Patterns of translational regulation in the mammalian testis. Mol Reprod Dev 1996;43: Rosario MO, Perkins SL, O Brien DA, Allen RL, Eddy EM. Identification of the gene for the developmentally expressed 70 kda heat-shock protein (P70) of mouse spermatogenic cells. Dev Biol 1992;150: Son WY, Hwang SH, Han CT, Lee JH, Kim S, Kim YC. Specific expression of heat shock protein HspA2 in human male germ cells. Mol Hum Reprod 1999;12: Son et al. Expression of hspa2 mrna in human testes Vol. 73, No. 6, June 2000

EXPRESSION PROFILING OF CREM GENE IN TESTIS WITH NORMAL AND IMPAIRED SPERMATOGENESIS IN EGYPTIAN MALES

EXPRESSION PROFILING OF CREM GENE IN TESTIS WITH NORMAL AND IMPAIRED SPERMATOGENESIS IN EGYPTIAN MALES EXPRESSION PROFILING OF CREM GENE IN TESTIS WITH NORMAL AND IMPAIRED SPERMATOGENESIS IN EGYPTIAN MALES MANAL O. EL HAMSHARY 1, ALIAA M. ISSA 2, M. K. KHALIFA 3, K. Z. SHAEER 4 1. 2. 3. Genetic Engineering

More information

Variability in testis biopsy interpretation: implications for male infertility care in the era of intracytoplasmic sperm injection

Variability in testis biopsy interpretation: implications for male infertility care in the era of intracytoplasmic sperm injection Variability in testis biopsy interpretation: implications for male infertility care in the era of intracytoplasmic sperm injection Matthew R. Cooperberg, M.D., a Thomas Chi, B.A., a Amir Jad, M.D., a Imok

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Testicular fine needle aspiration as a diagnostic tool in nonobstructive

Testicular fine needle aspiration as a diagnostic tool in nonobstructive Asian J Androl 2005; 7 (3): 289 294 DOI: 10.1111/j.1745-7262.2005.00043.x. Original Article. Testicular fine needle aspiration as a diagnostic tool in nonobstructive azoospermia A. Bettella 1, A. Ferlin

More information

Knockout TM SR : ; ; ; : R ; R : A : X(2013) , ,, B. , (Knockout TM

Knockout TM SR : ; ; ; : R ; R : A : X(2013) , ,, B. , (Knockout TM 33 1 Vol.33 No.1 013 1 Dec. 013 Reproduction & Contraception doi: 10.7669/j.issn.03-37X.013.1.0804 E-mail: randc_journal@163.com Knockout TM SR ; ; ; 400014 : FBS Knockout TM SRKSR : FBS KSR HE TUNEL RT-PCR

More information

Spermatogonial proliferation and apoptosis in hypospermatogenesis associated with nonobstructive azoospermia

Spermatogonial proliferation and apoptosis in hypospermatogenesis associated with nonobstructive azoospermia FERTILITY AND STERILITY VOL. 76, NO. 5, NOVEMBER 2001 Copyright 2001 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Spermatogonial proliferation

More information

Spermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis?

Spermatogenesis. What is it and what does it look like? How do hormones regulate spermatogenesis? Spermatogenesis What is it and what does it look like? How do hormones regulate spermatogenesis? FSH, androgens, growth factors Animal Physiology (Hill, Wise, Anderson): Ch. 15 435-438 1 Spermatogenesis:

More information

Comparative studies of spermatogenesis in fertile and

Comparative studies of spermatogenesis in fertile and J Clin Pathol 1981 ;34:145-150 Comparative studies of spermatogenesis in fertile and subfertile men MA LAMONT,* MJW FAED,* AND K BAXBYt From the *Cytogenetics Laboratory, Ninewells Hospital and Medical

More information

Identification of the spermatogenic stages in living seminiferous tubules of man

Identification of the spermatogenic stages in living seminiferous tubules of man Identification of the spermatogenic stages in living seminiferous tubules of man V. Nikkanen, K.-O. S\l=o"\derstr\l=o"\m and M. Parvinen Department of Obstetrics and Gynecology, Turku University Central

More information

Outcome of repeated micro-surgical testicular sperm extraction in patients with non-obstructive azoospermia

Outcome of repeated micro-surgical testicular sperm extraction in patients with non-obstructive azoospermia Repeated micro-surgical testicular sperm extraction DOI: 10.1111/j.1745-7262.2007.00273.x www.asiaandro.com. Original Article. Outcome of repeated micro-surgical testicular sperm extraction in patients

More information

Expression of a Testis-Specific Form of TBP-Related Factor 2 (TRF2) mrna During Mouse Spermatogenesis

Expression of a Testis-Specific Form of TBP-Related Factor 2 (TRF2) mrna During Mouse Spermatogenesis Journal of Reproduction and Development, Vol. 49, No. 1, 2003 Research Note Expression of a Testis-Specific Form of TBP-Related Factor 2 (TRF2) mrna During Mouse Spermatogenesis Shin SUGIURA 1), Shin-ichi

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.

Nature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality. Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

The Use of Rabbits in Male Reproductive Toxicology

The Use of Rabbits in Male Reproductive Toxicology Environmental Health Perspectives Vol. 77, pp. 5-9, 1988 The Use of Rabbits in Male Reproductive Toxicology by Daniel Morton* The rabbit is the smallest and least expensive laboratory animal in which serial

More information

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000) CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar

More information

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions

Product Manual. Omni-Array Sense Strand mrna Amplification Kit, 2 ng to 100 ng Version Catalog No.: Reactions Genetic Tools and Reagents Universal mrna amplification, sense strand amplification, antisense amplification, cdna synthesis, micro arrays, gene expression, human, mouse, rat, guinea pig, cloning Omni-Array

More information

Adapted from Preg. & Part., Senger

Adapted from Preg. & Part., Senger MALE ENDOCRINOLOGY AND SPERMATOGENESIS (Chapter 10) AVS 222 (Instructor: Dr. Amin Ahmadzadeh) I. MALE ENDOCRINOLOGY (Figure10-1 to 10-3) A. Glands and their respective hormones 1) Hypothalamic hormone:

More information

5 15/3/2012. Malik Al-Momani

5 15/3/2012. Malik Al-Momani 5 15/3/2012 Malik Al-Momani بسم هللا الرحمن الرحيم Spermatogenesis Note : Please refer to slides so see photos. Quick Revision : - Testis is divided by septum into testicular lobules, inside the lobules

More information

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

More information

AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men

AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men 92 Moyet Al-Faisal et al. IJPS Vol. 6, No.2, May-Aug 2010 Original Article AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men Abdul Hussein Moyet Al-Faisal 1*, Ali Fadel Alnajar

More information

MicroRNA and Male Infertility: A Potential for Diagnosis

MicroRNA and Male Infertility: A Potential for Diagnosis Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

SPERMATOGENESIS IN VITRO

SPERMATOGENESIS IN VITRO SPERMATOGENESIS IN VITRO INDUCTION OF PROLIFERATION, MEIOSIS AND DIFFERENTIATION Mário Sousa Lab Cell Biology Institute of Biomedical Sciences (ICBAS) University of Porto msousa@icbas.up.pt Spermatogonia

More information

AZOOSPERMIA CYTOLOGICAL MANIFESTATIONS

AZOOSPERMIA CYTOLOGICAL MANIFESTATIONS ý Comptes rendus de l Académie bulgare des Sciences ÌÓÑ ÆÓ ¾¼½½ BIOLOGIE Morphologie AZOOSPERMIA CYTOLOGICAL MANIFESTATIONS Stefka Ivanova, Petia Tzvetkova (Submitted by Corresponding Member J. Jordanov

More information

Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR

Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid

More information

Cytological findings of testicular fine needle aspiration in a sample of azoospermic Iraqi patients

Cytological findings of testicular fine needle aspiration in a sample of azoospermic Iraqi patients Cytological findings of testicular fine needle aspiration in a sample of azoospermic Iraqi patients Basim Sh. Ahmed F.I.C.M.S Department of Pathology, College of Medicine, Al-Mustansiriya University, Baghdad,

More information

Effects of Cryopreservation on the Ultrastructure of Human Testicular Sperm

Effects of Cryopreservation on the Ultrastructure of Human Testicular Sperm Journal of Reproduction & Contraception (2005) 16 (4):195-200 ORIGINAL PAPER Effects of Cryopreservation on the Ultrastructure of Human Testicular Sperm Xin-qiang LAI 1, Wei-jie ZHU 2, Jing LI 3, Fu-xing

More information

Male Factor Infertility and Health. Karen Baker, MD Associate Professor Duke University, Division of Urology

Male Factor Infertility and Health. Karen Baker, MD Associate Professor Duke University, Division of Urology Male Factor Infertility and Health Karen Baker, MD Associate Professor Duke University, Division of Urology Fertility and Cancer Heart disease Metabolic syndrome Diabetes Early death Goals: Review literature

More information

Spermatogenesis in Man

Spermatogenesis in Man Spermatogenesis in Man I. Nuclear Morphology During Spermatogenesis in Man BRUNETTO CHIARELLI, PH.D., ARTHUR FALEK, PH.D., KAREN J. BACK, B.S., and C. THOMAS COWART, M.D. THE SEQUENCE of transformations

More information

Sperm retrieval from patients with nonmosaic Klinefelter s syndrome by semen cytology examination

Sperm retrieval from patients with nonmosaic Klinefelter s syndrome by semen cytology examination Sperm retrieval from patients with nonmosaic Klinefelter s syndrome by semen cytology examination Y.-T. Jiang 1, Y. Dong 1, X.-W. Yu 1, R.-C. Du 1,2, L.-L. Li 1,2, H.-G. Zhang 1 and R.-Z. Liu 1 1 Center

More information

Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis

Role of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol

More information

Male Reproductive System

Male Reproductive System Male Reproductive System organs that function in: gamete and hormone production not all in abdominal cavity paired testicles = controlled by LH & FSH duct systems accessory glands Testis: Gross Histology

More information

Alternatively spliced variants of the follicle-stimulating hormone receptor gene in the testis of infertile men

Alternatively spliced variants of the follicle-stimulating hormone receptor gene in the testis of infertile men FERTILITY AND STERILITY VOL. 77, NO. 3, MARCH 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Alternatively spliced

More information

Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia

Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia RIMA DADA, N P GUPTA* and K KUCHERIA Department of Anatomy and *Department of Urology, All India Institute

More information

Citation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n.

Citation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n. University of Groningen Genetic predisposition to testicular cancer Lutke Holzik, Martijn Frederik IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite

More information

Meiosis & Sexual Reproduction. AP Biology

Meiosis & Sexual Reproduction. AP Biology Meiosis & Sexual Reproduction 2007-2008 Cell division / Asexual reproduction Mitosis produce cells with same information identical daughter cells exact copies clones same amount of DNA same number of chromosomes

More information

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products..

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 Related Products.. INSTRUCTION MANUAL Quick-RNA MidiPrep Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

REAPPRAISAL OF THE VALUE OF TESTICULAR BIOPSY IN THE INVESTIGATION OF INFERTILITY

REAPPRAISAL OF THE VALUE OF TESTICULAR BIOPSY IN THE INVESTIGATION OF INFERTILITY FERTWTY AND STEIuLlTY Copyright 1980 The American Fertility Society Vol., No.1 January 1980 Prinwl in U.S.A. REAPPRAISAL OF THE VALUE OF TESTICULAR BIOPSY IN THE INVESTIGATION OF INFERTILITY TERENCE

More information

II.3.9 Evaluation of Testicular Biopsy Samples from the Clinical Perspective

II.3.9 Evaluation of Testicular Biopsy Samples from the Clinical Perspective 454 Diagnostic Tools.9 Evaluation of Testicular Biopsy Samples from the Clinical Perspective M. Bergmann Summary Testicular biopsy is indicated therapeutically in cases of obstructive azoospermia, and

More information

Prediction of Successful Sperm Retrieval in Patients with Nonobstructive Azoospermia

Prediction of Successful Sperm Retrieval in Patients with Nonobstructive Azoospermia Urology Journal UNRC/IUA Vol. 3, No. 2, 92-96 Spring 2006 Printed in IRAN Prediction of Successful Sperm Retrieval in Patients with Nonobstructive Azoospermia Seyed Amirmohsen Ziaee, 1 * Mohammadreza Ezzatnegad,

More information

Testicular stem cells

Testicular stem cells Testicular stem cells Dirk G. de Rooij Department of Endocrinology Faculty of Biology, Utrecht University 1. Knowledge on the development of the spermatogenic stem cell lineage 2. Principals of the nature

More information

To General Embryology Dr: Azza Zaki

To General Embryology Dr: Azza Zaki Introduction To General Embryology The Human Development is a continuous process that begins when an ovum from a female is fertilized by a sperm from a male. Cell division, growth and differentiation transform

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

The effect of testicular nongerm cell tumors on local spermatogenesis

The effect of testicular nongerm cell tumors on local spermatogenesis FERTILITY AND STERILITY Vol. 62, No.1, July 1994 Copyright" 1994 The American Fertility Society Printed on acid-free paper in U. S. A. The effect of testicular nongerm cell tumors on local spermatogenesis

More information

SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis

SUPPLEMENTAL INFORMATION FOR. PAX7 expression defines germline stem cells in the adult testis SUPPLEMENTAL INFORMATION FOR PAX7 expression defines germline stem cells in the adult testis Gina M. Aloisio, Yuji Nakada, Hatice D. Saatcioglu, Christopher G. Peña, Michael D. Baker, Edward D. Tarnawa,

More information

Aspiration flow cytometry of the testes in the evaluation of spermatogenesis in the infertile male*t

Aspiration flow cytometry of the testes in the evaluation of spermatogenesis in the infertile male*t FERTILITY AND STERILITY Copyright e 1987 The American Fertility Society Printed in U.S.A. Aspiration flow cytometry of the testes in the evaluation of spermatogenesis in the infertile male*t David G. Kaufman,

More information

In vitro differentiation of germ cells from nonobstructive azoospermic patients using threedimensional culture in a collagen gel matrix

In vitro differentiation of germ cells from nonobstructive azoospermic patients using threedimensional culture in a collagen gel matrix In vitro differentiation of germ cells from nonobstructive azoospermic patients using threedimensional culture in a collagen gel matrix Jae-Ho Lee, Ph.D., a Myung C. Gye, Ph.D., b Kyoo Wan Choi, Ph.D.,

More information

Inhibin B plasma concentrations in oligozoospermic subjects before and after therapy with follicle stimulating hormone

Inhibin B plasma concentrations in oligozoospermic subjects before and after therapy with follicle stimulating hormone Human Reproduction vol.14 no.4 pp.906 912, 1999 Inhibin B plasma concentrations in oligozoospermic subjects before and after therapy with follicle stimulating hormone Carlo Foresta 1,4, Andrea Bettella

More information

Histology of Male Reproductive system (1)

Histology of Male Reproductive system (1) Histology of Male Reproductive system (1) Prof. Dr. Malak A. Al-yawer Learning Objectives At the end of this lecture, the medical student will be able to: State the organization of the testis Define seminiferous

More information

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-

Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary

More information

ABNORMAL SPERMATOGENESIS IN XYY MALES: A REPORT ON 4 CASES ASCERTAINED THROUGH A POPULATION STUDY*

ABNORMAL SPERMATOGENESIS IN XYY MALES: A REPORT ON 4 CASES ASCERTAINED THROUGH A POPULATION STUDY* FERTILITY AND STERILITY Copyright 1973 by The Williams & Wilkins Co. Vol. 24, No.5, May 1973 Printed in U.S.A. ABNORMAL SPERMATOGENESIS IN XYY MALES: A REPORT ON 4 CASES ASCERTAINED THROUGH A POPULATION

More information

Morphogenesis of the residual body of the mouse testis

Morphogenesis of the residual body of the mouse testis 93 Morphogenesis of the residual body of the mouse testis By CASIMIR F. FIRLIT and JOSEPH R. DAVIS (From the Department of Pharmacology and Therapeutics, Stritch School of Medicine, and Graduate School,

More information

Pinpoint Slide RNA Isolation System II Catalog No. R1007

Pinpoint Slide RNA Isolation System II Catalog No. R1007 INSTRUCTION MANUAL Pinpoint Slide RNA Isolation System II Catalog No. R1007 Highlights Allows for the isolation of total RNA from paraffin-embedded tissue sections on glass slides Simple procedure combines

More information

Histological findings of testicular biopsy in North Indian population

Histological findings of testicular biopsy in North Indian population International Journal of Reproduction, Contraception, Obstetrics and Gynecology Mahajan A et al. Int J Reprod Contracept Obstet Gynecol. 2015 Apr;4(2):432-438 www.ijrcog.org pissn 2320-1770 eissn 2320-1789

More information

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4

Product Contents. 1 Specifications 1 Product Description. 2 Buffer Preparation... 3 Protocol. 3 Ordering Information 4 INSTRUCTION MANUAL Quick-RNA Midiprep Kit Catalog No. R1056 Highlights 10 minute method for isolating RNA (up to 1 mg) from a wide range of cell types and tissue samples. Clean-Spin column technology allows

More information

The expression and significance of CATSPER1 in human testis and ejaculated spermatozoa

The expression and significance of CATSPER1 in human testis and ejaculated spermatozoa Asian J Androl 2006; 8 (3): 301 306 DOI: 10.1111/j.1745-7262.2006.00132.x. Original Article. The expression and significance of CATSPER1 in human testis and ejaculated spermatozoa Hong-Gang Li, Ai-Hua

More information

Mitochondrial DNA Isolation Kit

Mitochondrial DNA Isolation Kit Mitochondrial DNA Isolation Kit Catalog Number KA0895 50 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials

More information

Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy

Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Kavya Puchhalapalli CALS Honors Project Report Spring 2017 Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Abstract Malignant brain tumors including medulloblastomas and primitive neuroectodermal

More information

Predictive Factors of Successful Microdissection Testicular Sperm Extraction in Patients with Presumed Sertoli Cell-Only Syndrome

Predictive Factors of Successful Microdissection Testicular Sperm Extraction in Patients with Presumed Sertoli Cell-Only Syndrome Original Article Predictive Factors of Successful Microdissection Testicular Sperm Extraction in Patients with Presumed Sertoli Cell-Only Syndrome Tahereh Modarresi, M.Sc. 1, Hani Hosseinifar, M.Sc. 1,

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Infertility is not an uncommon problem in Western

Infertility is not an uncommon problem in Western Review Article A Practical Approach to Testicular Biopsy Interpretation for Male Infertility Lisa A. Cerilli, MD; Wayne Kuang, MD; David Rogers, MD Infertility is not an uncommon problem in Western societies

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Role Of Serum Hormone Indices Including Inhibin B And Scrotal Ultrasound In Evaluation Of Non Obstructive Male Factor Infertility

Role Of Serum Hormone Indices Including Inhibin B And Scrotal Ultrasound In Evaluation Of Non Obstructive Male Factor Infertility Article ID: WMC001510 ISSN 2046-1690 Role Of Serum Hormone Indices Including Inhibin B And Scrotal Ultrasound In Evaluation Of Non Obstructive Male Factor Infertility Author(s):Dr. Geetika, Dr. Sunita

More information

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria

AIDS - Knowledge and Dogma. Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/ , Vienna, Austria AIDS - Knowledge and Dogma Conditions for the Emergence and Decline of Scientific Theories Congress, July 16/17 2010, Vienna, Austria Reliability of PCR to detect genetic sequences from HIV Juan Manuel

More information

Decreased expression of the c-kit receptor is associated with increased apoptosis in subfertile human testes

Decreased expression of the c-kit receptor is associated with increased apoptosis in subfertile human testes FERTILITY AND STERILITY VOL. 71, NO. 1, JANUARY 1999 Copyright 1998 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Decreased expression

More information

With advances in assisted reproduction techniques,

With advances in assisted reproduction techniques, Journal of Andrology, Vol. 26, No. 6, November/December 2005 Copyright American Society of Andrology Clomiphene Administration for Cases of Nonobstructive Azoospermia: A Multicenter Study ALAYMAN HUSSEIN,*

More information

HISTOLOGIC CHANGES IN THE SEMINIFEROUS TUBULES AFTER VASECTOMY

HISTOLOGIC CHANGES IN THE SEMINIFEROUS TUBULES AFTER VASECTOMY FERTILItY AND STI!RILITY Copyright 1974 The American Fertility Society Vol. 25, No.8, August 1974 PTillted in U.S.AI HISTOLOGIC CHANGES IN THE SEMINIFEROUS TUBULES AFTER VASECTOMY FLETCHER C. DERRICK,

More information

IMMUNODETECTION OF A HUMAN CHORIONIC GONADOTROPIN-LIKE SUBSTANCE IN HUMAN SPERM

IMMUNODETECTION OF A HUMAN CHORIONIC GONADOTROPIN-LIKE SUBSTANCE IN HUMAN SPERM FERTILITY AND STERILITY Copyright' 1977 The American Fertility Society Vol. 28, No. 11, November 1977 Printed in U.S.A. IMMUNODETECTION OF A HUMAN CHORIONIC GONADOTROPIN-LIKE SUBSTANCE IN HUMAN SPERM RICARDO

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph

More information

A COMPARATIVE STUDY OF GERM CELL KINETICS IN THE TESTES OF CHILDREN WITH UNILATERAL CRYPTORCHIDISM: A PRELIMINARY REPORT*

A COMPARATIVE STUDY OF GERM CELL KINETICS IN THE TESTES OF CHILDREN WITH UNILATERAL CRYPTORCHIDISM: A PRELIMINARY REPORT* FERTILITY AND STERILITY Copyright 1970 by the Williams & Wilkins Co. Vol. 21, No. 11, November 1970 Printed in U.S.A. A COMPARATIVE STUDY OF GERM CELL KINETICS IN THE TESTES OF CHILDREN WITH UNILATERAL

More information

The use of Y-chromosome-specific repeated DNA sequences in the analysis of testis development in an XX/XY mouse

The use of Y-chromosome-specific repeated DNA sequences in the analysis of testis development in an XX/XY mouse Development 101 Supplement. 143 149 (1987) Printed in Great Britain The Company of Biologists Limited 1987 143 The use of Y-chromosome-specific repeated DNA sequences in the analysis of testis development

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Spermatogenesis Following Experimental Testicular Ischemia

Spermatogenesis Following Experimental Testicular Ischemia Spermatogenesis Following Experimental Testicular Ischemia Frank Hinman, Jr, MD, and Gilbert I Smith, MD REGENERATION of the spermatogenic elements of the testis after depression by testosterone and by

More information

CURRICULUM VITAE. Suite 1835 Chicago, Illinois Phone: Fax:

CURRICULUM VITAE. Suite 1835 Chicago, Illinois Phone: Fax: CURRICULUM VITAE NAME OFFICE ADDRESS CITIZENSHIP BIRTH DATE EDUCATION William Wei Lin, M.D. 2233 North Seminary Avenue 60614 676 N. St. Clair Suite 1835 60611 Phone: 312-926-3535 Fax: 312-926-3585 Email:

More information

a Control IgG Intestine c Testis b Thymus 1 3 2 S S 2 1 3 4 4 Figure S1 The wild-type mouse (C57BL/6J) organs (intestine, thymus and testis) were frozen in liquid nitrogen and sectioned at 5 µm on a cryostat.

More information

Abstract. Introduction. RBMOnline - Vol 19. No Reproductive BioMedicine Online; on web 12 October 2009

Abstract. Introduction. RBMOnline - Vol 19. No Reproductive BioMedicine Online;   on web 12 October 2009 RBMOnline - Vol 19. No 6. 2009 778 783 Reproductive BioMedicine Online; www.rbmonline.com/article/4178 on web 12 October 2009 Article Does age at orchidopexy impact on the results of testicular sperm extraction?

More information

The spermatogenesis CHARACTERISTICS OF THE SPERMATOZOON 26/04/2017. Reproductive Biotechnologies Andrology I. Prof. Alberto Contri

The spermatogenesis CHARACTERISTICS OF THE SPERMATOZOON 26/04/2017. Reproductive Biotechnologies Andrology I. Prof. Alberto Contri Reproductive Biotechnologies Andrology I The spermatogenesis Prof. Alberto Contri CHARACTERISTICS OF THE SPERMATOZOON 1) Aploid cell with high condensed DNA 2) Forward motility - flagellum 3) Enzymes for

More information

Patterns of Testicular Histopathology in Egyptian Azoospermic Men

Patterns of Testicular Histopathology in Egyptian Azoospermic Men ISPUB.COM The Internet Journal of Urology Volume 13 Number 1 Patterns of Testicular Histopathology in Egyptian Azoospermic Men M K Khalifa, A M Issa, M O El Hamshary, K Z Shaeer Citation M K Khalifa, A

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Cell Divisions. The autosomes represent the whole body. * Male Sex Chromosomes: XY * Female Sex Chromosomes: XX

Cell Divisions. The autosomes represent the whole body. * Male Sex Chromosomes: XY * Female Sex Chromosomes: XX Cell Divisions Each Cell (including gonads) has 46 chromosomes (23 pairs of chromosomes: 22 pairs of autosomes, 1 pair of sex chromosomes) which are located in the nucleus). The autosomes represent the

More information

Production of Fertile Sperm. Animal Science 434. Hormonal Regulation of the Testis. hormonal regulation of the testis

Production of Fertile Sperm. Animal Science 434. Hormonal Regulation of the Testis. hormonal regulation of the testis roduction of Fertile Sperm hormonal regulation of the testis nimal Science 434 Lecture 12: Spermatogenesis mitotic division of spermatogonia meiotic divisions of spermatocytes morphologic transformation

More information

A comparison between open and percutaneous needle biopsies in men with azoospermia

A comparison between open and percutaneous needle biopsies in men with azoospermia Human Reproduction vol.13 no.5 pp.1266 1271, 1998 A comparison between open and percutaneous needle biopsies in men with azoospermia B.Rosenlund 1,6, U.Kvist 3, L.Plöen 4, B.Lundh Rozell 2, P.Sjöblom 1

More information

Materials and Methods , The two-hybrid principle.

Materials and Methods , The two-hybrid principle. The enzymatic activity of an unknown protein which cleaves the phosphodiester bond between the tyrosine residue of a viral protein and the 5 terminus of the picornavirus RNA Introduction Every day there

More information

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC

More information

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler

Norgen s HIV Proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad T1000 Cycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product# 33840 Product Insert Intended

More information

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points

SHORT COMMUNICATION. Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points VIROLOGY 214, 259 263 (1995) SHORT COMMUNICATION Human Papillomavirus Type 11 E1 Ú E4 and L1 Proteins Colocalize in the Mouse Xenograft System at Multiple Time Points DARRON R. BROWN,*,,1 JANINE T. BRYAN,

More information

Sex Determination and Gonadal Sex Differentiation in Fish

Sex Determination and Gonadal Sex Differentiation in Fish Sex Determination and Gonadal Sex Differentiation in Fish Yoshitaka Nagahama Okazaki National Research Institutes, Japan This first slide shows the processes of gonadal sex differentiation and gametogenesis

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Evaluation of the semen swim-up method for bovine sperm RNA extraction

Evaluation of the semen swim-up method for bovine sperm RNA extraction Evaluation of the semen swim-up method for bovine sperm RNA extraction C.M. Han, R. Chen, T. Li, X.L. Chen, Y.F. Zheng, M.T. Ma and Q.H. Gao College of Animal Science, Tarim University, Alar, Xinjiang,

More information

Induction of spermatogenic synchrony by retinoic acid in neonatal mice

Induction of spermatogenic synchrony by retinoic acid in neonatal mice EDITOR'S Letter to CORNER the Editor Spermatogenesis 3:1, e23180; January/February/March 2013 2013; 2013 Landes Bioscience EDITOR'S CORNER Induction of spermatogenic synchrony by retinoic acid in neonatal

More information

Gametogenesis. Omne vivum ex ovo All living things come from eggs.

Gametogenesis. Omne vivum ex ovo All living things come from eggs. Omne vivum ex ovo All living things come from eggs. William Harvery, 1651 Gametogenesis This lecture is the preface, so to speak, to embryology; that is, it introduces the development of the specialized

More information

Detection of Wild Type and Variant mrna Transcript of Progesterone Receptor in Human Spermatozoa of Infertile Males

Detection of Wild Type and Variant mrna Transcript of Progesterone Receptor in Human Spermatozoa of Infertile Males International Journal of Research Studies in Microbiology and Biotechnology (IJRSMB) Volume 2, Issue 1, 2016, PP 28-32 ISSN 2454-9428 (Online) www.arcjournals.org Detection of Wild Type and Variant mrna

More information

Changes of androgen receptor expression in stages VII-VIII seminiferous tubules of rat testis after exposure to methamphetamine

Changes of androgen receptor expression in stages VII-VIII seminiferous tubules of rat testis after exposure to methamphetamine Songklanakarin J. Sci. Technol. 38 (3), 275-279, May - Jun. 2016 http://www.sjst.psu.ac.th Original Article Changes of androgen receptor expression in stages VII-VIII seminiferous tubules of rat testis

More information

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note

Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin

More information

Male factors determining the outcome of intracytoplasmic sperm injection with epididymal and testicular spermatozoa

Male factors determining the outcome of intracytoplasmic sperm injection with epididymal and testicular spermatozoa andrologia 35, 220 226 (2003) Accepted: April 25, 2003 Male factors determining the outcome of intracytoplasmic sperm injection with epididymal and testicular spermatozoa J. U. Schwarzer, K. Fiedler, I.

More information

Y Chromosome Microdeletions and Alterations of Spermatogenesis*

Y Chromosome Microdeletions and Alterations of Spermatogenesis* 0163-769X/01/$03.00/0 Endocrine Reviews 22(2): 226 239 Copyright 2001 by The Endocrine Society Printed in U.S.A. Y Chromosome Microdeletions and Alterations of Spermatogenesis* CARLO FORESTA, ENRICO MORO,

More information

3 CHAPTER 3: RESULTS

3 CHAPTER 3: RESULTS 3 CHAPTER 3: RESULTS 3.1 Histopathology 3.1.1 Normal Squamous Epithelium The squamous epithelium that covers the ectocervix of the uterus is composed of different layers starting at the basement membrane

More information

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler

Norgen s HIV proviral DNA PCR Kit was developed and validated to be used with the following PCR instruments: Qiagen Rotor-Gene Q BioRad icycler 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com HIV Proviral DNA PCR Kit Product # 33840 Product Insert Background Information

More information