Article Derivation of male germ cell-like lineage from human fetal bone marrow stem cells

Transcription

1 RBMOnline - Vol 19 No Reproductive BioMedicine Online; on web 8 May 2009 Article Derivation of male germ cell-like lineage from human fetal bone marrow stem cells Jinlian Hua has been studying human and mammalian embryonic stem cells and their characteristics since His interest is focusing on mechanisms in germ cell specification and stem cells. He has received science and technology awards from Yangling (2006) and Shaanxi Province (2005, 2006). He was also accepted into the Youth Research Key Member Program of Northwest A & F University (2005). Dr Jinlian Hua Jinlian Hua 1,3, Shaohui Pan 1, Chunrong Yang 1, Wuzi Dong 1, Zhongying Dou 1, Kuldip S Sidhu 2 1 College of Veterinary Medicine, Shaanxi Centre of Stem Cells Engineering and Technology, Shaanxi Key Laboratory for Agriculture Molecular Biotechnology Centre, Northwest A and F University, Yangling, Shaanxi, China; 2 Stem Cell Laboratory, Faculty of Medicine, School of Psychiatry, University of New South Wales, NSW 2031, Australia 3 Correspondence: jlhua2003@126.com Abstract Mesenchymal stem cells derived from bone marrow are a well characterized population of adult stem cells that can be maintained and propagated in culture for a long time with the capacity to form a variety of cell types. Reports have shown that murine and human embryonic stem cells can differentiate into primordial germ cells and then to early gametes. Evidence has indicated that some adult stem cells also have the potential to differentiate into germ cells. Currently, there are no reports on directed differentiation of human mesenchymal stem cells into germ cells. This study investigated the ability of retinoic acid and testicular extracts to induce human bone marrow stem cells (hbmsc) to differentiate into male germ cells. It was found that a small population of hbmsc seem to transdifferentiate into male germ cell-like cells. These cells expressed early germ cell markers OCT4, STELLA, NANOG and VASA, and male germ-cell-specific markers such as DAZL, TH2, c-kit, β 1 -integrin, ACR, PRM1, FSHR, STRA8 and SCP3, as analysed by reverse transcription-polymerase chain reaction and immunohistochemistry. These results demonstrated that hbmsc may differentiate into male germ cells and the same could be used as a potential source of cells for reproductive toxicological studies. Keywords: human bone marrow stem cells (hbmsc), male germ cells, spermatozoa Introduction The potential of embryonic stem cells (ESC) to generate all cell lineages of embryo and bodies in vivo and in vitro has been widely reported (Hübner et al., 2003; Clark et al., 2004; Geijsen et al., 2004). It is now believed that for most stem cell types the specific extracellular environment provides signals necessary for self-renewal and differentiation (Nayernia et al., 2004). Reports have shown that ESC can differentiate into germ cells in vitro (Hübner et al., 2003; Clark et al., 2004; Geijsen et al., 2004; Nayernia et al., 2006a,b). However, it is difficult to purify the germ cells derived from ESC. Infertility affects 13 18% of couples and the growing evidence from clinical and epidemiological studies suggests an increasing incidence of male reproductive problems. A male factor is involved in up to half of all infertile couples. The pathogenesis of male infertility manifests itself as defective spermatogenesis due to failure in germ cell proliferation and differentiation (Lammarrone et al., 2003). Recently, several reports have shown that germ cells can be produced in vitro from ESC (Hübner et al., 2003; Clark et al., 2004; Geijsen et al., 2004; Nayernia et al., 2006a,b) and even from adult stem cells (Dyce et al., 2006; Nayernia et al., 2006a; Danner et al., 2007). Mesenchymal stem cells (MSC) derived from bone marrow are a well-characterized population of adult stem cells that can form a variety of cell types, including fat cells, cartilage, bone, tendon and ligaments, muscle cells, skin cells and nerve cells (Pittenger et al., 1999; Jiang et al., 2002). It has recently been reported that murine MSC derived from bone Published by Reproductive Healthcare Ltd, Duck End Farm, Dry Drayton, Cambridge CB23 8DB, UK

2 100 marrow trans-differentiate into spermatozoa (Nayernia et al., 2006a). In this paper, it was investigated whether human bone marrow stem cells (hbmsc) have the potential to express markers characteristic of male germ cell differentiation. Materials and methods Isolation and culture of hbmsc hbmsc were isolated from the bone marrow of human male fetuses of 4- to 6 months gestation, based on previously described methods (Pittenger et al., 1999; Jiang et al., 2002). This research was approved by the human ethics committee of Shaanxi Centre of Stem Cell Engineering and Technology. The bone marrow aspirate was mixed with an equal amount of Dulbecco s modified Eagle s medium (DMEM; Invitrogen, USA) and centrifuged at 300 g for 10 min at room temperature. The cells were then resuspended in DMEM, layered on a Ficoll-Hypaque gradient (density g/cm 3 ; Sigma), and centrifuged again. The low-density mononuclear fraction was collected, washed and resuspended in complete culture medium (DMEM with 10% fetal bovine serum (FBS; Hyclone, USA), penicillin/streptomycin (Invitrogen, USA) and plated at cells/100 mm 2. The cultures were maintained at 37 C in a humidified atmosphere containing 95% air and 5% CO 2, and they were and subcultured each time prior to achieving full confluency. Characterization of hbmsc: flow cytometry hbmsc at passage 5 were treated with 0.25% trypsin (Invitrogen, USA), harvested, and washed twice with culture medium. Before staining, cells were allowed to recover for 20 min in suspension. Cell staining was performed using mouse monoclonal antibodies followed by fluorescein isothiocyanate (FITC)-conjugated affinity-purified mouse fluorochromeconjugated isotype control antibodies, or FITC or phycoerythrin (PE)-coupled antibodies against the common leukocyte antigen CD45 (Becton Dickinson, USA), the surface-expressed 5ʹ-ectonucleotidase CD71 (Becton Dickinson), the β 1 -integrin CD29 (Becton Dickinson), CD11a (Becton Dickinson), CD166 (Becton Dickinson), CD117 (Abcam, UK), CD34 (Becton Dickinson) and CD44 (Becton Dickinson); all antibodies used following the manufacturers instructions. Binding of antibodies against the markers as primary antibodies was detected by antimouse immunoglobulin G (IgG) conjugate (Becton Dickinson), or isotype-specific FITC- or PE-conjugated goat anti-mouse IgG F(abʹ)2 fragments (Becton Dickinson). Cells were analysed by fluorescence-activated cell sorting (FACS) using a FACSCalibur flow cytometer. Results are expressed as the mean percentage of positive cells and standard deviation from multiple experiments. Induction of hbmsc Isolated cells were cultured at 37 C in an atmosphere of 5% CO 2 in RPMI-1640 (Invitrogen) supplemented with 10% FBS and 50 μg/ml penicillin/streptomycin (Haribin Biological Technology Corporation, China). Cells of 5 10 passages were used to induce differentiation. The cells were cultured for days in DMEM containing 10 5 mol/l retinoic acid (RA; Sigma, USA) in combination with extracts derived from adult goat testis. The preparation of testis extracts was based on the method of Häelien et al. (2004). The protein concentration of the extract was estimated spectrophotometrically and added to the medium to give a concentration of 50 μg/ml. RNA isolation and reverse transcriptionpolymerase chain reaction analysis RNA was extracted from cells and human fetal testis using the Trizol reagent (Invitrogen) according to the manufacturer s instruction. For reverse transcription-polymerase chain reaction (RT-PCR) analysis, 1 μg RNA with DNase treatment was reverse transcribed into cdna at 42 C for 50 min in a final volume of 20 μl containing 200 units Superscript reverse transcriptase (Invitrogen), 0.5 μg oligo dt Primer, 10 mmol/l dithiothreitol and 0.5 mmol/l dntps. RT-PCR was carried out with 0.5 μl cdna, 30 pmol each of forward and reverse primers and 2 units Platinum Taq polymerase (Invitrogen, Germany) in a final volume of 15 μl. The solution was incubated at 94 C for 2 min and then subjected to 35 cycles of amplification, each consisting of 95 C for 30 s (denaturation), C for s (annealing) and 72 C for 60 s (primer extension). At the end of the temperature cycles the solution was incubated at 72 C for 10 min. The PCR products were subjected to electrophoresis on 1.0% (w/v) agarose gels containing 1 mg/ml ethidium bromide and the amplified fragments were viewed and photographed under UV light. Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. The primers used for RT-PCR analyses are shown in Table 1. Primers were designed to span exons to distinguish cdna from genomic DNA products. Immunofluorescence staining Cells from treatment groups treated for days with RA in combination with testicular extracts, and untreated cells as controls, were used for immunofluorescence studies. The cultures were fixed using 4% paraformaldehyde for 15 min, followed by three washes in cold PBS for 5 min. Washed cultures were treated with blocking solution (1% bovine serum albumin in phosphate-buffered saline (PBS)/Tween) for a minimum of 30 min before being washed with PBS and treated with primary antibodies against OCT4 (1:500; Chemicon), β 1 - integrin (1:100; Santa Cruz Biotechnology, Inc., USA), DDX4 (1:1000; Abcam), EMA1 (1:100; Developmental Studies Hybridoma Bank, USA) and FE-J1 (1:100; Developmental Studies Hybridoma Bank) overnight at 4 C. Antibodies were diluted according to the manufacturer s or provider s instructions. Cultures were washed with PBS and incubated in the appropriate secondary antibody conjugated with FITC or tetramethylrhodamine iso-thiocyanate (1:500 dilution in PBS; Invitrogen) for 30 min at room temperature in the dark. Then cells were washed with cold Dulbecco s PBS three times for 5 min. Slides were mounted and inspected under a Leica fluorescence microscope. Results Three hbmsc cultures from human fetal bones were identified and induced for differentiation to germ cells. The individual

3 Table 1. The primers and polymerase chain reaction (PCR) conditions used for the reverse transcription-pcr analysis of treated human bone marrow stem cells. Gene Sense Antisense Product Annealing size (bp) temperature ( C) GAPDH TTAGCACCCCTGGCCAAGG CTTACTCCTTGGAGGCCATG c-kit TGACTTACGACAGGCTCGTG AAGGAGTGAACAGGGTGTGG OCT4 CGTGAAGCTGGAGAAGGAGAACTG CAAGGGCCGCAGCTTACACATGTTC DDX4 AAAGTGCCCAGTTCTTGTTGC TACCTGGATTGGGAGCTTGTGAAG DAZL ATGAAAGATAAAACCACCAACC TGTTGACAGCCTGGTCCACTGA STELLA CTCAAATCTCCTCCGAGACG GTACGAACTCCGCCCAGTAA β 1 -Integrin CTGCAAGAACGGGGTGAATG CACAATGTCTACCAACACGCCC FSHR TGAGGGCCAGGTCGACTTAC TGAGGCTGGCTTCCATGAG STRA8 AGCAGCTTAGAGGAGGTCAAGA TACTCGGAACCTCACTTTTGTC NANOG GCGCGGTCTTGGCTCACTGC GCCTCCCAATCCCAAACAATACGA htert GTGTGCTGCAGCTCCCATTTC GCTGCGTCTGGGCTGTCC SCP3 CTAGAATTGTTCAGAGCCAGAGA GTTCAAGTTCTTTCTTCAAAG ACR ATGACTGGAGACTGGTTTTCGG CTTAGCACGGGCACAGCCTA PRM1 AACCGAAGTAACATATACTCA ATCTGCTTTCTCCACGACCTC TH2B GTGCTACCATTTCCAAGAAG CTCGCTATACGCTCAAAGAT hbmsc appeared as spindle-shaped-like fibroblasts and the cells were unique in their phenotypes and assumed a monolayer configuration on reaching confluency during culture (Figure 1A C). Giemsa staining of hbmsc at passage 5 8 indicated that most of the cells were of mononuclear fibroblast morphology (Figure 1D). Overgrown confluent mononuclear cells in culture formed colonies (Figure 1E, F). The cells after five passages showed strong positive homogeneous staining for markers of mesenchymal progenitors; these markers included CD44 (Figure 2A), CD133 (Figure 2B), CD166 (Figure 2C), and the β 1 -integrin CD29 (Figure 2D). Meanwhile, these cells were negative for the markers of haematopoietic cells (CD11a; Figure 2E), and they showed weak expression of CD45 (Figure 2F), CD117 (Figure 2G) and CD71 (Figure 2H), which denote haematopoietic or mature fibroblast differentiation. To investigate the potential of hbmsc for differentiation into germ cells, the cells were treated with 10 5 mol/l RA and it was found that there were some round cells and a small number of sperm-like cells formed in the treated cultures (Figure 3). The results of RT-PCR analysis demonstrated that initially RAtreated and testicular-extract-treated and untreated hbmsc were positive for some pre-meiotic germ cell markers and markers of ESC and primordial germ cells (PGC) (Figure 4). However, the expression of the meiotic and post-meiotic markers STRA8, SCP3 and PRM1 increased in RA-treated cultures compared with the untreated group based on semi-quantitative RT-PCR (Figure 4). The expression of germ cell markers in hbmsc was consistent with previous observations (Nayernia et al., 2006a) that also indicated spontaneous differentiation of part or all of the population of human mesenchymal bone cells (hmsc) to germ cells in vitro. To confirm the effects of RA and testicular extracts together on differentiation of hmsc to germ cells, the cells were treated for 2 15 days with 10 5 mol/l RA and testicular extract. Some round and spindle-shaped cells derived after the treatment of hbmsc with RA and testicular extract showed specific expression of OCT4, VASA, β 1 -integrin and SSEA1 by immunohistochemical analysis (Figure 5). However, a small number of spermatidlike cells (<3%) in culture for days expressed FE-J1 and EMA1. All these genes are expressed specifically in PGC, spermatogonial stem cells and male germ cells (Bowles et al., 1982; Fenderson et al., 1984; Hahnel and Eddy, 1986; Hartshorne, 1997; Clark et al., 2004). After RA and testicular extract treatment, an increase in the number of cells which expressed DDX4 was detected compared with untreated cells (20% versus 5%, P < 0.01). The percentage of cells positive for germ cell markers (DDX4, FE-J1 and EMA1) was increased in induction cultures compared with the untreated group (Figure 6). The results indicated that a small subpopulation of hbmsc is able to differentiate to male germ cells and a few spermlike cells (Figure 6). However, it has not yet been determined whether these male germ cells can complete meiosis and form functional spermatozoa. Discussion Two independent reports have used a three-dimensional embryoid body differentiation strategy for male ESC, concomitant with RA treatment and/or bone morphogenetic protein 4 stimulation, to induce embryoid body differentiation into male germ cells (Toyooka et al., 2003; Geijsen et al., 2004). Nayernia et al. (2006a,b) cultured male ESC transfected with a Stra8 (stimulated by retinoic acid gene 8)-reporter and a Prm1 (protamine 1)-reporter construct in monolayer culture. Following repeated RA treatments and selection of Stra8- positive cells, Prm1-positive cells were isolated and injected into eggs, and seven live pups carrying the Prm1-reporter gene were born when the resulting embryos were transferred to surrogate mothers. Additionally, male germ cells were produced from embryonal carcinoma cells and bone-marrow-derived 101

4 Figure 1. The characteristics of human bone marrow stem cells (hbmsc). (A, B) The cells showed a spindle or fibroblast-shaped morphology. (C) A confluent culture grown as a monolayer of spindle-shaped hmsc. (D) Giemsa staining of hbmsc shows that most of the cells are of mononuclear fibroblast morphology. A phase-contrast micrograph (E) and Giemsa staining (F) show confluent mononuclear cultures of hbmsc colonies. Bar = 50 μm. 102 Figure 2. Human mesenchymal stem cells (hmsc) at fifth passage were analysed after immunofluorescence staining with flow cytometry. Staining profiles of representative samples with 10,000 events each are shown. The markers are represented by shaded histograms. The cells stained homogeneously strong with markers for mesenchymal progenitors such as CD44 (A), CD133 (B), CD166 (C), and the β 1 -integrin CD29 (D), were negative for the markers of haematopoietic cells (CD11a (E)), and weakly expressed CD45 (F), CD117 (G) and CD71 (H).

5 Figure 3. The morphology of treated human bone marrow stem cells (hbmsc). (A) Control (untreated hbmsc) confluent mesenchymal stem cells. (B, C) Some sperm-like cells (indicated by arrows) were formed in treated hbmsc 10 days after treatment with 10 5 mol/l retinoic acid. Bar = 100 μm. Figure 4. Reverse transcription-polymerase chain reaction analysis showing the expression of germ cell markers in treated human bone marrow stem cells (hbmsc). Treated hbmsc were positive for premeiotic germ cell markers and markers of embryonic stem cells and primordial germ cells, and for meiotic and post-meiotic markers such as OCT4, NANOG, htert, STELLA, DAZL and c-kit, DDX4, β 1 -integrin, STRA8, SCP3, ACR, PRM1 and TH2B. RNA isolated from human fetal testis served as the positive control. hmsc = human mesenchymal stem cell. Figure 5. Immunohistochemical analysis of treated human bone marrow stem cells (hbmsc). Specific antibodies against the germ cell and male germ cell markers OCT4 (A, green; bar = 20 μm), VASA (B, green; bar = 50 μm), β 1 -integrin (C, green; bar = 50 μm), EMA1 (D, red; bar = 50 μm) in a spermatid-like cell were obtained in treated cultures (E), bar = 50μm. The spermatidlike cell was positive for FE-J1 (F red, bar = 50 μm). 103

6 104 Cells positive for germ cell markers (%) hbmsc DDX4 Induction hbmsc FE-J1 Induction hbmsc EMA1 Induction Figure 6. The effect of retinoic acid (RA) on the differentiation of human mesenchymal stem cells (hmsc) to male germ cells. After RA treatment, an increase in the number of cells expressing DDX4, FE-J1 and EMA1 was detected as compared with untreated cells. The percentage of positive cells is shown. MSC in mice using a similar RA-based approach (Nayernia et al., 2004, 2006a). Moreover, Nayernia et al. (2006a) reported that human bone marrow also has the potential to differentiate into spermatozoa. Some cells with specific expression of male germ-like cells and a small fraction of sperm-like cells were derived from hbmscs in this study. As far as is known, this is the first report of the production of sperm-like cells derived from human adult stem cells. These results showed that RA can stimulate stem cells to differentiate into spermatozoa in vitro (Toyooka et al., 2003; Geijsen et al., 2004; Nayernia et al., 2006a,b). But RA is a multipurpose factor, which can regulate the development and differentiation of neural cells, cardiac cells and many other tissues in addition to germ cells. The appropriate concentration of RA and its temporal effects to induce germ cell specification from stem cells needs further investigation. Lue et al. (2007) showed that adult bone marrow cells, in a favourable testicular environment, may differentiate into somatic and germ cell lineages. The resident neighbouring cells in the recipient testis may control site-appropriate stem cell differentiation. These observations promise new models of germ cell development and therapy for infertility using bone marrow cells. But the defined pathway of germ cell development, differentiation derived stem cells needs to be further investigated. OCT4 and Nanog are transcription factors involved in the regulation of pluripotency during embryonic development and are detected in both pluripotent cells and other early germ cells (Allergrucci et al., 2005; Nagano, 2007). In the adult murine testes, undifferentiated spermatogonial cells expressing OCT4 are distributed on the basement membrane of the seminiferous tubules (Nagano, 2007). Expression of fragilis (also called Ifitm3) is increased in the migratory PGC, and expression of other germ-cell-specific genes such as STELLA (Saitou et al., 2002; Sato et al., 2002) and the VASA homologue (Toyooka et al., 2003) is also increased. VASA (Mvh/DDX4) encodes an ATP-dependent RNA helicase which is specific for differentiating germ cells from the late migration stage to the post-meiotic stage, with the gene being specifically expressed in early PGC. The FSH receptor is a seven transmembrane spanning receptor which plays a crucial role in male and female reproduction (Piketty et al., 2006). Recent studies have reported that the decision of meiotic entry or mitotic arrest of post-migratory PGC is regulated by RA. Male PGC do not enter meiosis because an enzyme (Cyp26b1) expressed in somatic cells in the male genital ridge degrades RA. In contrast, the repression of Cyp26b1 expression in females or its lack in nullmutant embryos allows PGC to enter meiosis (Koubova et al., 2006). These studies suggest that RA may promote meiotic entry of PGC into the genital ridge. PGC that migrate to an ectopic site (e.g. adrenal gland) spontaneously enter meiosis, regardless of their genetic sex. Additionally, RA can stimulate mitotic proliferation of PGC up to 13.5 days post coitus. Therefore, while migratory and post-migratory PGC appear to respond differently to RA, the gonadal somatic environment also has an important role in regulating sex-specific germ cell development. RA is helpful for the derivation of germ cells from ESC in vitro (Toyooka et al., 2003; Geijsen et al., 2004; Nayernia et al., 2006a,b). During embryogenesis, Stra8 expression is restricted to the pre-meiotic male developing germ cells (Oulad-Abdelghani et al., 1996). DAZ-like (DAZL) proteins are germ-cell-specific RNA-binding proteins essential for gametogenesis. In humans, loss of the Y chromosomal DAZ genes is associated with oligozoospermia or azoospermia. The DAZ genes are strong candidates for azoospermia factor c, which is one of the most common genetic causes of male infertility (Xu et al., 2007). PGC and spermatogonial cells express the cytokine receptor c-kit at relatively high levels. β 1 -Integrin and OCT-4 were expressed in germline stem cells; c-kit is a marker of spermatogonia and spermatocytes, while synaptonemal complex protein 3 (SCP3) and testis-specific histone protein (TH2B) are markers of spermatocytes, and transition protein in spermatids (Lee et al., 2006). The presence of mrna corresponding to the protamine genes can be detected in the mature testicle but also in the mature spermatozoa (Lambard et al., 2004). In the present study, it was found that hbmsc expressed OCT4, STELLA, VASA and c-kit before and after RA treatment, and this was evidence that a population of MSC shows germ cell characteristics without RA treatment (Figure 3). The results are consistent with those of Nayernia et al. (2006). However, expression of some genes, such as DDX4, STRA8, SCP3 and PRM1, specific for germ cells and male germ cells, was increased after RA in combination with testicular extract treatment which indicates that RA treatment promotes germ cell differentiation of human MSC. SCP3 is a specific marker of meiosis in male and female germ cells (Hartshorne, 1997). From these results it can be suggested that a population of hbmsc shows expression of male germcell-specific markers. These studies suggest the possibility that human MSC may recruit the germ line for undergoing meiosis. However, the completion of meiosis in ESC-derived germ cells in vitro might be promoted by additional appropriate germ cell factors and/or somatic cell interactions that are native to the specific in-vivo environment (Hua and Sidhu, 2008). In conclusion, it was found that induced hbmsc expressed the markers of male germ cell and spermatocytes, which suggests that hbmsc have the potential to differentiate into male germ cells, and adds a new potential source of male germ cells that may be used for production of male germ cells that are used for various reproductive toxicological studies.

7 Acknowledgements This work was supported by grants from the Program ( ) from National Natural Science Foundation of China, the Scientific Research Program of Shaanxi Province (2008K02 05), China Postdoctoral Science Foundation funded project ( ), and the Youth Research Key Member Program of Northwest A & F University ( ). References Allergrucci C, Thurston A, Lucas E, Young I 2005 Epigenetics and the germline. Reproduction 129, Bowles J, Knight D, Smith C et al Ectopic germ cells: natural model for the study of germ cell sexual differentiation. Proceedings of the National Academy of Sciences of the USA 79, Clark AT, Bodnar MS, Fox M et al Spontaneous differentiation of germ cells from human embryonic stem cells in vitro. Human Molecular Genetics 13, Danner S, Kajahn J, Geismann C et al Derivation of oocyte-like cells from a clonal pancreatic stem cell line. Molecular Human Reproduction 13, Dyce PW, Wen L, Li J 2006 In vitro germline potential of stem cells derived from fetal porcine skin. Nature Cell Biology 8, Fenderson BA, O Brien DA, Millette CF, Eddy EM 1984 Stagespecific expression of three cell surface carbohydrate antigens during murine spermatogenesis detected with monoclonal antibodies. Developmental Biology 103, Geijsen N, Horoschak M, Kim K et al Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 427, Hahnel AC, Eddy EM 1986 Cell surface markers of mouse primordial germ cells defined by two monoclonal antibodies. Gamete Research 15, Hartshorne GM 1997 In vitro culture of ovarian follicles. Reviews of Reproduction 2, Hua J, Sidhu K 2008 Recent advances in the derivation of germ cells from the embryonic stem cells. Stem Cells and Development 17, Hübner K, Fuhrmann G, Christenson LK et al Derivation of oocytes from mouse embryonic stem cells. Science 300, Jiang Y, Jahagirdar BN, Reinhardt RL et al Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418, Koubova J, Menke DB, Zhou Q et al Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proceedings of the National Academy of Sciences of the USA 103, Lambard S, Galeraud-Denis I, Martin G et al Analysis and significance of mrna in human ejaculated sperm from normozoospermic donors: relationship to sperm motility and capacitation. Molecular Human Reproduction 100, 1 7. Lammarrone E, Balet R, Lower AM et al Male infertility. Best Practice and Research Clinical Obstetrics and Gynaecology 17, Lawson KA, Hage WJ 1994 Clonal analysis of the origin of primordial germ cells in the mouse. Ciba Foundation Symposium 182, Lee DR, Kim KS, Yang YH et al Isolation of male germ stem cell-like cells from testicular tissue of non-obstructive azoospermic patients and differentiation into haploid male germ cells in vitro. Human Reproduction 21, Lue YH, Erkkila K, Liu PY et al Fate of bone marrow stem cells transplanted into the testis: potential implication for men with testicular failure. American Journal of Pathology 170, Nagano MC 2007 In vitro gamete derivation from pluripotent stem cells: progress and perspective. Biology of Reproduction 76, Nayernia K, Lee JH, Drusenheimer NN et al. 2006a Derivation of male germ cells from bone marrow stem cells. Laboratory Investigation 86, Nayernia K, Nolte J, Michelmann HW et al. 2006b In vitro differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Development Cell 11, Nayernia K, Li M, Jaroszynski L et al Stem cell based therapeutical approach of male infertility by teratocarcinoma derived germ cells. Human Molecular Genetics 13, Oulad-Abdelghani M, Bouillet P, Decimo D et al Characterization of a premeiotic germ cell-specific cytoplasmic protein encoded by Stra8, a novel retinoic acid-response gene. Journal of Cell Biology 135, Piketty V, Kara E, Guillou F et al Follicle-stimulating hormone (FSH) activates extracellular signal-regulated kinase phosphorylation independently of beta-arrestin- and dynaminmediated FSH receptor internalization. Reproductive Biology and Endocrinology 33, Pittenger MF, Mackay AM, Beck SC et al Multi-lineage potential of adult human mesenchymal stem cells. Science 284, Saitou M, Barton SC, Surani MA 2002 A molecular programme for the specification of germ cell fate in mice. Nature 418, Sato M, Kimura T, Kurokawa K et al Identification of PGC7, a new gene expressed specifically in preimplantation embryos and germ cells. Mechanisms of Development 113, Toyooka Y, Tsunekawa N, Akasu R, Noce T 2003 Embryonic stem cells can form germ cells in vitro. Proceedings of the National Academy of Sciences of the USA 100, Xu H, Li M, Gui J, Hong Y 2007 Cloning and expression of medaka dazl during embryogenesis and gametogenesis. Gene Expression Patterns 7, Zhao GQ, Garbers DL 2002 Male germ cell specification and differentiation. Developmental Cell 5, Declaration: The authors report no financial or commercial conflicts of interest. Received 26 June 2008; refereed 21 August 2008; accepted 9 February