Genes, Environment and Microbiome Interactions in the Development of Diabetes & Metabolic Syndrome
|
|
|
- Jocelin Moore
- 5 years ago
- Views:
Transcription
1 Genes, Environment and Microbiome Interactions in the Development of Diabetes & Metabolic Syndrome Harvard Medical School October 3, 2018 C. Ronald Kahn, MD Harvard Medical School
2 Disclosures Over the past 3 years, I have served on the SAB or consulted for: Antriabio CohBar ERX Therapeutics Flagship Pioneering Kaleido Biosciences MedImmune Merck The work being presented was supported by: The Mary K. Iacocca Professorship
3 The Kahn Lab Past and Present Seigfried Ussar Carly Cederquist Kris Kriauciunas Emrah Altindis Francois Moreau Samir Softic Ella Li Marion Soto Marcos Damasio Damla Mergen Alfred Ramirez Ruben Garcia Bruna Brandao Waikang Cai Shiho Fujisaka Grace Wang Tamires Zanotto Thiago Batista Jasmin Lebastchi Collaborators: Jeffrey Gordon, Nick Griffin, Lynn Bry, Clary Clish, Julian Avila-Pacheco, Alex Kostic, Jonathan M. Dreyfuss, Hui Pan
4 Insulin Resistance: At the Core of Epidemic of Metabolic Syndrome Genes Central Obesity Glucose Intolerance Type 2 Diabetes Environment Hypertension Dyslipidemia Insulin Resistance Accelerated Atherosclerosis Hepatic Steatosis Gallstones Reproductive Dysfunction Increased Cancer Risk Impaired Longevity Microbiome Alzheimer s Disease
5 Modeling the Complexity of Gene- Environment Interactions in the Mouse Is it genes or is it environment? Or perhaps, it is the gut microbiome. Composited Data 5
6 Relative Abundance Differences in Gut Microbiota in Mice As They Arrive From Jackson Labs and Taconic Farms Diversity of Microbiota Firmicutes vs. Bacteriodetes Studies of have revealed that obese and type 2 diabetic rodents and humans have alterations in the gut microbiome: Lower diversity of microbes Higher ratio of Firmicutes to Bacteroidetes Pattern of obesity and diabetes, but diabetes-resistant or obesity- and diabetes-resistant 0.0 B6J 129J 129T Ussar, et al Cell Metab, 2015
7 Differences in Gut Microbiome in Mice B6J 129J 129T :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales New.Ref OTU969:Bacteroidales :Bacteroidales :Bacteroidales New.RefOTU3310:Bacteroidales :Bacteroides 2045:Bacteroides 1994:Bacteroides :Bacteroides_acidifacines :Parabacteroides_goldsteinii :Porphyromonadaceae :Porphyromonadaceae :Porphyromonadaceae New.Ref OTU6295:Porphyromonadaceae :Porphyromonadaceae :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridium :Clostridium :Clostridium :Clostridium :Clostridium :Clostridium :Clostridium :Eubacterium_plexicaudatum :Eubacterium_ventriosum r :Lactobacillus_murinus :Lactobacillus_reuteri :Lactobacillus :Lactobacillus_gasseri :Turicibacter_sanguinis 95638:Mucispirillum_schaedleri :Bifidobacterium :Akkermansia_muciniphila Abundance Log10 Bacteroidetes Firmicutes Deferribacteria Actinobacteria Verrucomicrobia Ussar, et al Cell Metab, 2015
8 Effect of Joslinization on the Gut Microbiome in Mice Vendor Bred B6J 129J 129T Joslin Bred B6J 129J 129T :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales :Bacteroidales New.Ref OTU969:Bacteroidales :Bacteroidales :Bacteroidales New.RefOTU3310:Bacteroidales :Bacteroides 2045:Bacteroides 1994:Bacteroides :Bacteroides_acidifacines :Parabacteroides_goldsteinii :Porphyromonadaceae :Porphyromonadaceae :Porphyromonadaceae New.Ref OTU6295:Porphyromonadaceae :Porphyromonadaceae :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridiales :Clostridium :Clostridium :Clostridium :Clostridium :Clostridium :Clostridium :Clostridium :Eubacterium_plexicaudatum :Eubacterium_ventriosum r :Lactobacillus_murinus :Lactobacillus_reuteri :Lactobacillus :Lactobacillus_gasseri :Turicibacter_sanguinis 95638:Mucispirillum_schaedleri :Bifidobacterium :Akkermansia_muciniphila Abundance Log10 Per 10 4 reads Bacteroidetes Firmicutes Deferribacteria Actinobacteria Verrucomicrobia Ussar, et al Cell Metab, 2015
9 Weight Gain (g) Change in Weight Gain After Breeding at Joslin for 3 Generations Weight Gain Over 8 Weeks 30 Commercial Bred Joslin Bred 25 HFD 20 HFD CD CD 5 CD HFD CD HFD CD HFD CD HFD CD HFD CD HFD B6Jax 129Jax 129Tac B6Jax 129Jax 129Tac Ussar, et al Cell Metab, 2015
10 Glucose (mg/dl) Glucose (mg/dl) Effect of Joslinization on Glucose Tolerance Vendor Imported Joslin Bred 700 B6J 700 B6J/Jos J J/Jos T T/Jos Time (minutes) Time (minutes) Chow Diet, 12 week old males Ussar, et al Cell Metab, 2015
11 Antibiotic Treatment in Analysis of Obesity and Insulin Resistance in Strains of Mice Jackson Lab Taconic Shiho Fujisaki, JCI 2016 Weeks of age 6 7 B6 129J 129T Placebo Vancomycin Metronidazole Placebo Vancomycin Metronidazole Placebo Vancomycin Metronidazole HFD (60%) Body weight DEXA CLAMS ITT GTT Insulin Signaling n=16
12 Changes in Gut Microbiota in HFD-Fed Mice After 8 Weeks of Antibiotic Rx HFD HFD + Vancomycin HFD + Metronidazole Tenericutes B6J Firmicutes Bacteroidetes Proteobacteria Firmicutes Proteobacteria Firmicutes Verrucomicrobia Bacteroidetes Deferribacteres Deferribacteres 129T Firmicutes Proteobacteria Firmicutes Proteobacteria Firmicutes Bacteroidetes 129J Verrucomicrobia Firmicutes Proteobacteria Firmicutes Verrucomicrobia Proteobacteria Firmicutes Shiho Fujisaki, JCI 2016
13 Glucose (mg/dl) Antibiotic Treatment Glucose Levels and Improves Insulin Sensitivity of HFD B6J Mice Blood Glucose ** ** HFD+Placebo HFD+Vancomycin HFD+Metronidazole Shiho Fujisaki, JCI 2016
14 pakt/akt Antibiotic Treatment Improves Insulin Signaling in Liver of HFD-fed B6J Mice B6J Placebo Vancomycin Metronidazole Insulin pir pakt AKT Insulin - Insulin + ** * ** * perk 10 ERK 5 perk pakt 0 Placebo Vanco Metro HF-fed 9 weeks Ab treated 10 weeks Fasted 2 hrs Insulin (5U)/saline injected into vena cava Shiho Fujisaki, JCI 2016
15 Improvements in Glucose Tolerance and Insulin Signaling are Transferrable to Germ-Free Mice 6 weeks Chow HFD 60% Donors Germ-Free C57Bl/6 Mice GUT MICROBIOTA TRANSFER Insulin Signaling in Muscle pir Chow HFD HFD+M HFD+V pakt perk Actin n=8/groups - 4h fasting Insulin Fujisaki, JCI 2016 Placebo Vancomycin Metronidazole
16 HFD and Antibiotics Modify Hypothalamic Insulin Signaling in HFD Mice Hypothalamus Chow HFD HFD+M HFD+V Insulin pir IR pirs1 IRS1 Actin ** * * n=8/groups 4h fasting - 5U insulin or saline * P<0.05, ** P < 0.01, *** P<0.001 Soto, et al, Mol. Psych., 2018 Insulin Chow HFD HFD+M HFD+V
17 After 30 minutes HFD and Antibiotics Alter Marble Burying and Other Behaviors in Mice Marble burying Chow * ** ** HFD t = 0 HFD + V HFD + M Soto, et al, Mol. Psych., 2018 Abnormal open field test and tail suspension test. This phenotype can be transferred to germ-free mice by cecal transfer N=14 mice/group *P < 0.05, **P < 0.01
18 Potential Mechanisms by Which Gut Microbiome Can Modify Metabolism Endotoxins/Cytokines Metabolic Regulation Immune Activation Changes in Gut Barrier Changes in Food/Bile Acid Metabolism Changes in Metabolite and Bile Acid Signaling Metabolic Syndrome Genes Changes in gut microbiome Modified from Serino, Diabetes & Metabolism Reviews, 2009
19 PiCRUST Modeling of the Microbial Metagenome After HFD and Antibiotics B6J 129T 129J C P V M C P V M C P V M Fujisaki, Cell Reports, 2018
20 LC-MS Untargeted Metabolomics Platform Clish Laboratory Cardiac or Portal blood Cecal contents Fujisaki, Cell Reports, 2018
21 Metabolomic Analysis of Cecal Contents and Plasma Highly Regulated Known Metabolites Cecal Metabolites Plasma Metabolites Amino acids & derivatives TCA Cycle/ Sugars/Sugar phosphates Acyl carnitines/ fatty acids Triglycerides Diacylglycerols Phospholipids Nucleosides Bile acids Vitamins C H V M C H V M C H V M C H V M C H V M C H V M B6J 129T 129J B6J 129T 129J Fujisaki, Cell Reports, 2018
22 Tracking Histidine Metabolism in Cecum and Blood Fujisaki, Cell Reports, in press
23 Relative Abundance Log2 Effect of HFD & Antibiotics on Serum Bile Acids Deoxycholic Acid Taurodeoxycholic Acid 21 B6J 129T 129J B6J 129T 129J C H V M C H V M C H V M 10 C H V M C H V M C H V M Pro-Inflammatory Anti-Inflammatory Fujisaki, JCI,2016
24 Relative expresson (AU) B6J Antibiotic Treatment Reduces Inflammatory Genes in Liver of High-Fat Fed B6J Mice Liver Inflammatory Gene Expression ** ** ** ** * TNFa IL-6 IL-1b F4/80 Emr1 TGFb1 Col1a1 Placebo Vancomycin Metronidazole Fujisaki, JCI, 2016 These changes were not observed in 129T or 129J mice.
25 Metabolites Which Correlate With Insulin Resistance Across Diets, Strains and Antibiotic Treatment Rank of metabolite Rank of metabolite Correlate Positively Aminoadipate Alpha-hydroxybutyrate Acetylglycine C16 carnitine Insulin resistance scores Correlate Negatively Adipate C34:2 PC plasmalogen C36:2 PC plasmalogen C58:6 TAG Insulin resistance scores Fujisaki, Cell Reports, 2018
26 Diet and Antibiotics Alter Over 1000 Unknown Metabolites in Mouse High in B6J Mice but not regulated Increased by HFD Increased by Metronidazole Low in B6J and increased by antibiotics Low in B6J and unchanged by antibiotics Increased by HFD Decreased by both antibiotics Decreased by HFD Unaffected by antibiotics Fujisaki, Cell Reports, 2018 C H V M C H V M C H V M B6J 129T 129J 26
27 Examples of Unknown Metabolites Altered by Diet, Strain or Antibiotics Fujisaki, Cell Reports, 2018 Another unknown with this pattern, but mz: = metronidazole
28 Summary & Conclusions Obesity and diabetes are the result of interactions between genes and the environment. One environmental modifier, the gut microbiome, is itself a result of interactions between host genes & environment. Many of the effects of diet and the microbiome are marked, and possibly mediated, by changes in circulating metabolites which can directly and indirectly alter insulin signaling. Over 1000 unknown metabolites also change dramatically with diet, strain and antibiotic treatment Understanding these interactions and these new metabolites may provide new ways to prevent and treat obesity, diabetes and the metabolic syndrome.
29 Genes, Environment, Diet and the Gut Microbiome In Metabolic Syndrome Genetics Environment Critical Metabolites Diet Obesity, Diabetes & Metabolic Syndrome Gut Microbiome Critical Metabolites Behavior, Mood and CNS Function
Antibiotic effects on gut microbiota and metabolism are host dependent
Antibiotic effects on gut microbiota and metabolism are host dependent Shiho Fujisaka, 1 Siegfried Ussar, 1,2 Clary Clish, 3 Suzanne Devkota, 4 Jonathan M. Dreyfuss, 5,6 Masaji Sakaguchi, 1 Marion Soto,
The Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain
The Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain Michael T. Bailey, Ph.D. Center for Microbial Pathogenesis The Research Institute, Nationwide Children s Hospital Department
Diet, microbiota and the immune system: A gut feeling about type 1 diabetes. Dr. Eliana Mariño Monash University Melbourne, Australia
Diet, microbiota and the immune system: A gut feeling about type 1 diabetes Dr. Eliana Mariño Monash University Melbourne, Australia Diet, gut microbiota and Western lifestyle diseases Asthma Fatty liver
The impact of the microbiome on brain and cognitive development
The Gut-Brain Axis The impact of the microbiome on brain and cognitive development Diane Stadler, PhD, RD Oregon Health & Sciences University, Portland, Oregon Lao-American Nutrition Institute With acknowledgements
The number of microorganisms residing in our intestines is 10 times the number of our somatic and germ cells.
The number of microorganisms residing in our intestines is 10 times the number of our somatic and germ cells. The number of microorganisms residing in our intestines is 10 times the number of our somatic
Microbiome as Predictor of Benefit and Toxicity in Cancer Immunotherapy
Microbiome as Predictor of Benefit and Toxicity in Cancer Immunotherapy Giuliana Magri, Ph.D Optimizing Immunotherapy New Approaches, Biomarkers, Sequences and Combinations PRBB Auditorium, Barcelona October
Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
Analysis of the effect of probiotics on shaping human gut microbiota
Analysis of the effect of probiotics on shaping human gut microbiota Masahira HATTORI Center for Omics and Bioinformatics, The University of Tokyo http://www.cb.k.u-tokyo.ac.jp/hattorilab
8/14/2016. Diet, Gut Bacteria, and Metabolic Disease: Strategies to Promote Healthy Microbial Communities. Outline. The Human Microbiome:
8/14/216 Diet, Gut Bacteria, and Metabolic Disease: Strategies to Promote Healthy Microbial Communities Kristina Martinez PhD, RD Postdoctoral Research Scholar University of Chicago Chicago, IL Outline
Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile
Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile Infection: Application of a Novel Diagnostic for Dysbiosis Courtney Jones, BS Rebiotix Inc. Roseville, MN USA
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12198 1. Supplementary results 1.1. Associations between gut microbiota, glucose control and medication Women with T2D who used metformin had increased levels of Enterobacteriaceae (i.e.
Why Obese People are Unable to Keep Weight Off After Losing It
Why Obese People are Unable to Keep Weight Off After Losing It Robert E. Ratner, MD Chief Scientific and Medical Officer American Diabetes Association I have no Pertinent Financial Disclosures Change in
Microbiome GI Disorders
Microbiome GI Disorders Prof. Ram Dickman Neurogastroenterology Unit Rabin Medical Center Israel 1 Key Points Our gut microbiota Were to find them? Symbiosis or Why do we need them? Dysbiosis or when things
Microbial Adaptations of the Microbiome. Damian R. Plichta, PhD Director of Bioinformatics
Microbial Adaptations of the Microbiome Damian R. Plichta, PhD Director of Bioinformatics Tailored shotgun metagenomics Microbiome model for biomarker discovery microbiome incoming species conditional
Microbiome and liver diseases
Klinik und Poliklinik für Innere Medizin I Microbiome and liver diseases Bernd Schnabl, M.D. Department of Medicine I have no financial relationship relevant to my presentation AND my presentation does
Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1,
Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1, additional measures of diversity are shown: Figure S2, SDC
Gut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor
Gut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor Michelle I. Smith et al. Science 339, 548 (2013) Dept Meeting, 28 May 2013, M. UMEZAKI ABSTRACT. Kwashiorkor, an enigmatic form of severe
Gut Microbiota and IBD. Vahedi. H M.D Associate Professor of Medicine DDRI
Gut Microbiota and IBD Vahedi. H M.D Associate Professor of Medicine DDRI 1393.3.1 2 GUT MICROBIOTA 100 Trillion Microbes - 10 times more than cells in our body Collective weight of about 1kg in human
The human microbiome and how it affects heath. Nafisa M. Jadavji, PhD
The human microbiome and how it affects heath Nafisa M. Jadavji, PhD NafisaJadavji@cunet.carleton.ca Lecture Outline Housekeeping Introduction Research Initiatives to Understand Microbiome Microbiota Development
traits and fasdng TMAO concentradons..6
FIGURE S1: Variability of gut microbiota composidon in Metsim samples 2 FIGURE S2: AssociaDon of bacterial diversity and richness measures with traits.3 FIGURE S3: AssociaDons of OTUs with fasdng blood
Diet, Microbiome and Health Cindy D. Davis
Diet, Microbiome and Health Cindy D. Davis davisci@mail.nih.gov OFFICE OF DIETARY SUPPLEMENTS 1 Outline 1.What is the microbiome? 2.How does it vary over the lifespan? 3.What is the evidence that diet
general meeting 1 20 October 2016
general meeting 1 20 October 2016 introductions today s topics the human microbiome about the study the human microbiome the human microbiome human microbiota: the microorganisms that live within and on
HUMAN GUT MICROBIOTA
HUMAN GUT MICROBIOTA Patrizia Brigidi Department of Pharmaceutical Sciences, University of Bologna, Italy patrizia.brigididi@unibo.it The Gut-Liver axis: a bidirectional relation in health and disease
6/24/2014. How do you study microbial communities? Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1. Michael T. Bailey, Ph.D.
Interactions between Diet and the Intestinal Microbiota: Implications for Obesity The Body is Colonized by an Enormous Array of Bacteria Outnumbers Cells of the Body 10:1 Outnumber Human Genes 100:1 Michael
PREBIOTIC MECHANISMS OF ACTION
PREBIOTIC MECHANISMS OF ACTION Seema Hooda, Kelly S. Swanson, George C. Fahey, Jr. Department t of Animal Sciences Division of Nutritional Sciences University of Illinois at Urbana-Champaign Institute
MICROBIOM AND OBESITY HEINZ GYAKY 2018 BUDAPEST
MICROBIOM AND OBESITY HEINZ GYAKY 2018 BUDAPEST HUMAN MICROBIOM 10 Billion bacterias are building a 1,5 2 kg heavy human microbiom It is located mainly in the human gut There is a intestinal controlled
Supplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Intestinal epithelial MyD88 deletion decreases fat mass under HFD. (a) Final fat mass expressed as a percentage of final body weight (n=25). (b)
a b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
A CENTRAL ROLE FOR MICROBIOTA IN PREGNANCY AND EARLY LIFE? Sacha Sidani, MD, FRCPC NASOM/GÉMOQ Annual Conference 2016
A CENTRAL ROLE FOR MICROBIOTA IN PREGNANCY AND EARLY LIFE? Sacha Sidani, MD, FRCPC NASOM/GÉMOQ Annual Conference 2016 Disclosure 2 Objectives Review the basic concepts of microbiota structure and function
The Gut Microbiome: 101 Justin Carlson University of Minnesota
The Gut Microbiome: 101 Justin Carlson University of Minnesota Where are we now? 360 B.C. 2003 Human Gut Microbes Associated With Obesity Ley et al., Nature. 2006. Consumer Driven Science For Better of
Exploring the link between gut microbiota and metabolic health
Food Matters Live, Nov 21-23 rd, London Exploring the link between gut microbiota and metabolic health Ellen Blaak Professor in Physiology of fat metabolism, Department of Human Biology NUTRIM School of
Stool Testing for the Microbiome - Ready for Primetime?
Stool Testing for the Microbiome - Ready for Primetime? Gillian M. Barlow, PhD Project Scientist, Medically Associated Science and Technology (MAST) Program Cedars-Sinai Medical Center Take Charge of
HOW THE MICROBIOME AFFECTS OUR HEALTH
HOW THE MICROBIOME AFFECTS OUR HEALTH THE INTESTINAL BARRIER AND INTESTINAL PERMEABILITY Intestinal Barrier: a functional body Defense from translocation of dietary antigens, bacteria or bacterial endotoxins
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments:
Supplementary Figure S1 Targeted disruption and overexpression of Gpr43 in mice. (a) A targeting vector was constructed by ligation of 3 fragments: the 5' and 3' homology recombination arms and a fragment
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease John Chiang, Ph.D. Northeast Ohio Medical University Rootstown, OH, USA International Conference
GUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH?
GUT MICROBIOME WHAT IS IT? WHY IS IT IMPORTANT FOR HUMAN HEALTH? Corrie Whisner, PhD School of Nutrition and Health Promotion Arizona State University Center for Research on Ingredient Safety Annual Meeting
Supplemental Information. Commensal Microbes Induce Serum IgA. Responses that Protect against Polymicrobial Sepsis
Cell Host & Microbe, Volume 23 Supplemental Information Commensal Microbes Induce Serum Ig Responses that Protect against Polymicrobial Sepsis Joel R. Wilmore, rian T. Gaudette, Daniela Gomez tria, Tina
Role of the Gut Microbiota in Autoimmunity
Role of the Gut Microbiota in Autoimmunity Pavan Bhargava, MD - Neuroimmunology Fellow Division of Neuroimmunology and Neurological Infections Johns Hopkins University, Baltimore, MD. May, 2015 None Disclosures
The Intestinal Microbiota and the Developing Immune System
The Intestinal Microbiota and the Developing Immune System 4 Feb 2016 The Intestinal Microbiota 10 fold more bacterial cells than human cells 100-1000 fold more bacterial genes than human genes Why does
18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
GROUP 5. Jerrold R. Turner Nathalie Delzenne Wenke Feng Reuben Wong Thierry Piche Yehuda Ringel Irina Kirpich Brant Johnson
GROUP 5 Jerrold R. Turner Nathalie Delzenne Wenke Feng Reuben Wong Thierry Piche Yehuda Ringel Irina Kirpich Brant Johnson Todd Klaenhammer Eamonn Quigley A. The Intestinal Epithelial Cell Barrier B. IEC
ZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
The A, B, C s of Bowel Flora
The A, B, C s of Bowel Flora Cynthia L. Sears, M.D. Divisions of Infectious Diseases, Gastroenterology & Tumor Immunology Departments of Medicine, Oncology & Molecular Microbiology Sidney Kimmel Comprehensive
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
Supplemental Fig. 1 A. C57BL/6 (B6) C. Number of colonies in culture media B6. B6 + Abx
A. Day C57BL/6 (B6) n=9 B6 + Abx (12 weeks) n=9 B. Supplemental Fig. 1 day 1 I/R 4min Sacrifice C. Number of colonies in culture media B6 Escherichia coli Lactbacillus spp. Lactobacillus murinus Enterococcus
Microbial Programming of the Tumor Microenvironment
PERLMUTTER CANCER CENTER Microbial Programming of the Tumor Microenvironment George Miller, MD NYU School of Medicine RCA with GSK Disclosures Co-Founder NYBO Therapeutics Inflammatory Context of Pancreatic
Structural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment
Structural modulation of the gut microbiota and the relationship with body weight: compared evaluation of liraglutide and saxagliptin treatment Lin Wang, Peicheng Li, Zhaosheng Tang, Xinfeng Yan, Bo Feng
THE ROLE OF MICROBIOME IN IBD
Disclosures THE ROLE OF MICROBIOME IN IBD Janssen UCB No relevance to the talk Subra Kugathasan, MD Professor of Pediatrics & Human Genetics Marcus Professor of Pediatric Gastroenterology Emory University
Microbiome and Asthma
제 12 차천식연구회 COPD 연구회공동심포지엄 Microbiome and Asthma 한양대학교병원호흡기알레르기내과 김상헌 Disclosure 내용 1 Lung Microbiome 2 Lung Microbiome and Asthma 3 Gut Microbiome and Asthma Microbiome and Microbiota human microbiome
Going With Your Gut: The Microbiome and You
Going With Your Gut: The Microbiome and You Robert T. Schooley, MD Professor of Medicine University of California San Diego San Diego, California Learning Objectives After attending this presentation,
Alterazioni età correlate del microbiota intestinale e fragilità Francesco Landi, MD, PhD Catholic University, Gemelli Hospital, Rome, Italy
Alterazioni età correlate del microbiota intestinale e fragilità Francesco Landi, MD, PhD Catholic University, Gemelli Hospital, Rome, Italy Aging and muscle Loss of muscle mass, strength and function
New Insights on the Structure of the Human Gut Microbiota. Chaysavanh Manichanh, PhD Vall d Hebron Research Institute Barcelona
New Insights on the Structure of the Human Gut Microbiota Chaysavanh Manichanh, PhD Vall d Hebron Research Institute Barcelona Sessio Societat Catalana Malalties Infecciosas i Microbiologia March 20th,
Il microbiota intestinale: come regola la riserva e la spesa energetica? Gerardo Nardone.
Il microbiota intestinale: come regola la riserva e la spesa energetica? Gerardo Nardone nardone@unina.it Department of Medicine and Surgery Gastroenterology Unit University Federico II, of Naples, Italy
Pro- and prebiotics as modulators of gut microbiome in management of obesity and metabolic diseases. Sampo Lahtinen, DuPont Nutrition & Health
Pro- and prebiotics as modulators of gut microbiome in management of obesity and metabolic diseases Sampo Lahtinen, DuPont Nutrition & Health 25 Jan 2016 Active Nutrition R&D team - Kantvik, Finland Characteristics
The impact of high fat dietinduced gut microbiota on circadian rhythm and obesity
The impact of high fat dietinduced gut microbiota on circadian rhythm and obesity Vanessa A. Leone, Ph.D. Postdoctoral scholar Impact of circadian dysrhythmia in gastrointestinal diseases Circadian rhythms
Mark Manary MD. International Symposium on Understanding Moderate Malnutrition in Children for Effective Interventions
Possible role of the microbiome in the development of acute malnutrition and implications for food-based strategies to prevent and treat acute malnutrition International Symposium on Understanding Moderate
Gut Microbiome Essentials
CORE COMPONENTS I: Gut Microbiome Essentials 2016 Tom Fabian, PhD Module Outline 1. Microbiome overview: getting a sense of the microbiome, research, what we know 2. Bacteria: features, functions, communities
Fecal transplantation as a treatment option for recurrent Clostridium difficile infection
Fecal transplantation as a treatment option for recurrent Clostridium difficile infection Josbert Keller Department of Gastroenterology Haga Teaching Hospital, The Hague Case: 81 yrs, CVA, recurrent UTI,
Microbiota and mental health: gut bacteria influences brain structure and behaviour. Jane A. Foster, PhD
Microbiota and mental health: gut bacteria influences brain structure and behaviour Jane A. Foster, PhD Disclosures Funding sources Industry/Academic Partnerships Gut-brain Axis Bidirectional and continual
Slide 1. Slide 2 Learning outcomes. Slide 3. Year 1 MBChB Lecture 15 Introduction to the Gut Microbiota. The importance of microbiota
Slide 1 Year 1 MBChB Lecture 15 Introduction to the Gut Microbiota Professor Barry Campbell Gastroenterology Research Unit Cellular & Molecular Physiology, Institute of Translational Medicine bjcampbl@liv.ac.uk
Microbe-Host Interactions in Inflammatory Bowel Diseases. Hera Vlamakis Oct 3, 2018
Microbe-Host Interactions in Inflammatory Bowel Diseases Hera Vlamakis Oct 3, 2018 Most of the bacteria in your body are in your gut HEALTH BENEFITS Breakdown of polysaccharides Synthesis of vitamins Colonization
9/25/2018 COPE WEBINAR SERIES FOR HEALTH PROFESSIONALS DID YOU USE YOUR PHONE TO ACCESS THE WEBINAR?
COPE WEBINAR SERIES FOR HEALTH PROFESSIONALS DID YOU USE YOUR PHONE TO ACCESS THE WEBINAR? September 26, 2018 The Gut Microbiome-Diabetes Connection Moderator: Lisa Diewald MS, RD, LDN Program Manager
Bibliografia Microbiota
Bibliografia Microbiota Systematic Review: Gut Microbiota in Fecal Samples and Detection of Colorectal Neoplasms. The role of the intestinal microbiome in ocular inflammatory disease. The gut microbiome
Bile acid is a significant host factor shaping the gut microbiome of diet-induced obese mice
Zheng et al. BMC Biology (2017) 15:120 DOI 10.1186/s12915-017-0462-7 RESEARCH ARTICLE Open Access Bile acid is a significant host factor shaping the gut microbiome of diet-induced obese mice Xiaojiao Zheng
A real life example In human studies, we quantify ~120 plasma related proteins Monocytes MMP9 Macrophages TNFα IL1ß platelet derived growth factor IFNγ MMP1 MMP8 MMP13 Myeloid Related Protein14 CD40
Functional Metagenomics and Host Metabolic Interactions in Health and Disease
Merieux, September 8 th 2011 Functional Metagenomics and Host Metabolic Interactions in Health and Disease Jeremy K. Nicholson Head of Department of Surgery and Cancer Faculty of Medicine Supraorganisms
The role of intestinal microbiota in metabolic disease-a novel therapeutic target.
Michael Connolly Department of Food Biosciences, The University of Reading The role of intestinal microbiota in metabolic disease-a novel therapeutic target. University of Reading 2008 www.reading.ac.uk
Next generation of probiotics
Session: Evaluating next generation ingredients to support digestive health Wednesday 23 rd November 2016 Next generation of probiotics Louise R Wilson RD PhD Assistant Science Manager, Yakult UK Ltd LWilson@yakult.co.uk
Gut Microbes as Participants and Targets in Cardiometabolic Diseases
Gut Microbes as Participants and Targets in Cardiometabolic Diseases Stanley L Hazen, MD, PhD Section Head, Preventive Cardiology, Cleveland Clinic Chair, Dept. of Cellular & Molecular Medicine, Lerner
The Human Gut Microbiome and Body Metabolism: Implications for Obesity and Diabetes
Clinical Chemistry 59:4 617 628 (2013) Review The Human Gut Microbiome and Body Metabolism: Implications for Obesity and Diabetes Sridevi Devaraj, 1,2 Peera Hemarajata, 1,2 and James Versalovic 1,2* BACKGROUND:
Session 4: the secrets of the microbiome
Session 4: the secrets of the microbiome Dr. Neil Lamb, Vice President for Educational Outreach sponsored by http://bearsbutt.com/2013/12/27/let-the-2013-ice-fishing-begin/ istock photo istock photo Correlation
Hygiene Hypothesis: 10 years later. Christina Ciaccio MD, MSc Assistant Professor The University of Chicago
Hygiene Hypothesis: 10 years later Christina Ciaccio MD, MSc Assistant Professor The University of Chicago none Disclosures Definitions Microbe: Microscopic organism Microbiota: Microbial community Definition
The gut microbiome in cardio-metabolic health
Hansen et al. Genome Medicine (2015) 7:33 DOI 10.1186/s13073-015-0157-z REVIEW Open Access The gut microbiome in cardio-metabolic health Tue H Hansen 1, Rikke J Gøbel 1, Torben Hansen 1,2 and Oluf Pedersen
BREAKTHROUGH SOLUTION TO ADDRESS PET OBESITY
BREAKTHROUGH SOLUTION TO ADDRESS PET OBESITY A NATURAL SOLUTION FROM GnuBiotics Sciences 1st product is GNU100, which is a Microbiota Accessible Carbohydrate (MAC) that serves as a dense protective barrier
Human Microbiome in state of health and illness.
Human Microbiome in state of health and illness. Objectives: 1) To recognize what fuels the plaque of Century 2) To understand the interaction between microbiome and human in health and disease states(dysbiosis)
OBESITY AND THE CONNECTION TO THE GUT
OBESITY AND THE CONNECTION TO THE GUT Weight Loss Most weight loss programs are based on calorie in = calorie out Does not matter how they are dressed up Most of these plans being healthier foods to people
Benakis et al. Supplementary Figure 1
Benakis et al. Supplementary Figure a flora Naive C7BL/ d AC weeks d S rrna sequencing Antibiotic in drinking water Stool pellet collection riginal seeder flora flora Naive C7BL/ d AC weeks d S rrna sequencing
Module Outline. 1. Microbiome overview: getting a sense of the microbiome, research, what we know
Module Outline 1. Microbiome overview: getting a sense of the microbiome, research, what we know 2. Bacteria: features, functions, communities & taxonomy 3. Other microbes: archaea, fungi, viruses, parasites
Manuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs
Journal name: Applied Microbiology and Biotechnology Manuscript Title: Responses in ileal and cecal bacteria to low and high amylose/amylopectin ratio diets in growing pigs The names of the authors: Yu-heng
Accepted Article Preview: Published ahead of advance online publication
Accepted Article Preview: Published ahead of advance online publication Omega-3 fatty acids prevent early-life antibiotic exposureinduced gut microbiota dysbiosis and later-life obesity K Kaliannan, B
Bifidobacterium animalis ssp. lactis Metagenics Institute. All Rights Reserved.
Bifidobacterium animalis ssp. lactis 420 Outline The clinical problem o BMI in Canadian population o Weight gain/regain patterns Microbiome and body weight regulation Development pathway of B420 B420 mechanisms
Supplementary Figures
Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,
Breastfeeding and the Microbiome
Breastfeeding and the Microbiome JENNY WALTERS MPH, IBCLC Objectives At the conclusion of this session, participants will be able to: Identify ways the microbiota is passed from mother to baby Identify
Examining the effects of pre and probiotics on gut microbiota during the ageing process
Session: Reviewing key ingredients shaping nutrition for healthy ageing Tuesday 22 nd November 2016 Examining the effects of pre and probiotics on gut microbiota during the ageing process Louise R Wilson
Gut Lung Axis Implication of the Gut Microbiota beyond its niche
Gut Lung Axis Implication of the Gut Microbiota beyond its niche Reema Subramanian PhD Candidate (4 th year) Supervisor: Prof. Margaret Ip Department of Microbiology, CUHK Joint Graduate Student Seminar
EPIDEMIOLOGICAL INVESTIGATIONS IN UNDERSTANDING HEALTH IMPACTS OF HUMAN BUILT ENVIRONMENT INTERACTIONS
EPIDEMIOLOGICAL INVESTIGATIONS IN UNDERSTANDING HEALTH IMPACTS OF HUMAN BUILT ENVIRONMENT INTERACTIONS JOANNE E. SORDILLO, SCD HARVARD MEDICAL SCHOOL, BRIGHAM AND WOMEN S HOSPITAL CHANNING DIVISION OF
OKLAHOMA STATE UNIVERSITY FINAL REPORT. Title of Study: Understanding how mango affects glucose homeostasis in type 2 diabetes
OKLAHOMA STATE UNIVERSITY FINAL REPORT Title of Study: Understanding how mango affects glucose homeostasis in type 2 diabetes Principal Investigator: Dr. Edralin A. Lucas Nutritional Sciences Department
2200 GI Effects Comprehensive Profile Stool Interpretation At-a-Glance
P: 1300 688 522 E: info@nutripath.com.au A: PO Box 442 Ashburton VIC 3142 TEST PATIENT Sample Test Name Sex : F Date Collected : 00-00-0000 111 TEST ROAD TEST SUBURB LAB ID: 00000000 UR#:0000000 TEST PHYSICIAN
Microbiome as a marker for CRC screening
WEO CRC Screening Committee Meeting Microbiome as a marker for CRC screening Dr Sunny H Wong MBChB (Hons), DPhil, MRCP, FHKCP, FHKAM (Medicine) Assistant Professor Institute of Digestive Disease Department
The role of nutrition in optimum gastrointestinal health
The role of nutrition in optimum gastrointestinal health Kelly A. Tappenden, Ph.D., R.D., FASPEN Kraft Foods Human Nutrition Endowed Professor University Distinguished Teacher-Scholar University of Illinois
What are probiotics? How do probiotics benefit health?
The culture club So, you re clean eating, gluten free, fasting, eating avocados like their going out of fashion, chugging down green juices with the latest wonder powders and using coconut oil to cook
4/17/2019 DISCLOSURES OBJECTIVES GI MICROBIOME & HEALTH: A REVIEW. Nancy C. Kois, MD, FCAP Contemporary Pathology Services. There are no disclosures
GI MICROBIOME & HEALTH: A REVIEW Nancy C. Kois, MD, FCAP Contemporary Pathology Services DISCLOSURES There are no disclosures OBJECTIVES Definitions: GI microbiota, GI microbiome, probiotic, prebiotic
2/13/2018. What s bugging you? Relevance of the Human Microbiome in Health and Disease Heidi H. Kong, MD, MHSc, FAAD Dermatology Branch
What s bugging you? Relevance of the Human Microbiome in Health and Disease Heidi H. Kong, MD, MHSc, FAAD Dermatology Branch DISCLOSURE OF RELATIONSHIPS WITH INDUSTRY Heidi H Kong, MD, MHSc, FAAD U017:
ISSN: (Print) (Online) Journal homepage:
Gut Microbes ISSN: 1949-0976 (Print) 1949-0984 (Online) Journal homepage: http://www.tandfonline.com/loi/kgmi20 The structures of the colonic mucosa-associated and luminal microbial communities are distinct
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
Impact of Sleep Deprivation Stress in Promoting Sensitization of the Trigeminal System
Impact of Sleep Deprivation Stress in Promoting Sensitization of the Trigeminal System Functions of Sleep Fatigue reversal - allows individual to recover and reenergize Biochemical refreshment - promotes
The vital role of the microbiome in human health
The vital role of the microbiome in human health abandoning hygiene is not the way to a healthy microbiome Colin Hill APC Microbiome Institute University College Cork @colinhillucc Mixed messages? We live
Metabolomics and systems biology approaches to study health and disease. Matej Oreši
Metabolomics and systems biology approaches to study health and disease Matej Oreši 14.12.2011 1/19/2012 2 Biomarker concept in domain of human health [Wikipedia definition] A substance used as an indicator